scholarly journals Features of the strawberry field repository formation

2021 ◽  
Vol 22 (5) ◽  
pp. 715-724
Author(s):  
M. T. Upadyshev ◽  
T. A. Tumaeva ◽  
A. A. Borisova ◽  
N. V. Andronova ◽  
A. D. Petrova ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
High Efficiency ◽  
International Standards ◽  
Ringspot Virus ◽  
Fruit Crops ◽  
Arabis Mosaic Virus ◽  
Planting Material ◽  
Intact Plants ◽  
Small Fruit ◽  
Horticultural Research

For the successful functioning of a breeding and nursery center of scientific and practical work with fruit and small fruit crops, an important task is to create repositories, including thosein the field. A field repository is a plant gene bank based in accordance with international standards on planting material that is free from dangerous pathogens, including viruses, representing tested for productivity typical plants.For the purpose of a comparative study of promising varieties, hybrids and clones-candidates for original plants, a field repository and mother plantation of strawberries clones and varieties have been created on the territory of the Federal Horticultural Research Center for Breeding, Agrotechnology and Nursery.As a result of research in 2015-2020, 386 high-yielding strawberry plants were selected and tested for the main harmful viruses using diagnostic kits from “Loewe” firm (Germany). The prevalence of harmful Arabis mosaic virus (ArMV), Raspberry ringspot virus (RpRSV), Tomato black ring virus (TBRV), Strawberry latent ringspot virus (SLRSV), Cucumber mosaic virus (CMV) in strawberry plantations depended on the area cultivation, varietal composition of plantings and ranged from 31 to 69 %. The prevalence of viruses RpRSV (up to 36 %), TBRV (up to 31 %) and CMV (up to 22 %) was established. The high efficiency of dry-air thermotherapy for the recovery of strawberries with the number of virus-free intact plants of 56 % has been shown.A genebank of "candidates for original plants" has been formed from 234 strawberry plants of 39 varieties and hybrids, which, after confirming their status by PCR, will be transferred to the category of "original plants".

Peculiarities of the phytosanitary state of pome fruits in industrial horticulture

2020 ◽  
Vol 60 (1) ◽  
pp. 159-168
Author(s):  
V. V. Antonenko ◽  
A. V. Zubkov ◽  
S. N. Kruchina
Keyword(s):  
Mechanism Of Action ◽  
Large Scale ◽  
High Efficiency ◽  
Fruit Trees ◽  
Fruit Crops ◽  
Planting Material ◽  
Relative Safety ◽  
Pome Fruits ◽  
Weed Plants ◽  
Spread Of Infection

Data were obtained on the basis of the results of research carried out on the territory of the educational and experimental farm of the Timiryazev State Agrarian University, in Moscow during 2018-2019. As a result of the surveys, the most dangerous diseases and pests of pome crops on the territory of this farm were established. The most resistant apple and pear varieties to major diseases have been identified. Peculiarities of development of alternariosis on pear are described, the harmfulness of the disease on pear and apple seedlings is noted. A possible role in the transfer of alternariosis infection from garden-protective plantations and weed vegetation to fruit trees was noted. A possible role has been established in the transport of septoriosis, powdery dew infection from dicotyledonous weeds plants. The peculiarities of the spread of infection under the influence of wind direction are noted. The results and peculiarities of the application of various methods of scaring birds in the orchard are presented. As a result of route surveys the most harmful weed plants have been identified. The possibility of using herbicides of different mechanism of action in fruit gardens for weed control has been studied. High efficiency and relative safety of application of herbicides of contact action in nursery fields, operational orchards and for control of piglets on fruit trees are shown. Recommendations are given for the use of soil and systemic herbicides of soil in seedlings beds, the first and second fields of the nursery, as well as in the process of production of large-scale planting material and operational orchards of fruit crops. The safety of the herbicides in question is established when used in accordance with the recommended methods of use.

Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

2013 ◽  
Vol 14 (1) ◽  
pp. 24 ◽  
Author(s):  
John R. Fisher
Keyword(s):  
Mosaic Virus ◽  
Tobacco Rattle Virus ◽  
Alfalfa Mosaic Virus ◽  
Pcr Primers ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Sequence Variants ◽  
Arabis Mosaic Virus ◽  
Specific Pcr ◽  
Wilt Virus

Two Hosta sp. ‘So Sweet’ plants and one Hosta sieboldii (labeled as ‘Albo-marginata’) plant showing a suspected virus-like leaf mottle symptom tested negative for the Potyvirus group, Hosta virus X, Alfalfa mosaic virus, Arabis mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato ringspot virus, and Tomato spotted wilt virus by ELISA. DsRNA analysis produced a banding profile suggestive of a viral infection, and dsRNA was used as template to synthesize cDNAs for use with tobravirus group and Tobacco rattle virus (TRV) specific PCR primers. Amplicons were cloned and sequenced, and results showed two distinct populations of sequences: the two So Sweet isolates were ∼99% identical to each other but only ∼92% identical to the Albo-marginata isolate. These results represent the first confirmed report of TRV in Hosta in Ohio, and further demonstrate that there are at least two nucleotide sequence variants of the virus infecting Ohio Hosta. Accepted for publication 21 December 2012. Published 30 March 2013.

scholarly journals Occurrence of Stone Fruit Viruses in Plum Orchards in Latvia

2013 ◽  
Vol 67 (2) ◽  
pp. 116-123
Author(s):  
Alina Gospodaryk ◽  
Inga Moročko-Bičevska ◽  
Neda Pūpola ◽  
Anna Kāle
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Ringspot Virus ◽  
Stone Fruit ◽  
Detection Methods ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Detection Rates ◽  
Arabis Mosaic Virus ◽  
Das Elisa

To evaluate the occurrence of nine viruses infecting Prunus a large-scale survey and sampling in Latvian plum orchards was carried out. Occurrence of Apple mosaic virus (ApMV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Apple chlorotic leaf spot virus (ACLSV), and Plum pox virus (PPV) was investigated by RT-PCR and DAS ELISA detection methods. The detection rates of both methods were compared. Screening of occurrence of Strawberry latent ringspot virus (SLRSV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV) and Petunia asteroid mosaic virus (PeAMV) was performed by DAS-ELISA. In total, 38% of the tested trees by RT-PCR were infected at least with one of the analysed viruses. Among those 30.7% were infected with PNRSV and 16.4% with PDV, while ApMV, ACLSV and PPV were detected in few samples. The most widespread mixed infection was the combination of PDV+PNRSV. Observed symptoms characteristic for PPV were confirmed with RT-PCR and D strain was detected. Comparative analyses showed that detection rates by RT-PCR and DAS ELISA in plums depended on the particular virus tested. The results obtained in this study revealed that commonly grown plum cultivars in Latvia are infected with economically important stone fruit viruses and highlight the need to implement a programme to produce and propagate virus-free planting material.

scholarly journals Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1067-1067 ◽  
Author(s):  
K. C. Eastwell ◽  
W. E. Howell
Keyword(s):  
Mosaic Virus ◽  
Sweet Cherry ◽  
The United States ◽  
Ringspot Virus ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Fresh Market ◽  
Arabis Mosaic Virus ◽  
Leafroll Virus ◽  
Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

scholarly journals Characteristics of rose mosaic diseases

2013 ◽  
Vol 57 (1-2) ◽  
pp. 79-89
Author(s):  
Marek S. Szyndel
Keyword(s):  
Mosaic Virus ◽  
Mosaic Disease ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Line Pattern ◽  
Arabis Mosaic Virus ◽  
Tobacco Ringspot Virus ◽  
Tomato Ringspot Virus ◽  
Prunus Necrotic Ringspot Virus ◽  
Methods Of Control

Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are <i>Prunus necrotic ringspot virus</i> - PNRSV, <i>Apple mosaic virus</i> - ApMV (syn. <i>Rose mosaic virus</i>) and <i>Arabis mosaic virus</i> - ArMV Symptoms and damages caused by these viruses are described. <i>Tomato ringspot virus, Tobacco ringspot virus</i> and <i>Rose mottle mosaic virus</i> are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

scholarly journals Molecular marking and genetic certification: application in plant breeding, biotechnology and identification of horticultural crops

2019 ◽  
pp. 5-11
Author(s):  
A. A. Yankovskaya ◽  
I. V. Knyazeva ◽  
M. T. Upadishev
Keyword(s):  
Ssr Markers ◽  
Target Genes ◽  
Dna Analysis ◽  
Control Plant ◽  
Genetic Identification ◽  
Fruit Crops ◽  
Horticultural Crops ◽  
Planting Material ◽  
Small Fruit

The analysis of contemporary research on molecular marking and genetic certification for use in breeding, biotechnology and identification of horticultural crops is carried out. In Russia and abroad, active work is underway on the identification and certification of garden crops: apple, pear, various types of stone fruit crops, raspberry, strawberry, currant and gooseberry. Currently, the most effective and frequently used are SSR markers. Genetic certificates have been elaborated for many fruit and small fruit crops, which are used in breeding research, works on the study of genetic diversity, in variety diagnosis and diagnosis of pathogens and genealogy analysis. In previous studies using SSR markers, 16 apple varieties, 10 cherry varieties, 29 raspberry varieties and 12 pear varieties of ARHIBAN contemporary breeding were genotyped. The appearance of plant genetic certificates contributed to the development of marker-oriented breeding, making it possible to identify and select genotypes carrying target genes and quantitative trait loci (QTLs) using only DNA analysis data without preliminary phenotypic evaluation. Molecular genetics certificate can serve as a reliable tool to protect the copyright of breeders. In conditions of Russian Federation it is necessary to expand researches of genomic analysis of fruit and small fruit crops, improve and unify the methods of DNA identification and molecular marking techniques, develop common requirements for the level of information content of markers, principles and methods of evaluation of planting material and collections in vitro. The researchers are faced with the task of creating a clear system of molecular-genetic identification and certification of planting material, which will allow to develop and introduce into production varieties with known characteristics, to control plant material at all stages of nursery and commercial distribution of varieties.

scholarly journals REGIONALIZATION AND FRUIT CROPS IN THE SOUTHERN REGION: USDA–ARS SOUTHERN HORTICULTURAL LABORATORY

HortScience ◽  
2005 ◽  
Vol 40 (3) ◽  
pp. 890e-890
Author(s):  
J.M. Spiers
Keyword(s):  
Research Station ◽  
Regional Research ◽  
Fruit Crops ◽  
Short History ◽  
Research Facility ◽  
Research Directions ◽  
Horticultural Crops ◽  
Small Fruit ◽  
History Of ◽  
Horticultural Research

The Southern Horticultural Laboratory evolved from the USDA Small Fruit Research Station located at Poplarville, MS. A short history of the research facility and present horticultural research directions will be discussed. Emphases will be on past and present cooperative regional research efforts in horticultural crops.

Prevalence of viral diseases and isolation of candidates in nuclear stock plants of raspberry ex situ

2020 ◽  
Vol 61 ◽  
pp. 109-116
Author(s):  
M. T. Upadyshev ◽  
K. V. Metlitskaya ◽  
S. N. Evdokimenko ◽  
T. A. Tumaeva ◽  
A. A. Borisova ◽  
...  
Keyword(s):  
Species Composition ◽  
Ringspot Virus ◽  
Ex Situ ◽  
Viral Diseases ◽  
Serological Tests ◽  
Arabis Mosaic Virus ◽  
Planting Material ◽  
Total Prevalence ◽  
Virus Rna ◽  
Longidorus Elongatus

On raspberries, currently about 30 viral diseases are known in the world that can reduce the yield and its quality. According to the results of previous studies in the Moscow region, the prevalence of viruses on raspberries was: Arabis mosaic virus(ArMV) – 14 %, Raspberry ringspot virus(RpRSV) – 30 %, Strawberry latent ringspot virus(SLRSV) – 16 %, Tomato black ring virus (TBRV ) – 18 %, Raspberry bushy dwarf virus (RBDV) – 39 %. Viruses spread in agrocenosis with infected planting material, with tools, with pollen and seeds, nematodes – longidorids (Xiphinema diversicaudatum – ArMV and SLRSVvector, Longidorus elongatus – RpRSV and TBRVvector). The harmfulness of viruses on raspberry plants consisted inreducingthe productivity by 21 %, fruit masse– by 26 % compared with virus-free plants. The aim of the study was to study the species composition of viruses on raspberries to identify candidates for the nuclear stock plants. In serological tests, the ELISA sandwich version was used according, for analysis, diagnostic kits from Loewe (Germany) were used. Leaves were taken as samples. The results of analyzes were recorded on a Stat Fax 2100 hotometer at a wavelength of 405 and 630 nm. RBDV virus RNA was isolated using the CytoSorb kit, followed by RT-PCR. The species composition of viruses on raspberry varieties was studied under ex situ conditions. The total prevalence of viruses was 29 % with the predominance of the RBDV virus (19 %). 102 candidates for nuclearstockplants of 22 varieties of raspberries were identified. After confirming the virus-free status of raspberry plants by PCR, they will receive the category “nuclearstock plant”.

Sign in / Sign up

Export Citation Format

Share Document