A subtelomeric satellite DNA family isolated from the genome of the dioecious plant Silene latifolia

Genome ◽  
1999 ◽  
Vol 42 (3) ◽  
pp. 442-446 ◽  
Author(s):  
M A Garrido-Ramos ◽  
R de la Herrán ◽  
M Ruiz Rejón ◽  
C Ruiz Rejón
Keyword(s):  
Sex Chromosomes ◽  
Dna Sequences ◽  
Satellite Dna ◽  
Consensus Sequence ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Repeat Sequence ◽  
Silene Latifolia ◽  
Telomere Repeat ◽  
Significant Length

In an ongoing effort to trace the evolution of the sex chromosomes of Silene latifolia, we have searched for the existence of repetitive sequences specific to these chromosomes in the genome of this species by direct isolation from low-melting agarose gels of satellite DNA bands generated by digestion with restriction enzymes. Five monomeric units belonging to a highly repetitive family isolated from Silene latifolia, the SacI family, have been cloned and characterized. The consensus sequence of the repetitive units is 313 bp in length (however, high variability exists for monomer length variants) and 52.9% in AT. Repeating units are tandemly arranged at the subtelomeric regions of the chromosomes in this species. The sequence does not possess direct or inverted sequences of significant length, but short direct repeats are scattered throughout the monomer sequence. Several short sequence motives resemble degenerate monomers of the telomere repeat sequence of plants (TTTAGGG), confirming a tight association between this subtelomeric satellite DNA and the telomere repeats. Our approach in this work confirms that SacI satellite DNA sequences are among the most abundant in the genome of S. latifolia and, on the other hand, that satellite DNA sequences specific of sex chromosomes are absent in this species. This agrees with a sex determination system less cytogenetically diverged from a bisexual state than the system present in other plant species, such as R. acetosa, or at least a lesser degree of differentiation between the sex chromosomes of S. latifolia and the autosomes.Key words: satellite DNA, sex chromosomes, Silene latifolia, subtelomeric sequences.

Great Abundance of Satellite DNA in Proceratophrys (Anura, Odontophrynidae) Revealed by Genome Sequencing

2020 ◽  
Vol 160 (3) ◽  
pp. 141-147 ◽  
Author(s):  
Marcelo J. da Silva ◽  
Raquel Fogarin Destro ◽  
Thiago Gazoni ◽  
Hideki Narimatsu ◽  
Paulo S. Pereira dos Santos ◽  
...  
Keyword(s):  
Repetitive Dna ◽  
Sex Chromosomes ◽  
Dna Sequences ◽  
Satellite Dna ◽  
Sex Chromosome ◽  
Repetitive Sequences ◽  
Centromere Function ◽  
Sex Chromosome System ◽  
First Time ◽  
Eukaryotic Genomes

Most eukaryotic genomes contain substantial portions of repetitive DNA sequences. These are located primarily in highly compacted heterochromatin and, in many cases, are one of the most abundant components of the sex chromosomes. In this sense, the anuran Proceratophrys boiei represents an interesting model for analyses on repetitive sequences by means of cytogenetic techniques, since it has a karyotype with large blocks of heterochromatin and a ZZ/ZW sex chromosome system. The present study describes, for the first time, families of satellite DNA (satDNA) in the frog P. boiei. Its genome size was estimated at 1.6 Gb, of which 41% correspond to repetitive sequences, including satDNAs, rDNAs, transposable elements, and other elements characterized as non-repetitive. The satDNAs were mapped by FISH in the centromeric and pericentromeric regions of all chromosomes, suggesting a possible involvement of these sequences in centromere function. SatDNAs are also present in the W sex chromosome, occupying the entire heterochromatic area, indicating a probable contribution of this class of repetitive DNA to the differentiation of the sex chromosomes in this species. This study is a valuable contribution to the existing knowledge on repetitive sequences in amphibians. We show the presence of repetitive DNAs, especially satDNAs, in the genome of P. boiei that might be of relevance in genome organization and regulation, setting the stage for a deeper functional genome analysis of Proceratophrys.

scholarly journals Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

2000 ◽  
Vol 35 (10) ◽  
pp. 2007-2015
Author(s):  
CARLOS EDUARDO ANUNCIAÇÃO ◽  
SPARTACO ASTOLFI-FILHO
Keyword(s):  
Human Genome ◽  
Dna Fingerprinting ◽  
Dna Sequences ◽  
Genomic Dna ◽  
Genomic Library ◽  
Consensus Sequence ◽  
Repetitive Sequences ◽  
Restriction Enzymes ◽  
Paternity Test ◽  
Paternity Tests

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Enhancement of telomere-plasmid segregation by the X-telomere associated sequence in Saccharomyces cerevisiae involves SIR2, SIR3, SIR4 and ABF1.

Genetics ◽  
1994 ◽  
Vol 136 (3) ◽  
pp. 757-767 ◽  
Author(s):  
S Enomoto ◽  
M S Longtine ◽  
J Berman
Keyword(s):  
Binding Site ◽  
Consensus Sequence ◽  
Active Role ◽  
Repeat Sequence ◽  
Dependent Manner ◽  
Enhancer Element ◽  
Telomere Repeat ◽  
Plasmid Segregation ◽  
Telomere Function ◽  
Associated Sequences

Abstract We have previously shown that circular replicating plasmids that carry yeast telomere repeat sequence (TG1-3) tracts segregate efficiently relative to analogous plasmids lacking the TG1-3 tract and this efficient segregation is dependent upon RAP1. While a long TG1-3 tract is sufficient to improve plasmid segregation, the segregation efficiency of telomere plasmids (TEL-plasmids) is enhanced when the X-Telomere Associated Sequence (X-TAS) is also included on the plasmids. We now demonstrate that the enhancement of TEL-plasmid segregation by the X-TAS depends on SIR2, SIR3, SIR4 and ABF1 in trans and requires the Abf1p-binding site within the X-TAS. Mutation of the Abf1p-binding site within the X-TAS results in TEL-plasmids that are no longer affected by mutations in SIR2, SIR3 or SIR4, despite the fact that other Abf1p-binding sites are present on the plasmid. Mutation of the ARS consensus sequence within the X-TAS converts the X-TAS from an enhancer element to a negative element that interferes with TEL-plasmid segregation in a SIR-dependent manner. Thus, telomere associated sequences interact with TG1-3 tracts on the plasmid, suggesting that the TASs have an active role in modulating telomere function.

Isolation and characterization of a satellite DNA family in the Saccharum complex

Genome ◽  
1998 ◽  
Vol 41 (6) ◽  
pp. 854-864 ◽  
Author(s):  
Karine Alix ◽  
Franc-Christophe Baurens ◽  
Florence Paulet ◽  
Jean-Christophe Glaszmann ◽  
Angélique D'Hont
Keyword(s):  
In Situ Hybridization ◽  
Fluorescence In Situ Hybridization ◽  
Satellite Dna ◽  
Repetitive Sequences ◽  
Repeat Sequence ◽  
Miscanthus Sinensis ◽  
Saccharum Complex ◽  
Satellite Dnas ◽  
Isolation And Characterization

EaCIR1, a 371-bp Erianthus-specific satellite DNA sequence, was cloned from TaqI restricted genomic DNA after agarose-gel electrophoresis. This sequence has 77% homology with a 365-bp satellite of Helictotrichon convolutum and 72% homology with a 353-bp tandem repeat sequence from Oryza sativa. PCR primers defined in the conserved regions of these repetitive sequences were used to isolate other satellite DNAs in different representatives of the Saccharum complex: SoCIR1 in Saccharum officinarum, SrCIR1 in Saccharum robustum, SsCIR1 and SsCIR2 in Saccharum spontaneum, and MsCIR1 in Miscanthus sinensis. EaCIR1 and SoCIR1 were localized to subtelomeric regions of the chromosomes by fluorescence in situ hybridization. Southern hybridization experiments, using two representatives of this repeat sequence family as probes, illustrated contrasting species-specificity and demonstrated the existence of similar repetitive elements in sorghum and maize.Key words: satellite DNA, sugarcane, Saccharum complex, Gramineae, fluorescence in situ hybridization, FISH.

scholarly journals A sequence-specific DNA binding small molecule triggers the release of immunogenic signals and phagocytosis in a model of B-cell lymphoma

2015 ◽  
Vol 48 (4) ◽  
pp. 453-464 ◽  
Author(s):  
JeenJoo S. Kang ◽  
Peter B. Dervan
Keyword(s):  
Cell Death ◽  
B Cell ◽  
Cancer Cells ◽  
Dna Sequences ◽  
Cell Lymphoma ◽  
B Cell Lymphoma ◽  
Repeat Sequence ◽  
Immunogenic Cell Death ◽  
Telomere Repeat ◽  
Molecular Patterns

AbstractMeans to cause an immunogenic cell death could lead to significant insight into how cancer escapes immune control. In this study, we screened a library of five pyrrole–imidazole polyamides coding for different DNA sequences in a model of B-cell lymphoma for the upregulation of surface calreticulin, a pro-phagocytosis signal implicated in immunogenic cell death. We found that hairpin polyamide 1 triggers the release of the damage-associated molecular patterns calreticulin, ATP and HMGB1 in a slow necrotic-type cell death. Consistent with this signaling, we observed an increase in the rate of phagocytosis by macrophages after the cancer cells were exposed to polyamide 1. The DNA sequence preference of polyamide 1 is 5′-WGGGTW-3′ (where W = A/T), indicated by the pairing rules and confirmed by the Bind-n-Seq method. The close correspondence of this sequence with the telomere-repeat sequence suggests a potential mechanism of action through ligand binding at the telomere. This study reveals a chemical means to trigger an inflammatory necrotic cell death in cancer cells.

Laser isolation of plant sex chromosomes: studies on the DNA composition of the X and Y sex chromosomes of Silene latifolia

Genome ◽  
1997 ◽  
Vol 40 (5) ◽  
pp. 705-715 ◽  
Author(s):  
Charles P. Scutt ◽  
Yasuko Kamisugi ◽  
Philip M. Gilmartin ◽  
Fukumi Sakai
Keyword(s):  
In Situ Hybridization ◽  
Sex Chromosomes ◽  
Dna Sequences ◽  
Sex Chromosome ◽  
Silene Latifolia ◽  
Dioecious Species ◽  
Mitotic Metaphase Chromosome ◽  
Degenerate Oligonucleotide ◽  
Plant Sex Chromosomes

X and Y sex chromosomes from the dioecious plant Silene latifolia (white campion) were isolated from mitotic metaphase chromosome preparations on polyester membranes. Autosomes were ablated using an argon ion laser microbeam and isolated sex chromosomes were then recovered on excised fragments of polyester membrane. Sex chromosome associated DNA sequences were amplified using the degenerate oligonucleotide primed polymerase chain reaction (DOP–PCR) and pools of DOP–PCR products were used to investigate the genomic organization of the S. latifolia sex chromosomes. The chromosomal locations of cloned sex chromosome repeat sequences were analysed by fluorescence in situ hybridization and data complementary to laser ablation studies were obtained by genomic in situ hybridization. In combination, these studies demonstrate that the X and Y sex chromosomes of S. latifolia are of very similar DNA composition and also that they share a significant repetitive DNA content with the autosomes. The evolution of sex chromosomes in Silene is discussed and compared with that in another dioecious species, Rumex acetosa.Key words: FISH, GISH, laser-microdissection, sex chromosome, Silene latifolia.

scholarly journals Chromosomal Mapping of Repetitive DNAs in Characidium (Teleostei, Characiformes): Genomic Organization and Diversification of ZW Sex Chromosomes

2015 ◽  
Vol 146 (2) ◽  
pp. 136-143 ◽  
Author(s):  
Priscilla C. Scacchetti ◽  
Ricardo Utsunomia ◽  
José C. Pansonato-Alves ◽  
Marcelo R. Vicari ◽  
Roberto F. Artoni ◽  
...  
Keyword(s):  
Sex Chromosomes ◽  
Dna Sequences ◽  
Sex Chromosome ◽  
Repetitive Sequences ◽  
5S Rdna ◽  
Chromosome Mapping ◽  
Chromosomal Mapping ◽  
Specific Probe ◽  
W Chromosome ◽  
Sex Chromosome System

The speciose neotropical genus Characidium has proven to be a good model for cytogenetic exploration. Representatives of this genus often have a conserved diploid chromosome number; some species exhibit a highly differentiated ZZ/ZW sex chromosome system, while others do not show any sex-related chromosome heteromorphism. In this study, chromosome painting using a W-specific probe and comparative chromosome mapping of repetitive sequences, including ribosomal clusters and 4 microsatellite motifs - (CA)15, (GA)15, (CG)15, and (TTA)10 -, were performed in 6 Characidium species, 5 of which possessed a heteromorphic ZW sex chromosome system. The W-specific probe showed hybridization signals on the W chromosome of all analyzed species, indicating homology among the W chromosomes. Remarkably, a single major rDNA-bearing chromosome pair was found in all species. The 18S rDNA localized to the sex chromosomes in C. lanei, C. timbuiense and C. pterostictum, while the major rDNA localized to one autosome pair in C. vidali and C. gomesi. In contrast, the number of 5S rDNA-bearing chromosomes varied. Notably, minor ribosomal clusters were identified in the W chromosome of C. vidali. Microsatellites were widely distributed across almost all chromosomes of the karyotypes, with a greater accumulation in the subtelomeric regions. However, clear differences in the abundance of each motif were detected in each species. In addition, the Z and W chromosomes showed the differential accumulation of distinct motifs. Our results revealed variability in the distribution of repetitive DNA sequences and their possible association with sex chromosome diversification in Characidium species.

scholarly journals Genome-Wide Analysis of Transposable Elements and Satellite DNAs in Spinacia Species to Shed Light on Their Roles in Sex Chromosome Evolution

2021 ◽  
Vol 11 ◽  
Author(s):  
Ning Li ◽  
Xiaoyue Li ◽  
Jian Zhou ◽  
Li’ang Yu ◽  
Shufen Li ◽  
...  
Keyword(s):  
Sugar Beet ◽  
Sex Chromosomes ◽  
Dna Sequences ◽  
Chromosome Evolution ◽  
Sex Chromosome ◽  
Repetitive Sequences ◽  
Chromosome 1 ◽  
Sex Chromosome Evolution ◽  
Satellite Dnas ◽  
Heteromorphic Sex Chromosomes

Sex chromosome evolution has mostly been studied in species with heteromorphic sex chromosomes. The Spinacia genus serves as an ideal model for investigating evolutionary mechanisms underlying the transition from homomorphic to heteromorphic sex chromosomes. Among evolutionary factors, repetitive sequences play multiple roles in sex chromosome evolution while their forces have not been fully explored in Spinacia species. Here, we identified major repetitive sequence classes in male and female genomes of Spinacia species and their ancestral relative sugar beet to elucidate the evolutionary processes of sex chromosome evolution using next-generation sequencing (NGS) data. Comparative analysis revealed that the repeat elements of Spinacia species are considerably higher than of sugar beet, especially the Ty3/Gypsy and Ty1/Copia retrotransposons. The long terminal repeat retroelements (LTR) Angela, Athila, and Ogre may be accounted for the higher proportion of repeats in the spinach genome. Comparison of the repeats proportion between female and male genomes of three Spinacia species indicated the different representation in Spinacia tetrandra samples but not in the S. oleracea or S. turkestanica samples. From these results, we speculated that emergence of repetitive DNA sequences may correlate the formation of sex chromosome and the transition from homomorphic sex chromosomes to heteromorphic sex chromosomes as heteromorphic sex chromosomes exclusively existed in Spinacia tetrandra. Three novel sugar beet-specific satellites were identified and confirmed by fluorescence in situ hybridization (FISH); six out of eight new spinach-specific satellites were mapped to the short arm of sex chromosomes. A total of 141 copies of SolSat01-171-s were found in the sex determination region (SDR). Thus, the accumulation of satellite DNA on the short arm of chromosome 1 may be involved in the sex chromosome evolution in Spinacia species. Our study provides a fundamental resource for understanding repeat sequences in Spinacia species and their roles in sex chromosome evolution.

An AT-rich satellite DNA sequence, E180, in alfalfa (Medicago sativa)

Genome ◽  
1993 ◽  
Vol 36 (3) ◽  
pp. 427-432 ◽  
Author(s):  
X. Xia ◽  
L. Erickson
Keyword(s):  
Medicago Sativa ◽  
Dna Sequence ◽  
Repetitive Dna ◽  
Dna Sequences ◽  
Satellite Dna ◽  
Nuclear Dna ◽  
Consensus Sequence ◽  
Repeated Dna Sequence ◽  
Dna Fragment ◽  
High Degree

A DNA fragment of ~750 bp was cloned from EcoRI-digested nuclear DNA of alfalfa (Medicago sativa). Southern blot and sequence analysis showed that the cloned DNA fragment represents a tetramer of a highly tandemly repeated DNA sequence of 185–188 bp (E180). The consensus sequence deduced from the four repeating units is 189 bp in length with an AT content of 67%. The copy number of the satellite DNA was estimated to be ~1.8 × 105 per genome and constitutes about 1% of the alfalfa genome. Sequence comparison revealed no identity to any repetitive DNA sequences that have been published to date. Digestion with HpaII and MspI indicated a high degree of methylation at the internal C of the restriction site CCGG within E180.Key words: alfalfa, Medicago, repetitive DNA sequence, satellite DNA.

scholarly journals Satellite DNA induces unstable expression of the adjacent herpes simplex virus tk gene cotransfected in mouse cells.

1988 ◽  
Vol 8 (3) ◽  
pp. 1336-1344 ◽  
Author(s):  
D Talarico ◽  
A F Peverali ◽  
E Ginelli ◽  
R Meneveri ◽  
C Mondello ◽  
...  
Keyword(s):  
Herpes Simplex Virus ◽  
Herpes Simplex ◽  
Dna Sequences ◽  
Satellite Dna ◽  
Repetitive Sequences ◽  
Metaphase Chromosomes ◽  
Highly Repetitive Dna ◽  
Cellular Dna ◽  
Mouse Satellite Dna ◽  
Simplex Virus

To study the influence of clustered highly repetitive DNA sequences on the expression of adjacent genes, LTK- cells were cotransfected with the herpes simplex virus thymidine kinase (tk) gene and mouse satellite DNA. TK+ transformants containing a few copies of the tk genes flanked by satellite DNA were isolated. In situ hybridization on the metaphase chromosomes indicated that in each cell line the TK sequences resided at a single chromosomal site and that integration occurred preferentially into regions of the cellular DNA rich in highly repetitive sequences. The prominent feature of these cell lines was their phenotypic instability. Suppression and reexpression of the tk gene occurred at high frequency (greater than 3%) and did not correlate with any significant change in the organization of foreign DNA or with the presence of selective agents. These results indicate that satellite DNA, the major component of constitutive heterochromatin, may influence the expression of adjacent genes by affecting the chromatin structure.

Sign in / Sign up

Export Citation Format

Share Document