scholarly journals Relative resistance to Rice yellow mottle virus in rice 

2014 ◽  
Vol 50 (No. 1) ◽  
pp. 1-8 ◽  
Author(s):  
M.T. Salaudeen
Keyword(s):  
Agronomic Traits ◽  
Disease Incidence ◽  
Mottle Virus ◽  
High Yield ◽  
Rice Yellow Mottle Virus ◽  
Rice Cultivars ◽  
Progress Curve ◽  
Breeding Programmes ◽  
Yellow Mottle ◽  
Paddy Yield

We identified sources of Rice yellow mottle virus (RYMV) resistance in rice cultivars. Eight cultivars together with susceptible and resistant controls were evaluated under screenhouse conditions as inoculated and uninoculated treatment in completely randomised design with three replications. Seedlings were inoculated with the virus by sap transmission at two weeks after sowing. Disease incidence and severity (scale 1–9: 1–3 = green leaves with sparse dots or streaks, 9 = yellow or orange leaves and some plant dead), yield, and agronomic traits were recorded. Data analyses included Area Under the Disease Progress Curve (AUDPC), independent t-test, and Analysis of Variance. According to differences in most measured traits control cultivars FARO 29 and Gigante were proved to be the most susceptible and partially tolerant ones, respectively. Cvs FARO 12, FARO 17, FARO 37, and FARO 52 were classified as partially tolerant. Uninoculated control plants performed better than the inoculated for all the yield and agronomic parameters. Reduction in plant height (6%) and number of tillers per plant (4.8%), increased days to heading (3 days), and reduction in paddy yield (6.5%) was lowest in cv. Gigante. Paddy yield per plant of the RYMV-inoculated was the highest in cv. Gigante (2.4 g). The rice cultivars which combined RYMV-resistance with high-yield could be utilised in rice breeding programmes in order to enhance food security.

scholarly journals Rice yellow mottle virus Is Transmitted by Cows, Donkeys, and Grass Rats in Irrigated Rice Crops

Plant Disease ◽  
2003 ◽  
Vol 87 (7) ◽  
pp. 804-808 ◽  
Author(s):  
Soungalo Sarra ◽  
Dick Peters
Keyword(s):  
Field Experiment ◽  
Disease Incidence ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Irrigated Rice ◽  
Rice Plants ◽  
Yellow Mottle ◽  
Experimental Plots ◽  
Over Time ◽  
Arvicanthis Niloticus

Rice yellow mottle virus (RYMV), endemic in Africa, is believed to be spread by chrysomelid beetles, although the infections in a field often cannot be explained by the prevailing number of beetles. We show that the grass rat Arvicanthis niloticus, domestic cows (Bos spp.), and donkeys (Asinus spp.) are potent and efficient transmitters of RYMV. Spread of RYMV by rats was demonstrated in cage experiments wherein individual rats transmitted the virus from healthy to infected rice plants and confirmed in a field experiment. Experiments with cows and donkeys showed that they could transmit the virus in plots with healthy and infected plants and to plots with healthy plants. A high percentage of seedlings became infected when a cow grazed in a seedbed after being fed with infected rice plants. Transmission also was observed when cows were allowed to graze on the stubble of infected fields. The disease incidence increased at least fourfold over time to approximately 36% of the plants infected in the experimental plots of two stubble fields. The results obtained in these stubble fields suggest that cattle-mediated spread will enhance the size of the virus load in the contraseason and the infection potential to infect the next crop.

scholarly journals Evaluation of rice cultivars for resistance to rice yellow mottle virus

2018 ◽  
Vol 26 (1) ◽  
pp. 49
Author(s):  
H. Kam ◽  
M.-N. Ndjiondjop ◽  
N. Ouedraogo ◽  
M.D. Laing ◽  
A. Ghesquiere
Keyword(s):  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Rice Cultivars ◽  
Yellow Mottle

scholarly journals Variation among Tanzania Rice Germplasm Collections Based on Agronomic Traits and Resistance to Rice Yellow Mottle Virus

Agronomy ◽  
2021 ◽  
Vol 11 (2) ◽  
pp. 391
Author(s):  
William Titus Suvi ◽  
Hussein Shimelis ◽  
Mark Laing ◽  
Isack Mathew ◽  
Admire I. T. Shayanowako
Keyword(s):  
Grain Yield ◽  
Agronomic Traits ◽  
Genotypic Variation ◽  
Germplasm Collection ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Lattice Design ◽  
Rice Germplasm ◽  
Yellow Mottle ◽  
The Impact

Rice (Oryza species) is a commercial crop worldwide. Across Africa, the potential yield and quality of rice is diminished by a lack of high performance, locally adapted varieties, and the impact of rice yellow mottle virus (RYMV). The objective of this study was to assess the performance of a diverse collection of rice germplasm for RYMV resistance and agronomic traits, and to select promising lines for breeding for Tanzanian conditions. Fifty-four rice genotypes were field evaluated in two important rice production sites (Ifakara and Mkindo) in Tanzania, which are recognized as RYMV hotspots, using a 6 × 9 alpha lattice design with two replications. There was significant (p < 0.05) genotypic variation for agronomic traits and RYMV susceptibility in the tested germplasm. Seven genotypes with moderate to high RYMV resistance were identified, including Salama M-57, SSD1, IRAT 256, Salama M-55, Mwangaza, Lunyuki, and Salama M-19, which were identified as new sources of resistance genes. Positive and significant correlations were detected between grain yield and number of panicles per plant (NPP), panicle length (PL), number of grains per panicle (NGP), percentage-filled grains (PFG), and thousand-grain weight (TGW), which are useful traits for simultaneous selection for rice yield improvement. A principal component analysis allocated five principal components, accounting for 79.88% of the total variation present in the assessed germplasm collection. Traits that contributed most to variability included NPP, number of tillers/plant (NT), PL, grain yield (GY), and days to 50% flowering (DFL). The genotypes Rangimbili, Gigante, and SARO possess complementary agronomic traits and RYMV resistance, and can be recommended for further evaluation, genetic analysis, and breeding.

scholarly journals Resistance of Oryza sativa and Oryza glaberrima Genotypes to RBe24 Isolate of Rice Yellow Mottle Virus in Benin and Effects of Silicon on Host Response

2021 ◽  
Vol 37 (4) ◽  
pp. 375-388
Author(s):  
Vital Kouessi Sixte Anato ◽  
Yves Agnoun ◽  
Joèl Houndjo ◽  
Aderonke Oludare ◽  
Clement Agbangla ◽  
...  
Keyword(s):  
Oryza Sativa ◽  
Disease Incidence ◽  
Mottle Virus ◽  
Oryza Glaberrima ◽  
Rice Yellow Mottle Virus ◽  
Comprehensive Strategy ◽  
Yellow Mottle ◽  
Rice Genotypes ◽  
Resistant Genotypes ◽  
Screen House

Rice yellow mottle virus (RYMV) is the most harmful virus that affects irrigated and lowland rice in Africa. The RBe24 isolate of the virus is the most pathogenic strain in Benin. A total of 79 genotypes including susceptible IR64 (Oryza sativa) and the resistant TOG5681 (O. glaberrima) as checks were screened for their reactions to RBe24 isolate of RYMV and the effects of silicon on the response of host plants to the virus investigated. The experiment was a three-factor factorial consisting of genotypes, inoculation level (inoculated vs. non-inoculated), and silicon dose (0, 5, and 10 g/plant) applied as CaSiO3 with two replications and carried out twice in the screen house. Significant differences were observed among the rice genotypes. Fifteen highly resistant and eight resistant genotypes were identified, and these were mainly O. glaberrima. Silicon application did not affect disease incidence and severity at 21 and 42 days after inoculation (DAI); it, however, significantly increased plant height of inoculated (3.6% for 5 g CaSiO3/plant and 6.3% for 10 g CaSiO3/plant) and non-inoculated (1.9% for 5 g CaSiO3/plant and 4.9% for 10 g CaSiO3/plant) plants at 42 DAI, with a reduction in the number of tillers (12.3% for both 5 and 10 g CaSiO3/plant) and leaves (26.8% for 5 g CaSiO3/plant and 28% for 10 g CaSiO3/plant) under both inoculation treatments. Our results confirm O. glaberrima germplasm as an important source of resistance to RYMV, and critical in developing a comprehensive strategy for the control of RYMV in West Africa.

scholarly journals Incidence and Distribution of Rice Yellow Mottle Virus Disease in Kebbi State, Nigeria

2019 ◽  
pp. 1-7
Author(s):  
I. U. Mohammed ◽  
Y. A. Busari ◽  
A. Muhammad ◽  
R. Idris ◽  
M. Adamu ◽  
...  
Keyword(s):  
Local Governments ◽  
Virus Disease ◽  
Hot Spot ◽  
Disease Incidence ◽  
The State ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Yellow Mottle ◽  
Leaf Deformation ◽  
Severity Of The Disease

The study was conducted to assess the incidences of Rice Yellow Mottle Virus disease (RYMVD) in Kebbi State Nigeria, a field survey was conducted in four rice-growing areas of the State. Rice fields were selected randomly at 2 km interval, severity of the disease was assess using arbitrary five-point scale and disease incidence was assessed according to the proportion of the plants showing symptoms. Thirty plants were assessed in each field visited. Symptoms occurred in varying levels of incidence. The presence of RYMV in the collected samples was confirmed using Reverse Transcription Polymerase Chain Reaction (RT-PCR). Mottle/yellowing symptom was found more on the plants assessed (46%) followed by leaf curling (21%), leaf necrosis (09%), leaf deformation (11%) and irregular patches (13%). RYMVD was found highly distributed in the State with average incidence of 54.38%. The highest incidence was recorded in in Yauri (67.50%) followed by Argungu (55.00%), Bagudo (52.50%) and the lowest was recorded in Suru (42.50%). The average symptom severity across all the four Local Governments visited was 2.8, the highest was recorded in Yauri (3.2), followed by Argungu (2.9), Bagudo (2.7) and Suru 2.3. The information obtained in this study would assist rice breeding programs to develop durable RYMV rice resistant cultivars and guide in the identification of RYMVD hot spot locations for seed multiplication trials in Kebbi State.

scholarly journals First Report of Rice yellow mottle virus on Rice in Burundi

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1230-1230 ◽  
Author(s):  
I. Ndikumana ◽  
A. Pinel-Galzi ◽  
Z. Negussie ◽  
S. N'chimbi Msolla ◽  
P. Njau ◽  
...  
Keyword(s):  
Polyclonal Antibodies ◽  
Disease Incidence ◽  
Sandwich Elisa ◽  
Rice Cultivation ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Cultivated Rice ◽  
Phylogenic Tree ◽  
Northern Tanzania ◽  
Yellow Mottle

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

scholarly journals First Report of Rice yellow mottle virus in Rice in the Central African Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 162-162 ◽  
Author(s):  
D. R. S. Longué ◽  
A. Galzi-Pinel ◽  
S. Semballa ◽  
I. Zinga ◽  
D. Fargette ◽  
...  
Keyword(s):  
Central African Republic ◽  
Disease Incidence ◽  
Central Africa ◽  
Rice Production ◽  
Mottle Virus ◽  
Cultivated Plants ◽  
Rice Yellow Mottle Virus ◽  
Rt Pcr ◽  
Serotype 1 ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.

Sign in / Sign up

Export Citation Format

Share Document