Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

2013 ◽  
Vol 14 (1) ◽  
pp. 24 ◽  
Author(s):  
John R. Fisher
Keyword(s):  
Mosaic Virus ◽  
Tobacco Rattle Virus ◽  
Alfalfa Mosaic Virus ◽  
Pcr Primers ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Sequence Variants ◽  
Arabis Mosaic Virus ◽  
Specific Pcr ◽  
Wilt Virus

Two Hosta sp. ‘So Sweet’ plants and one Hosta sieboldii (labeled as ‘Albo-marginata’) plant showing a suspected virus-like leaf mottle symptom tested negative for the Potyvirus group, Hosta virus X, Alfalfa mosaic virus, Arabis mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato ringspot virus, and Tomato spotted wilt virus by ELISA. DsRNA analysis produced a banding profile suggestive of a viral infection, and dsRNA was used as template to synthesize cDNAs for use with tobravirus group and Tobacco rattle virus (TRV) specific PCR primers. Amplicons were cloned and sequenced, and results showed two distinct populations of sequences: the two So Sweet isolates were ∼99% identical to each other but only ∼92% identical to the Albo-marginata isolate. These results represent the first confirmed report of TRV in Hosta in Ohio, and further demonstrate that there are at least two nucleotide sequence variants of the virus infecting Ohio Hosta. Accepted for publication 21 December 2012. Published 30 March 2013.

scholarly journals Spathiphyllum sp.: A New Natural Host of Impatiens necrotic spot virus

Plant Disease ◽  
2001 ◽  
Vol 85 (4) ◽  
pp. 448-448 ◽  
Author(s):  
A. Materazzi ◽  
E. Triolo
Keyword(s):  
Mosaic Virus ◽  
Alfalfa Mosaic Virus ◽  
Systemic Infection ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Spot Virus ◽  
New Host ◽  
Arabis Mosaic Virus ◽  
Wilt Virus

In September 1999, several Spathiphyllum plants grown in a greenhouse in Tuscany (Italy) showed leaf symptoms in the form of concentric chlorotic ringspots, line patterns, and irregular chlorotic blotches. These symptoms developed into localized necrosis. Crude sap of tissues showing symptoms was mechanically inoculated to young symptomless Spathiphyllum plants and to Nicotiana benthamiana and N. clevelandii. Samples drawn from symptomatic and symptomless tissues of naturally or artificially infected Spathiphyllum and Nicotiana plants were tested for the presence of Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Dasheen mosaic virus (DsMV), Impatiens necrotic spot virus (INSV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), and Tomato spotted wilt virus (TSWV) by double-antibody sandwich enzyme-linked immunosorbent assay carried out with commercial antisera. The symptomatic tissues obtained from Spathiphyllum and Nicotiana plants gave a positive reaction only for INSV. The symptomless samples obtained from various parts of the infected Spathiphyllum plants gave a negative reaction, even after 1 year from the appearance of localized necrosis, suggesting a non-systemic infection in this new host. This is the first report of infection of Spathiphyllum sp. by INSV.

scholarly journals First Report of a Disease of Peony Caused by Alfalfa mosaic virus

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 99-99 ◽  
Author(s):  
M. G. Bellardi ◽  
C. Rubies-Autonell ◽  
A. Bianchi
Keyword(s):  
Mosaic Virus ◽  
Leaf Roll ◽  
Tobacco Rattle Virus ◽  
Alfalfa Mosaic Virus ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
First Report ◽  
Systemic Leaf ◽  
Cherry Leaf Roll Virus ◽  
Line Patterns

During the summers of 2001 and 2002, Japanese peony (Paeonia albiflora Pall., synonym P. lactiflora, family Paeoniaceae) plants, cultivated in the Botanical Garden of the University of Parma (Emilia Romagna Region of northern Italy), were found affected by a disease with virus-like symptoms. The oldest leaves showed yellow, mosaic, oak-like arabesques and line-patterns; the remaining leaves and pink flowers were symptomless. A disease of peony, known as peony ring spot disease, has been reported worldwide (Europe, United States, Japan, and New Zeland) for several years and is associated with strains of Tobacco rattle virus (TRV) (1). Electron microscopic observations of peony leaf sap (leaf dip preparations stained with uranyl acetate and phospotungstic acid) did not show the presence of any rod-shaped virus particles, including TRV. Mechanical inoculations of sap from symptomatic leaves caused symptoms typical of Alfalfa mosaic virus (AMV) on Chenopodium amaranticolor Coste & Reyn. (local chlorotic and necrotic lesions and systemic periveinal line-patterns), Ocimum basilicum L. (yellow mosaic), Vigna unguiculata (L.) Walp. (red, local necrotic lesions), and Nicotiana tabacum cv. Samsun (white, necrotic lesions, systemic leaf malformation, and mosaic), and N. glutinosa L. (systemic leaf variegation). Symptomatic leaves of peony and infected herbaceous plants were analyzed for virus presence by protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA). The polyclonal antisera tested were those to AMV (PVAS 92, American Type Culture Collection, Manassas, VA), AMV-Vinca minor L. (DiSTA collection, Italy), and the nepoviruses Strawberry latent ringspot virus, Tomato ringspot virus, and Cherry leaf roll virus. PAS-ELISA revealed only the presence of AMV. Immunoelectron microscopy and gold-labeled decoration confirmed the identity of the virus. In 2001, five symptomless peony plants (provided by a commercial grower and previously analyzed for AMV and TRV presence) were grafted with shoots from peony showing yellow mosaic on the leaves and maintained in a greenhouse under aphid-proof cage. During the summer of 2002, one of the grafted plants showed a mild mosaic on the leaves; PAS-ELISA revealed this peony was infected by AMV. To our knowledge, this is the first report of AMV in peony. Reference: (1) Chang et al. Ann. Phytopathol. Soc. Jpn. 42:325, 1976.

scholarly journals Occurrence of viruses on pepper plantations in the Czech Republic – Short communication

2012 ◽  
Vol 39 (No. 3) ◽  
pp. 139-143 ◽  
Author(s):  
J. Svoboda ◽  
L. Svobodová-Leišová
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Short Communication ◽  
Alfalfa Mosaic Virus ◽  
Sources Of Resistance ◽  
Pepper Mild Mottle Virus ◽  
The Czech Republic ◽  
Tomato Spotted Wilt ◽  
Wilt Virus ◽  
Broad Bean Wilt Virus

A survey of viruses on capsicum plants in the Czech Republic was carried out in the years 2006–2010. Altogether, 375 leaf samples with symptoms suggesting viral infection were collected both from open fields and greenhouses. These samples were examined for the presence of Alfalfa mosaic virus (AMV), Broad bean wilt virus-1 (BBWV-1), Cucumber mosaic virus (CMV), Pepper mild mottle virus (PMMoV), Potato virus Y (PVY), Tobacco mosaic virus (TMV) and Tomato spotted wilt virus (TSWV) by ELISA. Viruses detected in the samples were AMV, BBWV-1, CMV and PVY. The most prevalent were CMV and PVY which were present in 24 and 29% of tested samples, respectively. In some cases a complex infection of two viruses was detected. Gene sources of resistance against CMV and PVY are mentioned. The relation of virus occurrence on aphid incidence is discussed.

scholarly journals Occurrence of Stone Fruit Viruses in Plum Orchards in Latvia

2013 ◽  
Vol 67 (2) ◽  
pp. 116-123
Author(s):  
Alina Gospodaryk ◽  
Inga Moročko-Bičevska ◽  
Neda Pūpola ◽  
Anna Kāle
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Ringspot Virus ◽  
Stone Fruit ◽  
Detection Methods ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Detection Rates ◽  
Arabis Mosaic Virus ◽  
Das Elisa

To evaluate the occurrence of nine viruses infecting Prunus a large-scale survey and sampling in Latvian plum orchards was carried out. Occurrence of Apple mosaic virus (ApMV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Apple chlorotic leaf spot virus (ACLSV), and Plum pox virus (PPV) was investigated by RT-PCR and DAS ELISA detection methods. The detection rates of both methods were compared. Screening of occurrence of Strawberry latent ringspot virus (SLRSV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV) and Petunia asteroid mosaic virus (PeAMV) was performed by DAS-ELISA. In total, 38% of the tested trees by RT-PCR were infected at least with one of the analysed viruses. Among those 30.7% were infected with PNRSV and 16.4% with PDV, while ApMV, ACLSV and PPV were detected in few samples. The most widespread mixed infection was the combination of PDV+PNRSV. Observed symptoms characteristic for PPV were confirmed with RT-PCR and D strain was detected. Comparative analyses showed that detection rates by RT-PCR and DAS ELISA in plums depended on the particular virus tested. The results obtained in this study revealed that commonly grown plum cultivars in Latvia are infected with economically important stone fruit viruses and highlight the need to implement a programme to produce and propagate virus-free planting material.

scholarly journals Features of the strawberry field repository formation

2021 ◽  
Vol 22 (5) ◽  
pp. 715-724
Author(s):  
M. T. Upadyshev ◽  
T. A. Tumaeva ◽  
A. A. Borisova ◽  
N. V. Andronova ◽  
A. D. Petrova ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
High Efficiency ◽  
International Standards ◽  
Ringspot Virus ◽  
Fruit Crops ◽  
Arabis Mosaic Virus ◽  
Planting Material ◽  
Intact Plants ◽  
Small Fruit ◽  
Horticultural Research

For the successful functioning of a breeding and nursery center of scientific and practical work with fruit and small fruit crops, an important task is to create repositories, including thosein the field. A field repository is a plant gene bank based in accordance with international standards on planting material that is free from dangerous pathogens, including viruses, representing tested for productivity typical plants.For the purpose of a comparative study of promising varieties, hybrids and clones-candidates for original plants, a field repository and mother plantation of strawberries clones and varieties have been created on the territory of the Federal Horticultural Research Center for Breeding, Agrotechnology and Nursery.As a result of research in 2015-2020, 386 high-yielding strawberry plants were selected and tested for the main harmful viruses using diagnostic kits from “Loewe” firm (Germany). The prevalence of harmful Arabis mosaic virus (ArMV), Raspberry ringspot virus (RpRSV), Tomato black ring virus (TBRV), Strawberry latent ringspot virus (SLRSV), Cucumber mosaic virus (CMV) in strawberry plantations depended on the area cultivation, varietal composition of plantings and ranged from 31 to 69 %. The prevalence of viruses RpRSV (up to 36 %), TBRV (up to 31 %) and CMV (up to 22 %) was established. The high efficiency of dry-air thermotherapy for the recovery of strawberries with the number of virus-free intact plants of 56 % has been shown.A genebank of "candidates for original plants" has been formed from 234 strawberry plants of 39 varieties and hybrids, which, after confirming their status by PCR, will be transferred to the category of "original plants".

scholarly journals Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1067-1067 ◽  
Author(s):  
K. C. Eastwell ◽  
W. E. Howell
Keyword(s):  
Mosaic Virus ◽  
Sweet Cherry ◽  
The United States ◽  
Ringspot Virus ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Fresh Market ◽  
Arabis Mosaic Virus ◽  
Leafroll Virus ◽  
Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

scholarly journals Characteristics of rose mosaic diseases

2013 ◽  
Vol 57 (1-2) ◽  
pp. 79-89
Author(s):  
Marek S. Szyndel
Keyword(s):  
Mosaic Virus ◽  
Mosaic Disease ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Line Pattern ◽  
Arabis Mosaic Virus ◽  
Tobacco Ringspot Virus ◽  
Tomato Ringspot Virus ◽  
Prunus Necrotic Ringspot Virus ◽  
Methods Of Control

Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are <i>Prunus necrotic ringspot virus</i> - PNRSV, <i>Apple mosaic virus</i> - ApMV (syn. <i>Rose mosaic virus</i>) and <i>Arabis mosaic virus</i> - ArMV Symptoms and damages caused by these viruses are described. <i>Tomato ringspot virus, Tobacco ringspot virus</i> and <i>Rose mottle mosaic virus</i> are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

scholarly journals Macroarray Detection of Eleven Potato-Infecting Viruses and Potato spindle tuber viroid

Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 730-740 ◽  
Author(s):  
Bright Agindotan ◽  
Keith L. Perry
Keyword(s):  
Mosaic Virus ◽  
Potato Virus ◽  
Tobacco Rattle Virus ◽  
Alfalfa Mosaic Virus ◽  
Potato Virus X ◽  
Potato Spindle Tuber Viroid ◽  
Apparent Competition ◽  
Enzyme Linked Immunosorbent Assay ◽  
Potato Seed ◽  
Potato Virus S

A macroarray was developed for the detection of 11 potato viruses and Potato spindle tuber viroid. The 11 viruses detected included those commonly found or tested for in North American potato seed certification programs: Alfalfa mosaic virus, Cucumber mosaic virus, Potato mop top virus, Potato leafroll virus, Potato latent virus, Potato virus A, Potato virus M, Potato virus S, Potato virus X, Potato virus Y, and Tobacco rattle virus. These viruses were detected using oligonucleotide 70-mer probes and labeled targets prepared by a random primed amplification procedure. Potato plants analyzed included those infected with 12 reference virus stocks and 36 field isolates. Results from the macroarray were entirely consistent with those obtained using a standard serological assay (enzyme-linked immunosorbent assay). Four isolates of Potato spindle tuber viroid, in mixed infection with one or more viruses, also were detected in the array, although strong hybridization signals required amplification with viroid-specific primers in combination with anchored-random primers. In individual plants, up to four viruses, or a viroid plus two viruses, were detected, with no apparent competition or inhibition. Macroarrays are a cost-effective approach to the simultaneous diagnostic detection of multiple pathogens from infected plants.

Sign in / Sign up

Export Citation Format

Share Document