Enhancement of Simian Virus 40 Infection in Simian and Human Cells by Permissive Cell Extracts

1974 ◽  
Vol 146 (4) ◽  
pp. 1014-1020 ◽  
Author(s):  
V. F. Righthand
Keyword(s):  
Simian Virus 40 ◽  
Simian Virus ◽  
Human Cells ◽  
Permissive Cell ◽  
Cell Extracts

scholarly journals A unique subpopulation of murine DNA polymerase alpha/primase specifically interacts with polyomavirus T antigen and stimulates DNA replication.

1994 ◽  
Vol 14 (4) ◽  
pp. 2767-2776 ◽  
Author(s):  
K Moses ◽  
C Prives
Keyword(s):  
Dna Replication ◽  
Dna Polymerase ◽  
Simian Virus 40 ◽  
Simian Virus ◽  
T Antigen ◽  
Human Cells ◽  
Affinity Column ◽  
Dna Polymerase Alpha ◽  
Cell Extracts ◽  
Species Specific

Murine cells or cell extracts support the replication of plasmids containing the replication origin (ori-DNA) of polyomavirus (Py) but not that of simian virus 40 (SV40), whereas human cells or cell extracts support the replication of SV40 ori-DNA but not that of Py ori-DNA. It was shown previously that fractions containing DNA polymerase alpha/primase from permissive cells allow viral ori-DNA replication to proceed in extracts of nonpermissive cells. To extend these observations, the binding of Py T antigen to both the permissive and nonpermissive DNA polymerase alpha/primase was examined. Py T antigen was retained by a murine DNA polymerase alpha/primase but not by a human DNA polymerase alpha/primase affinity column. Likewise, a Py T antigen affinity column retained DNA polymerase alpha/primase activity from murine cells but not from human cells. The murine fraction which bound to the Py T antigen column was able to stimulate Py ori-DNA replication in the nonpermissive extract. However, the DNA polymerase alpha/primase activity in this murine fraction constituted only a relatively small proportion (approximately 20 to 40%) of the total murine DNA polymerase alpha/primase that had been applied to the column. The DNA polymerase alpha/primase purified from the nonbound murine fraction, although far more replete in this activity, was incapable of supporting Py DNA replication. The two forms of murine DNA polymerase alpha/primase also differed in their interactions with Py T antigen. Our data thus demonstrate that there are two distinct populations of DNA polymerase alpha/primase in murine cells and that species-specific interactions between T antigen and DNA polymerases can be identified. They may also provide the basis for initiating a novel means of characterizing unique subpopulations of DNA polymerase alpha/primase.

Carcinogen-induced DNA amplification in vitro: overreplication of the simian virus 40 origin region in extracts from carcinogen-treated CO60 cells

1990 ◽  
Vol 10 (1) ◽  
pp. 75-83
Author(s):  
Y Berko-Flint ◽  
S Karby ◽  
D Hassin ◽  
S Lavi
Keyword(s):  
De Novo ◽  
Chinese Hamster ◽  
Simian Virus 40 ◽  
Simian Virus ◽  
T Antigen ◽  
Dna Molecules ◽  
Viral Origin ◽  
Cell Extracts ◽  
Origin Region

An in vitro system to study carcinogen-induced amplification in simian virus 40 (SV40)-transformed Chinese hamster (CO60) cells is described. SV40 amplification in this system resembled in many aspects the viral overreplication observed in drug-treated CO60 cells. Cytosolic extracts from N-methyl-N'-nitro-N-nitrosoguanidine-treated cells supported de novo DNA synthesis in the presence of excess exogenous T antigen and the SV40-containing plasmid pSVK1. The pattern of viral replication in these extracts was unique, since only the 2.4-kilobase-pair region spanning the origin was overreplicated, whereas distal sequences were not replicated significantly. Extracts from control cells supported only marginal levels of replication. In HeLa extracts, complete SV40 DNA molecules were replicated efficiently. The overreplication of the origin region in CO60 cell extracts was bidirectional and symmetrical. A fraction of the newly synthesized DNA molecules underwent a second round of replication, yielding MboI-sensitive fragments representing the 2.4-kilobase-pair region around the origin. The mechanisms controlling the amplification of the viral origin region, the nature of the cellular factors induced in the carcinogen-treated cells, and their putative association with general drug-induced SOS-like responses are discussed.

Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication

1992 ◽  
Vol 12 (6) ◽  
pp. 2514-2524 ◽  
Author(s):  
Z S Guo ◽  
M L DePamphilis
Keyword(s):  
Transcription Factor ◽  
Transcription Factors ◽  
Dna Replication ◽  
Binding Sites ◽  
Simian Virus 40 ◽  
Simian Virus ◽  
T Antigen ◽  
Activation Domains ◽  
Auxiliary Component ◽  
Cell Extracts

The origins of DNA replication (ori) in simian virus 40 (SV40) and polyomavirus (Py) contain an auxiliary component (aux-2) composed of multiple transcription factor binding sites. To determine whether this component stimulated replication by binding specific transcription factors, aux-2 was replaced by synthetic oligonucleotides that bound a single transcription factor. Sp1 and T-antigen (T-ag) sites, which exist in the natural SV40 aux-2 sequence, provided approximately 75 and approximately 20%, respectively, of aux-2 activity when transfected into monkey cells. In cell extracts, only T-ag sites were active. AP1 binding sites could replace completely either SV40 or Py aux-2. Mutations that eliminated AP1 binding also eliminated AP1 stimulation of replication. Yeast GAL4 binding sites that strongly stimulated transcription in the presence of GAL4 proteins failed to stimulate SV40 DNA replication, although they did partially replace Py aux-2. Stimulation required the presence of proteins consisting of the GAL4 DNA binding domain fused to specific activation domains such as VP16 or c-Jun. These data demonstrate a clear role for transcription factors with specific activation domains in activating both SV40 and Py ori. However, no correlation was observed between the ability of specific proteins to stimulate promoter activity and their ability to stimulate origin activity. We propose that only transcription factors whose specific activation domains can interact with the T-ag initiation complex can stimulate SV40 and Py ori-core activity.

Sequential transcription-translation of simian virus 40 by using mammalian cell extracts

1981 ◽  
Vol 1 (10) ◽  
pp. 919-931
Author(s):  
C L Cepko ◽  
U Hansen ◽  
H Handa ◽  
P A Sharp
Keyword(s):  
Transcription Initiation ◽  
Simian Virus 40 ◽  
Restriction Enzymes ◽  
Simian Virus ◽  
T Antigen ◽  
Coding Regions ◽  
Cell Extracts ◽  
Initiation Of Translation

Ribonucleic acids (RNAs) transcribed in vitro by using the whole-cell extract system of Manley et al. (Proc. Natl. Acad. Sci. U.S.A. 77:3855-3859, 1980) were tested for their efficiency and fidelity in directing protein synthesis in reticulocyte lysates. Simian virus 40 deoxyribonucleic acid (DNA), cleaved by various restriction endonucleases, was used as the template. Successful translation of the small tumor antigen t, as well as the capsid proteins VP1, VP2, and VP3, was detected by immunoprecipitation analysis. Although no synthesis of large T antigen was detected, use of this technology allows detection of large T synthesis resulting from the correct splicing of as little as 0.2% of the in vitro RNA transcripts, making it ideal for use as an in vitro splicing assay. Transcripts synthesized in vitro were used as messages at least as efficiently as were viral messenger RNA's (mRNA's) synthesized in vivo; and in the case of small t, there was more efficient translation of small t mRNA synthesized in vitro than of small t mRNA synthesized in vivo. The transcripts that served as mRNA's for the various polypeptides were identified by using the following two criteria. (i) The sensitivity of synthesis of a given protein to digestion of the template DNA with restriction enzymes allowed the localization of the promoter and coding regions. (ii) Translation of size-fractionated RNA allowed confirmation of the transcript-mRNA assignments. With these techniques we found that VP2, VP3 and, in some cases, VP1 synthesis resulted from the initiation of translation at internal AUG codons. In fact, families of polypeptides were produced by initiation of translation at AUG codons within sequences coding for VP1 and T, presumably as a result of transcription initiation events that generated 5' ends immediately upstream from these AUGs. Application of this technology for the identification of coding regions within cloned DNA fragments is discussed.

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system.

1987 ◽  
Vol 7 (1) ◽  
pp. 379-387 ◽  
Author(s):  
R B DuBridge ◽  
P Tang ◽  
H C Hsia ◽  
P M Leong ◽  
J H Miller ◽  
...  
Keyword(s):  
Cell Lines ◽  
Epstein Barr Virus ◽  
Shuttle Vector ◽  
Simian Virus 40 ◽  
Simian Virus ◽  
Human Cells ◽  
Missense Mutations ◽  
Barr Virus ◽  
Vector Systems ◽  
Epstein Barr

We developed highly sensitive shuttle vector systems for detection of mutations formed in human cells using autonomously replicating derivatives of Epstein-Barr virus (EBV). EBV vectors carrying the bacterial lacI gene as the target for mutation were established in human cells and later returned to Escherichia coli for rapid detection and analysis of lacI mutations. The majority of the clonal cell lines created by establishment of the lacI-EBV vector show spontaneous LacI- frequencies of less than 10(-5) and are suitable for studies of induced mutation. The ability to isolate clonal lines represents a major advantage of the EBV vectors over transiently replicating shuttle vectors (such as those derived from simian virus 40) for the study of mutation. The DNA sequence changes were determined for 61 lacI mutations induced by exposure of one of the cell lines to N-nitroso-N-methylurea. A total of 33 of 34 lacI nonsense mutations and 26 of 27 missense mutations involve G X C to A X T transitions. These data provide support for the mutational theory of cancer.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Transformation of Human Cells by Temperature-Sensitive Mutants of Simian Virus 40

Intervirology ◽  
1978 ◽  
Vol 9 (1) ◽  
pp. 28-38 ◽  
Author(s):  
Christopher A. Lomax ◽  
Edward Bradley ◽  
Joseph Weber ◽  
Pierre Bourgaux
Keyword(s):  
Simian Virus 40 ◽  
Simian Virus ◽  
Human Cells ◽  
Temperature Sensitive ◽  
Temperature Sensitive Mutants
Sign in / Sign up

Export Citation Format

Share Document