scholarly journals Characterization of Begomoviruses Sampled during Severe Epidemics in Tomato Cultivars Carrying the Ty-1 Gene

2018 ◽  
Vol 19 (9) ◽  
pp. 2614 ◽  
Author(s):  
Covadonga Torre ◽  
Livia Donaire ◽  
Cristina Gómez-Aix ◽  
Miguel Juárez ◽  
Michel Peterschmitt ◽  
...  
Keyword(s):  
Rolling Circle Amplification ◽  
In Planta ◽  
Rolling Circle ◽  
Satellite Sequences ◽  
Major Species ◽  
Complete Sequences ◽  
Massive Sequencing ◽  
Group 2 ◽  
El Jadida ◽  
Leaf Curl Virus

Tomato yellow leaf curl virus (TYLCV, genus Begomovirus, family Geminiviridae) is a major species that causes a tomato disease for which resistant tomato hybrids (mainly carriers of the Ty-1/Ty-3 gene) are being used widely. We have characterized begomoviruses severely affecting resistant tomato crops in Southeast Spain. Circular DNA was prepared from samples by rolling circle amplification, and sequenced by massive sequencing (2015) or cloning and Sanger sequencing (2016). Thus, 23 complete sequences were determined, all belonging to the TYLCV Israel strain (TYLCV-IL). Massive sequencing also revealed the absence of other geminiviral and beta-satellite sequences. A phylogenetic analysis showed that the Spanish isolates belonged to two groups, one related to early TYLCV-IL isolates in the area (Group 1), and another (Group 2) closely related to El Jadida (Morocco) isolates, suggesting a recent introduction. The most parsimonious evolutionary scenario suggested that the TYLCV isolates of Group 2 are back recombinant isolates derived from TYLCV-IS76, a recombinant virus currently predominating in Moroccan epidemics. Thus, an infectious Group 2 clone (TYLCV-Mu15) was constructed and used in in planta competition assays against TYLCV-IS76. TYLCV-Mu15 predominated in single infections, whereas TYLCV-IS76 did so in mixed infections, providing credibility to a scenario of co-occurrence of both types of isolates.

scholarly journals Identification of Chili leaf curl virus Causing Leaf Curl Disease of Petunia in Oman

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
A. A. Al-Shihi ◽  
S. Akhtar ◽  
A. J. Khan
Keyword(s):  
Indian Subcontinent ◽  
Rolling Circle Amplification ◽  
Rapid Evolution ◽  
Post Inoculation ◽  
Multiple Sequence ◽  
Rolling Circle ◽  
Begomovirus Genome ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Petunias (Petunia × hybrida) are the most important ornamental plants in Oman. In 2012, petunias were observed in public parks and airport landscape in Dhofar region with symptoms of upward leaf curling, yellowing and vein clearing, and size reduction in leaves. Almost all plants in the surveyed landscape showed high infestation of Bemisia tabaci and symptoms that suggested infection with a begomovirus. Six symptomatic samples were collected from three different sites. All symptomatic samples were found PCR-positive with diagnostic primers for begomovirus (3) when DNA extracted from infected leaves was used as template. Nucleic acids extracted from the symptomatic leaves were used to amplify circular DNA molecules by rolling circle amplification method. The amplified concatameric products were digested with restriction enzyme PstI, which yielded a product ∼2.8 kb in size. The putative begomovirus fragment was cloned and sequenced in both orientations. Partial sequences of six clones were 99 to 100% similar and thus only two clones, PT-2 and PT-3, were fully sequenced. The whole genomes of both clones were 2,761 bp, and both were deposited in GenBank under accession numbers HF968755 and HF968756 for the isolates PT-2 and PT-3, respectively. Both sequences had six open reading frames; Rep, TrAP, REn, and C4 genes in complementary sense; and CP and V2 genes in virion-sense, typical of the begomovirus genome organization. Upon alignment, the two sequences showed 99.4% nucleotide identity with each other, thus representing isolates of a single begomovirus species. BlastN comparison showed PT-2 and PT-3 from petunia were 94 to 95% identical to the sequences of ChCLV from Oman (JN604490 to JN604500), which were obtained from other hosts. ClustalV multiple sequence alignment showed that isolates PT-2 and PT-3 shared maximum sequence identity of 93.3 and 92.8%, respectively, with an isolate of ChLCV-OM (JN604495). According to ICTV rules for begomoviruses, PT-3 should be considered to be a new strain of ChLCV-OM and PT-2 a variant of the already existing ChLCV-OM strain. We propose the name for this new strain as the “Petunia strain” of Chili leaf curl virus (ChLCV-Pet). Two infectious clones were constructed from the PT-2 and PT-3 sequences, clones as 1.75-genome sequences in a binary vector, suitable for agroinfection to confirm their infectivity. Both clones, PT-2 and PT-3, produced typical leaf curl disease symptoms upon inoculation on petunia 18 days post inoculation. The presence of the same virus in symptomatic field infected and inoculated petunia was confirmed by Southern blot using 650 bp DIG labeled probe prepared from CP region of PT-3 isolate. ChLCV-OM, a monopartite begomovirus, is widely associated with leaf curl disease of tomato and pepper in Oman, with its origin traced to the Indian subcontinent (2). Identification of a new strain of ChLCV from petunia provides evidence of an ongoing rapid evolution of begomoviruses in this region. Although petunia has been tested as an experimental host for some begomoviruses (1,4), this is the first report of petunia as natural host for ChLCV, a begomovirus previously reported in tomato and pepper in Oman. References: (1) Cui et al. J. Virol. 78:13966, 2004. (2) Khan et al. Virus Res. 177:87, 2013. (3) Khan et al. Plant Dis. 97:1396, 2013. (4) Urbino et al. Arch. Virol. 149:417, 2003.

scholarly journals First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1746-1746 ◽  
Author(s):  
Y. H. Cheng ◽  
T. C. Deng ◽  
C. C. Chen ◽  
C. H. Chiang ◽  
C. A. Chang
Keyword(s):  
Rolling Circle Amplification ◽  
Pcr Primers ◽  
Passion Fruit ◽  
The Other ◽  
Passiflora Edulis ◽  
Rolling Circle ◽  
First Report ◽  
Immature Fruit ◽  
Leaf Curl Virus ◽  
Leaf Curl

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) ‘Tainung No. 1’ is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5′TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3′/5′CGCAGTTT CTGGAGGATATTAAG3′/5′TCGCATGCCACTTCCTCAGT3′) were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

Ferromagnetic Resonance Biosensor for Homogeneous and Volumetric Detection of DNA

2017 ◽  
Author(s):  
Bo Tian ◽  
Peter Svedlindh ◽  
Mattias Strömberg ◽  
Erik Wetterskog
Keyword(s):  
Magnetic Nanoparticles ◽  
Ferromagnetic Resonance ◽  
Limit Of Detection ◽  
Point Of Care ◽  
Rolling Circle Amplification ◽  
Resonance Field ◽  
Isothermal Amplification ◽  
Detection Sensitivity ◽  
Serum Samples ◽  
Rolling Circle

In this work, we demonstrate for the first time, a ferromagnetic resonance (FMR) based homogeneous and volumetric biosensor for magnetic label detection. Two different isothermal amplification methods, <i>i.e.</i>, rolling circle amplification (RCA) and loop-mediated isothermal amplification (LAMP) are adopted and combined with a standard electron paramagnetic resonance (EPR) spectrometer for FMR biosensing. For RCA-based FMR biosensor, binding of RCA products of a synthetic Vibrio cholerae target DNA sequence gives rise to the formation of aggregates of magnetic nanoparticles. Immobilization of nanoparticles within the aggregates leads to a decrease of the net anisotropy of the system and a concomitant increase of the resonance field. A limit of detection of 1 pM is obtained with an average coefficient of variation of 0.16%, which is superior to the performance of other reported RCA-based magnetic biosensors. For LAMP-based sensing, a synthetic Zika virus target oligonucleotide is amplified and detected in 20% serum samples. Immobilization of magnetic nanoparticles is induced by their co-precipitation with Mg<sub>2</sub>P<sub>2</sub>O<sub>7</sub> (a by-product of LAMP) and provides a detection sensitivity of 100 aM. The fast measurement, high sensitivity and miniaturization potential of the proposed FMR biosensing technology makes it a promising candidate for designing future point-of-care devices.<br>

scholarly journals Addressing widespread misidentifications of traditional medicinal mushrooms in Sanghuangporus (Basidiomycota) through ITS barcoding and designation of reference sequences

IMA Fungus ◽  
2021 ◽  
Vol 12 (1) ◽  
Author(s):  
Shan Shen ◽  
Shi-Liang Liu ◽  
Ji-Hang Jiang ◽  
Li-Wei Zhou
Keyword(s):  
Species Identification ◽  
Rolling Circle Amplification ◽  
Practical Method ◽  
Morphological Characters ◽  
Its Sequences ◽  
Commercial Development ◽  
Medicinal Mushrooms ◽  
Rolling Circle ◽  
Reference Sequences ◽  
Its Barcoding

Abstract“Sanghuang” refers to a group of important traditionally-used medicinal mushrooms belonging to the genus Sanghuangporus. In practice, species of Sanghuangporus referred to in medicinal studies and industry are now differentiated mainly by a BLAST search of GenBank with the ITS barcoding region as a query. However, inappropriately labeled ITS sequences of “Sanghuang” in GenBank restrict accurate species identification and, to some extent, the utilization of these species as medicinal resources. We examined all available 271 ITS sequences related to “Sanghuang” in GenBank including 31 newly submitted sequences from this study. Of these sequences, more than half were mislabeled so we have now corrected the corresponding species names. The mislabeled sequences mainly came from strains utilized by non-taxonomists. Based on the analyses of ITS sequences submitted by taxonomists as well as morphological characters, we separate the newly described Sanghuangporus subbaumii from S. baumii and treat S. toxicodendri as a later synonym of S. quercicola. Fourteen species of Sanghuangporus are accepted, with intraspecific distances up to 1.30% (except in S. vaninii, S. weirianus and S. zonatus) and interspecific distances above 1.30% (except between S. alpinus and S. lonicerinus, and S. baumii and S. subbaumii). To stabilize the concept of these 14 species of Sanghuangporus, their taxonomic information and reliable ITS reference sequences are provided. Moreover, ten potential diagnostic sequences are provided for Hyperbranched Rolling Circle Amplification to rapidly confirm three common commercial species, viz. S. baumii, S. sanghuang, and S. vaninii. Our results provide a practical method for ITS barcoding-based species identification of Sanghuangporus and will promote medicinal studies and commercial development from taxonomically correct material.

scholarly journals MiRNA Detection Using a Rolling Circle Amplification and RNA-Cutting Allosteric Deoxyribozyme Dual Signal Amplification Strategy

Biosensors ◽  
2021 ◽  
Vol 11 (7) ◽  
pp. 222
Author(s):  
Chenxin Fang ◽  
Ping Ouyang ◽  
Yuxing Yang ◽  
Yang Qing ◽  
Jialun Han ◽  
...  
Keyword(s):  
Signal Amplification ◽  
Rolling Circle Amplification ◽  
Padlock Probe ◽  
Rolling Circle ◽  
Sensing Platform ◽  
Mirna Detection ◽  
Substrate Cleavage ◽  
Amplification Strategy ◽  
Circular Template ◽  
Dual Signal Amplification

A microRNA (miRNA) detection platform composed of a rolling circle amplification (RCA) system and an allosteric deoxyribozyme system is proposed, which can detect miRNA-21 rapidly and efficiently. Padlock probe hybridization with the target miRNA is achieved through complementary base pairing and the padlock probe forms a closed circular template under the action of ligase; this circular template results in RCA. In the presence of DNA polymerase, RCA proceeds and a long chain with numerous repeating units is formed. In the presence of single-stranded DNA (H1 and H2), multi-component nucleic acid enzymes (MNAzymes) are formed that have the ability to cleave substrates. Finally, substrates containing fluorescent and quenching groups and magnesium ions are added to the system to activate the MNAzyme and the substrate cleavage reaction, thus achieving fluorescence intensity amplification. The RCA–MNAzyme system has dual signal amplification and presents a sensing platform that demonstrates broad prospects in the analysis and detection of nucleic acids.

Sign in / Sign up

Export Citation Format

Share Document