scholarly journals Diversity and Molecular Characterization of Mosquitoes (Diptera: Culicidae) in Selected Ecological Regions in Kenya.

F1000Research ◽  
2019 ◽  
Vol 8 ◽  
pp. 262
Author(s):  
Moni Makanda ◽  
Gladys Kemunto ◽  
Lucy Wamuyu ◽  
Joel Bargul ◽  
Jackson Muema ◽  
...  
Keyword(s):  
Cytochrome Oxidase ◽  
Molecular Characterization ◽  
Mosquito Species ◽  
Molecular Genetic ◽  
Cytochrome Oxidase Subunit ◽  
Valley Fever ◽  
Genetic Characteristics ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1

Mosquitoes play a predominant role as leading agents in the spread of vector-borne diseases and the consequent mortality in humans. Despite reports on increase of new and recurrent mosquito borne-disease outbreaks such as chikungunya, dengue fever and Rift Valley fever in Kenya, little is known about the genetic characteristics and diversity of the vector species that have been incriminated in transmission of disease pathogens. In this study,  mosquito species were collected from Kisumu city, Kilifi town and Nairobi city and we determined their genetic diversity and phylogenetic relationships. PCR was used to amplify the partial cytochrome oxidase subunit 1 (CO1) gene of mosquito samples. Molecular-genetic and phylogenetic analysis of the partial cytochrome oxidase subunit 1 (CO1) gene were employed to identify their relationship with known mosquito species. Fourteen (14) haplotypes belonging to genus Aedes, nine (9) haplotypes belonging to genus Anopheles and twelve (12) haplotypes belonging to genus Culex were identified in this study. Findings from this study revealed a potentially new haplotype belonging to Anopheles genus and reported the first molecular characterization of Aedes cumminsii in Kenya. Sequence results revealed variation in mosquito species from Kilifi, Kisumu and Nairobi. Since vector competence varies greatly across species as well as species-complexes and is strongly associated with specific behavioural adaptations, proper species identification is important for vector control programs.

scholarly journals Diversity and Molecular Characterization of Mosquitoes (Diptera: Culicidae) in selected ecological regions in Kenya.

F1000Research ◽  
2019 ◽  
Vol 8 ◽  
pp. 262 ◽  
Author(s):  
Moni Makanda ◽  
Gladys Kemunto ◽  
Lucy Wamuyu ◽  
Joel Bargul ◽  
Jackson Muema ◽  
...  
Keyword(s):  
Cytochrome Oxidase ◽  
Molecular Characterization ◽  
Mosquito Species ◽  
Molecular Genetic ◽  
Cytochrome Oxidase Subunit ◽  
Valley Fever ◽  
Genetic Characteristics ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1

Mosquitoes play a predominant role as leading agents in the spread of vector-borne diseases and consequent mortality in humans. Despite reports on increase of new and recurrent mosquito borne-disease outbreaks such as chikungunya, dengue fever and Rift valley fever in Kenya little is known about the genetic characteristics and diversity of the vector species that have been incriminated in transmission of disease pathogens. In this study, we identified mosquito species across Kisumu, Kilifi and Nairobi Counties and determined their genetic diversity and phylogenetic relationships. PCR was used to amplify and sequence the partial cytochrome oxidase subunit 1 (CO1) gene of mosquito samples. Molecular-genetic and phylogenetic analysis of the partial cytochrome oxidase subunit 1 (CO1) gene was employed to identify their relationships with known mosquito species. Fourteen (14) haplotypes belonging to genus Aedes, nine (9) haplotypes belonging to genus Anopheles and twelve (12) haplotypes belonging to genus Culex were identified in this study. Findings from this study revealed a potentially new haplotype belonging to Anopheles genus and reported the first molecular characterization of Aedes cummnisii in Kenya. Sequence results revealed variation in mosquito species from Kilifi, Kisumu and Nairobi. Since vector competence varies greatly across species and species-complexes and is strongly associated with specific behavioural adaptations, proper species identification is important for vector control programs.

scholarly journals Sequence Analysis of Mitochondrial DNAs of 12S rRNA, 16S rRNA, and Cytochrome Oxidase Subunit 1(COI) Regions in Slow Lorises (Genus Nycticebus) May Contribute to Improved Identification of Confiscated Specimens

ISRN Zoology ◽  
2012 ◽  
Vol 2012 ◽  
pp. 1-8 ◽  
Author(s):  
Hiroko Somura ◽  
Hiroshi Hori ◽  
Yoshinobu Manome
Keyword(s):  
16S Rrna ◽  
Cytochrome Oxidase ◽  
Dna Analysis ◽  
12S Rrna ◽  
Cytochrome Oxidase Subunit ◽  
Slow Loris ◽  
Oxidase Subunit ◽  
Mitochondrial Dnas ◽  
Cytochrome Oxidase Subunit 1 ◽  
Rrna 16S

The slow loris (Nycticebus) is a prosimian that is popular among exotic pet lovers. In Japan, many slow lorises have been imported illegally. Prosimians that have been confiscated in raids are protected in Japanese zoos, and the number of such animals has increased. In most cases, the country of origin remains unknown and even the species can be difficult to identify from the animal’s physical appearance alone. We have attempted to resolve this problem by using DNA analysis. DNA samples of five species, consisting of the Pygmy slow loris (Nycticebus pygmaeus), Bengal slow loris (Nycticebus bengalensis), Sunda slow loris (Nycticebus coucang), Javan slow loris (Nycticebus javanicus), and Bornean slow loris (Nycticebus menagensis), were extracted, amplified, and the nucleotide sequences of mitochondrial 12S rRNA, 16S rRNA, and the cytochrome oxidase subunit 1(COI) regions were compared. Differences of nucleic acid sequences of representative individuals were demonstrated.

scholarly journals Identifikasi sirip ikan hiu yang didapat dari pengumpul di Minahasa Tenggara menggunakan DNA Barcode

2017 ◽  
Vol 5 (1) ◽  
pp. 62
Author(s):  
Andre Wehantouw ◽  
Elvy Ginting ◽  
Stenly Wullur
Keyword(s):  
Cytochrome Oxidase ◽  
Dna Barcode ◽  
Cytochrome Oxidase Subunit ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1 ◽  
Triaenodon Obesus

Populasi ikan hiu global menunjukkan penurunan yang signifikan karena; penangkapan yang masif dan tak terkontrol, karakter biologi reproduksi yang lambat serta fekunditas yang rendah.  Indonesia merupakan salah satu negara kontributor terbesar dalam perdagangan sirip ikan hiu dunia. Tingginya aktifitas perdagangan sirip tersebut berpengaruh terhadap populasi ikan hiu dan berdampak pada turunnya kualitas keseimbangan ekosistem laut. Tujuan penelitian ini untuk mengidentifikasi ikan hiu dari potongan sirip yang didapat dari pengumpul di Tumbak, Minahasa Tenggara menggunakan DNA barcode.  Ekstraksi DNA genom sirip hiu kering dilakukan dengan menggunakan prosedur DNeasy Blood & Tissue kit, amplifikasi gen Cytochrome Oxidase Subunit 1 (COI) dilakukan dengan menggunakan primer Fish BCL5 (TCAACYAATCAYAAAGATATYGGCAC) dan HCO2198 (TAAACTTCAGGGTGACCAAAAAA TCA). Pengolahan data sekuens dilakukan dengan menggunakan program ABsequence3 dan MEGA ver 6.  Pencocokan karakter nukleotida gen COI dilakukan dengan menggunakan program nBLAST yang terintegrasi pada laman GenBank. Sampel sirip yang berhasil dikoleksi berasal dari 4 individu yang berbeda.  Hasil nBLAST menunjukkan bahwa keempat sampel sirip hiu tersebut teridentifikasi sebagai spesies Triaenodon obesus.  Nilai keakuratan pensejajaran sekuens, nilai dugaan, prosentase panjang nukleotida yang selaras, dan prosentase tingkat kemiripan, masing-masing pada nilai antara 604-1245, 0.0, 70-99% dan 92-99%.

scholarly journals Molecular identification of Ergalatax contracta from Yeongdo island, Korea

2021 ◽  
pp. 96-98
Author(s):  
Yangrae Rho ◽  
◽  
Hoyeon Lee ◽  
Hiyoung Kim ◽  
Inho Yang ◽  
...  
Keyword(s):  
Cytochrome Oxidase ◽  
Molecular Identification ◽  
Genomic Dna ◽  
Sequencing Analysis ◽  
Accession Number ◽  
Cytochrome Oxidase Subunit ◽  
Oxidase Subunit ◽  
Cytochrome Oxidase Subunit 1

The current study reports the cytochrome oxidase subunit 1 sequence of Gastropoda Ergalatax contracta from Busan, Korea. Four specimens were collected and extracted to obtain genomic DNA for the sequencing analysis. This is the first E. contracta sequence from Korea submitted to the NCBI for an accession number.

Sign in / Sign up

Export Citation Format

Share Document