scholarly journals Identification of Chili leaf curl virus Causing Leaf Curl Disease of Petunia in Oman

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
A. A. Al-Shihi ◽  
S. Akhtar ◽  
A. J. Khan
Keyword(s):  
Indian Subcontinent ◽  
Rolling Circle Amplification ◽  
Rapid Evolution ◽  
Post Inoculation ◽  
Multiple Sequence ◽  
Rolling Circle ◽  
Begomovirus Genome ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Petunias (Petunia × hybrida) are the most important ornamental plants in Oman. In 2012, petunias were observed in public parks and airport landscape in Dhofar region with symptoms of upward leaf curling, yellowing and vein clearing, and size reduction in leaves. Almost all plants in the surveyed landscape showed high infestation of Bemisia tabaci and symptoms that suggested infection with a begomovirus. Six symptomatic samples were collected from three different sites. All symptomatic samples were found PCR-positive with diagnostic primers for begomovirus (3) when DNA extracted from infected leaves was used as template. Nucleic acids extracted from the symptomatic leaves were used to amplify circular DNA molecules by rolling circle amplification method. The amplified concatameric products were digested with restriction enzyme PstI, which yielded a product ∼2.8 kb in size. The putative begomovirus fragment was cloned and sequenced in both orientations. Partial sequences of six clones were 99 to 100% similar and thus only two clones, PT-2 and PT-3, were fully sequenced. The whole genomes of both clones were 2,761 bp, and both were deposited in GenBank under accession numbers HF968755 and HF968756 for the isolates PT-2 and PT-3, respectively. Both sequences had six open reading frames; Rep, TrAP, REn, and C4 genes in complementary sense; and CP and V2 genes in virion-sense, typical of the begomovirus genome organization. Upon alignment, the two sequences showed 99.4% nucleotide identity with each other, thus representing isolates of a single begomovirus species. BlastN comparison showed PT-2 and PT-3 from petunia were 94 to 95% identical to the sequences of ChCLV from Oman (JN604490 to JN604500), which were obtained from other hosts. ClustalV multiple sequence alignment showed that isolates PT-2 and PT-3 shared maximum sequence identity of 93.3 and 92.8%, respectively, with an isolate of ChLCV-OM (JN604495). According to ICTV rules for begomoviruses, PT-3 should be considered to be a new strain of ChLCV-OM and PT-2 a variant of the already existing ChLCV-OM strain. We propose the name for this new strain as the “Petunia strain” of Chili leaf curl virus (ChLCV-Pet). Two infectious clones were constructed from the PT-2 and PT-3 sequences, clones as 1.75-genome sequences in a binary vector, suitable for agroinfection to confirm their infectivity. Both clones, PT-2 and PT-3, produced typical leaf curl disease symptoms upon inoculation on petunia 18 days post inoculation. The presence of the same virus in symptomatic field infected and inoculated petunia was confirmed by Southern blot using 650 bp DIG labeled probe prepared from CP region of PT-3 isolate. ChLCV-OM, a monopartite begomovirus, is widely associated with leaf curl disease of tomato and pepper in Oman, with its origin traced to the Indian subcontinent (2). Identification of a new strain of ChLCV from petunia provides evidence of an ongoing rapid evolution of begomoviruses in this region. Although petunia has been tested as an experimental host for some begomoviruses (1,4), this is the first report of petunia as natural host for ChLCV, a begomovirus previously reported in tomato and pepper in Oman. References: (1) Cui et al. J. Virol. 78:13966, 2004. (2) Khan et al. Virus Res. 177:87, 2013. (3) Khan et al. Plant Dis. 97:1396, 2013. (4) Urbino et al. Arch. Virol. 149:417, 2003.

scholarly journals First Report of Okra enation leaf curl virus and Associated Cotton leaf curl Multan betasatellite and Cotton leaf curl Multan alphasatellite Infecting Cotton in Pakistan: A New Member of the Cotton Leaf Curl Disease Complex

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1447-1447 ◽  
Author(s):  
U. Hameed ◽  
M. Zia-Ur-Rehman ◽  
H.-W. Herrmann ◽  
M. S. Haider ◽  
J. K. Brown
Keyword(s):  
Rolling Circle Amplification ◽  
Economic Security ◽  
Cotton Leaf ◽  
First Report ◽  
Begomovirus Genome ◽  
Cotton Leaf Curl Disease ◽  
Total Dna ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Cotton (Gossypium hirsutum L.) is an important and widely cultivated crop in Pakistan, upon which many rely for economic security. Cotton leaf curl disease (CLCuD) is caused by a complex comprising of more than eight species in the genus Begomovirus (family Geminiviridae) with associated betasatellite and alphasatellites. During 2011, characteristic symptoms of leaf curl disease were widespread (>40%), and the whitefly Bemisia tabaci (Genn.) vector of the leaf curl complex was abundant in commercial cotton fields in Burewala, Pakistan. Symptoms included vein thickening, upward or downward leaf curling, and foliar enations. To test for the presence of a begomovirus(es), total DNA was extracted from 100 mg of symptomatic leaf tissues from five different plants (isolates CLCuDBur1 to 5) using the CTAB method (1). Total DNA extracts were used for rolling circle amplification (RCA) using TempliPhi DNA Amplification Kit (GE Healthcare). Of the five field isolates, the RCA product for only one, CLCuDBur3, digested with HindIII, produced an apparently full-length ~2.7 kb fragment, suggesting that CLCuD-Bur3 represented a distinct isolate. The 2.7-kb fragment was cloned into the plasmid vector pGEM-3Zf+ (Promega, Madison, WI). To test for the presence of associated alphasatellites and betasatellites, the PCR primers, AlphaF/R and BetaF/R (2), were used to amplify the putative 1.4-kbp molecules. The resultant 1.4-kb PCR products were ligated into the pGEMT-Easy vector and cloned. Cloned inserts for each were subjected to DNA sequencing, bidirectionally. The cloned monopartite, helper begomovirus genome (HF567945), one betasatellite (HF567946), and one alphasatellite (HF567947) sequences were determined and found to be 2,742, 1,358, and 1,376 bases long, respectively. Pairwise sequence comparisons were carried out for each using the 10 most closely related species or strains (identified in GenBank using BLASTn) using MEGA5 software. The CLCuDBur3 genome sequence shared its highest identity (99.6%) with Okra enation leaf curl virus (OELCuV) (KC019308), so CLCuDBur3 is a variant of OELCuV, a begomovirus reported previously from Abelmoschus esculentus (L.) (okra) plants in India. The betasatellite and alphasatellite shared their highest nt identity at 96 and 98.7% with Cotton leaf curl Multan betasatellite (CLCuMB) (AM774311) and Cotton leaf curl Multan alphasatellite (CLCuMA), respectively (misnamed as CLCuBuA in GenBank) (FN658728). Additionally, the HindIII-digested RCA products were analyzed by Southern blot hybridization using a DIG-labeled DNA probe specific for the intergenic region of either Cotton leaf curl Burewala virus (CLCuBuV) or OELCuV. The OELCuV, but not the CLCuBuV, probe hybridized with HindIII digested RCA products (CLCuDBur3 genome), confirming the presence of OELCuV and the absence of CLCuBuV, the latter being the most prevalent begomovirus species infecting cotton in Pakistan. This is the first report of OELCuV infecting cotton plants in Pakistan, underscoring the discovery of yet another begomovirus member of the CLCuD complex. Further, the possible co-infection of cotton by OELCuV and other recognized species of the CLCuD complex could facilitate further diversification (potentially, through recombination) and lead to the emergence of new variants with the potential to cause damage to the cotton crop in Pakistan. References: (1) J. J. Doyle and J. L. Doyle. Focus. 12:13, 1990. (2) M. Zia-Ur-Rehman et al. Plant Dis. 97:1122, 2013.

scholarly journals First Report of Ageratum enation virus, Betasatellite and Alphasatellite Causing Leaf Curl and Enation Disease of Amaranthus hypochondriacus in India

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1285-1285 ◽  
Author(s):  
A. Srivastava ◽  
S. Kumar ◽  
S. K. Raj
Keyword(s):  
Sequence Data ◽  
Disease Incidence ◽  
Rolling Circle Amplification ◽  
Nucleotide Identity ◽  
Post Inoculation ◽  
Specific Primers ◽  
Rolling Circle ◽  
Amaranthus Hypochondriacus ◽  
Close Phylogenetic Relationship ◽  
Leaf Curl

During a survey in February 2011, severe symptoms of upward leaf curling, vein enation on lower side of the leaves, and shortening of internodes were observed on 20 out of 117 Amaranthus hypochondriacus plants (17% disease incidence) examined at breeding plots of CSIR-NBRI, Lucknow. These symptoms are typical of begomovirus infection. PCR with begomovirus-specific primers (3) produced the expected ~1.1-kb product from DNA extracts of 20 symptomatic plants but not from a non-symptomatic plant, suggesting the association of a begomovirus. The full-length begomoviral genome from a representative sample was amplified by rolling circle amplification using Ø-29 DNA polymerase and digested by BamHI, which resulted in a ~2.7 kb product when electrophoresed in 1.0% agarose gel. The product obtained was cloned, sequenced, and sequence data of 2,753 nucleotides was deposited in GenBank (Accession No. JF682242). BLASTn analysis revealed 97 to 98% nucleotide identity and forms a distinct clade with Ageratum enation virus (AEV) isolates. This shows the virus in A. hypochondriacus to be an isolate of AEV. The separate PCRs were also performed with betasatellite and alphasatellite specific primers (1,2) that resulted in ~1.3-kb amplicons from all samples, suggesting their association. The amplification products were cloned and sequenced. An analysis of betasatellite (JX512904) revealed highest 98% nucleotide identity and close phylogenetic relationship with Ageratum leaf curl betasatellite (ALCB, JQ710745). The alphasatellite (JX512905) showed highest 95% identity and close relationship with Hibiscus leaf curl alphasatellite (HLCA, FN794199). This shows the betasatellite and alphasatellite in A. hypochondriacus to be isolates of ALCB and HLCA, respectively. The partial direct repeat clones of the begomovirus (pCAM-AEV), betasatellite (pCAM-ALCB), alphasatellite (pCAM-HLCA) were generated and mobilized into Agrobacterium tumefaciens strain GV3101 and infiltrated in A. hypochondriacus seedlings. The plants inoculated with pCAM-AEV, pCAM-ALCB, and pCAM-HLCA; pCAM-AEV and pCAM-ALCB developed severe leaf curl and enation symptoms on 5/5 plant at 35 days post inoculation, which were similar to those of naturally infected plants, satisfying Koch's postulates. On the other hand, plants inoculated with pCAM-AEV alone or in combination with pCAM-HLCA developed mild symptoms. Plants inoculated with pCAM-ALCB and pCAM-HLCA did not develop symptoms. The results here show that leaf curl and enation disease of A. hypochondriacus in India is caused by AEV and ALCB and that an alphasatellite may be associated with symptomatic plants. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. E. Bull et al. Mol. Biotechnol. 23:83, 2003. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1746-1746 ◽  
Author(s):  
Y. H. Cheng ◽  
T. C. Deng ◽  
C. C. Chen ◽  
C. H. Chiang ◽  
C. A. Chang
Keyword(s):  
Rolling Circle Amplification ◽  
Pcr Primers ◽  
Passion Fruit ◽  
The Other ◽  
Passiflora Edulis ◽  
Rolling Circle ◽  
First Report ◽  
Immature Fruit ◽  
Leaf Curl Virus ◽  
Leaf Curl

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) ‘Tainung No. 1’ is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5′TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3′/5′CGCAGTTT CTGGAGGATATTAAG3′/5′TCGCATGCCACTTCCTCAGT3′) were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

Multiple infection, recombination and genome relationships among begomovirus isolates found in cotton and other plants in Pakistan

Microbiology ◽  
2000 ◽  
Vol 81 (7) ◽  
pp. 1839-1849 ◽  
Author(s):  
Ana I. Sanz ◽  
Aurora Fraile ◽  
Fernando García-Arenal ◽  
Xueping Zhou ◽  
David J. Robinson ◽  
...  
Keyword(s):  
Indian Subcontinent ◽  
Multiple Infection ◽  
Pcr Analysis ◽  
Cotton Leaf ◽  
Evolutionary Divergence ◽  
Cotton Leaf Curl Virus ◽  
Geographical Regions ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Begomoviruses occur in many plant species in Pakistan and are associated with an epidemic of cotton leaf curl disease that has developed since 1985. PCR analysis with primer pairs specific for each of four already sequenced types of DNA-A of cotton leaf curl virus (CLCuV-PK types a, 26, 72b and 804a), or for okra yellow vein mosaic virus (OYVMV), indicated that many individual naturally infected plants of cotton and other malvaceous species contained two or three begomovirus sequences. Similarly, sequence differences among overlapping fragments of begomovirus DNA-A, amplified from individual naturally infected plants, indicated much multiple infection in malvaceous and non-malvaceous species. Some cotton plants contained DNA-A sequences typical of begomoviruses from non-malvaceous species, and some non-malvaceous plants contained sequences typical of CLCuV-PK. Some DNA-A sequences were chimaeric; they each included elements typical of different types of CLCuV-PK, or of different malvaceous and/or non-malvaceous begomoviruses. Often an apparent recombination site occurred at the origin of replication. No complete CLCuV-PK DNA-A sequence was found in malvaceous or non-malvaceous species collected in Pakistan outside the area of the cotton leaf curl epidemic but chimaeric sequences, including a part that was typical of CLCuV-PK DNA-A, did occur there. We suggest that recombination among such pre-existing sequences was crucial for the emergence of CLCuV-PK. Recombination, following multiple infection, could also explain the network of relationships among many of the begomoviruses found in the Indian subcontinent, and their evolutionary divergence, as a group, from begomoviruses causing similar diseases in other geographical regions.

scholarly journals First Report of Papaya leaf curl virus Associated with Leaf Curl Disease in Cestrum nocturnum in Pakistan

Plant Disease ◽  
2020 ◽  
Vol 104 (11) ◽  
pp. 3089
Author(s):  
Aamir Lal ◽  
Eui-Joon Kil ◽  
Kainat Rauf ◽  
Muhammad Ali ◽  
Sukchan Lee
Keyword(s):  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Papaya Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Molecular Characterization of a Begomovirus, α-Satellite, and β-Satellite Associated with Leaf Curl Disease of Parthenium hysterophorus in India

Plant Disease ◽  
2016 ◽  
Vol 100 (11) ◽  
pp. 2299-2305 ◽  
Author(s):  
Susheel Kumar ◽  
Ashish Srivastava ◽  
Meraj Jaidi ◽  
Puneet Singh Chauhan ◽  
S. K. Raj
Keyword(s):  
Satellite Dna ◽  
Rolling Circle Amplification ◽  
Tomato Leaf ◽  
Parthenium Hysterophorus ◽  
Alternate Host ◽  
Invasive Weed ◽  
Tomato Leaf Curl Disease ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

Parthenium hysterophorus plants exhibiting severe leaf curl and stunting symptoms were observed near agriculture fields in Lucknow, India. The association of a begomovirus, β-satellite, and α-satellite with these symptoms of a Parthenium disease was investigated by sequence analyses of virus and satellite DNA amplified by rolling circle amplification and polymerase chain reaction. The highest sequence identities and closest phylogenetic relationships for the begomovirus, β-satellite, and α-satellite detected in P. hysterophorus plants were to Tomato leaf curl virus (ToLCV), papaya leaf curl β-satellite (PaLCuB), and Ageratum yellow vein India α-satellite (AYVIA), respectively. These findings identified the virus and satellites infecting the Parthenium sp. as ToLCV, PaLCuB, and AYVIA, respectively. P. hysterophorus and tomato seedlings infected with cloned ToLCV, PaLCuB, and AYVIA by agroinoculation developed leaf curl symptoms, whereas plants infected with ToLCV alone or with ToLCV and AYVIA developed mild yellowing. The results show that this complex infects and causes disease in P. hysterophorus and tomato. P. hysterophorus is an invasive weed commonly found around agricultural fields and along roadsides in India. These results indicate that P. hysterophorus plants infected with ToLCV and associated satellite DNA act as an alternate host (reservoir), and that could lead to increased incidence of tomato leaf curl disease.

scholarly journals Characterization of Begomoviruses Sampled during Severe Epidemics in Tomato Cultivars Carrying the Ty-1 Gene

2018 ◽  
Vol 19 (9) ◽  
pp. 2614 ◽  
Author(s):  
Covadonga Torre ◽  
Livia Donaire ◽  
Cristina Gómez-Aix ◽  
Miguel Juárez ◽  
Michel Peterschmitt ◽  
...  
Keyword(s):  
Rolling Circle Amplification ◽  
In Planta ◽  
Rolling Circle ◽  
Satellite Sequences ◽  
Major Species ◽  
Complete Sequences ◽  
Massive Sequencing ◽  
Group 2 ◽  
El Jadida ◽  
Leaf Curl Virus

Tomato yellow leaf curl virus (TYLCV, genus Begomovirus, family Geminiviridae) is a major species that causes a tomato disease for which resistant tomato hybrids (mainly carriers of the Ty-1/Ty-3 gene) are being used widely. We have characterized begomoviruses severely affecting resistant tomato crops in Southeast Spain. Circular DNA was prepared from samples by rolling circle amplification, and sequenced by massive sequencing (2015) or cloning and Sanger sequencing (2016). Thus, 23 complete sequences were determined, all belonging to the TYLCV Israel strain (TYLCV-IL). Massive sequencing also revealed the absence of other geminiviral and beta-satellite sequences. A phylogenetic analysis showed that the Spanish isolates belonged to two groups, one related to early TYLCV-IL isolates in the area (Group 1), and another (Group 2) closely related to El Jadida (Morocco) isolates, suggesting a recent introduction. The most parsimonious evolutionary scenario suggested that the TYLCV isolates of Group 2 are back recombinant isolates derived from TYLCV-IS76, a recombinant virus currently predominating in Moroccan epidemics. Thus, an infectious Group 2 clone (TYLCV-Mu15) was constructed and used in in planta competition assays against TYLCV-IS76. TYLCV-Mu15 predominated in single infections, whereas TYLCV-IS76 did so in mixed infections, providing credibility to a scenario of co-occurrence of both types of isolates.

Tomato Plant Flavonoids Increase Whitefly Resistance and Reduce Spread of Tomato yellow leaf curl virus

2019 ◽  
Author(s):  
Qixi Yao ◽  
Zhengke Peng ◽  
Hong Tong ◽  
Fengbo Yang ◽  
Gaoshan Xing ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Electrical Penetration Graph ◽  
Severe Damage ◽  
The World ◽  
New Varieties ◽  
Leaf Curl Virus ◽  
Phloem Feeding ◽  
Leaf Curl Disease ◽  
Leaf Curl

Abstract Tomato yellow leaf curl virus (TYLCV), a begomovirus (genus Begomovirus) is the causal agent of tomato yellow leaf curl disease (TYLCD), which causes severe damage to tomato (Solanum lycopersicum) crops throughout tropical and subtropical regions of the world. TYLCV is transmitted by the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) in a circulative and persistent manner. Our previous studies showed that tomato flavonoids deter B. tabaci oviposition, but the effects of tomato flavonoids on the settling and feeding behavior of B. tabaci and on its transmission of TYLCV are unknown. Using two near-isogenic tomato lines that differ greatly in flavonoid levels, we found that high flavonoid production in tomato deterred the landing and settling of B. tabaci. Moreover, electrical penetration graph studies indicated that high flavonoid levels in tomato reduced B. tabaci probing and phloem-feeding efficiency. As a consequence, high flavonoid levels in tomato reduced the primary and secondary spread of TYLCV. The results indicate that tomato flavonoids provide antixenosis resistance against B. tabaci and that the breeding of such resistance in new varieties could enhance TYLCD management.

scholarly journals Frequent occurrence of Mungbean yellow mosaic India virus in tomato leaf curl disease affected tomato in Oman

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
M. S. Shahid ◽  
M. Shafiq ◽  
M. Ilyas ◽  
A. Raza ◽  
M. N. Al-Sadrani ◽  
...  
Keyword(s):  
Rolling Circle Amplification ◽  
Monopartite Begomoviruses ◽  
Tomato Leaf ◽  
Bipartite Begomovirus ◽  
Rolling Circle ◽  
Tomato Leaf Curl Disease ◽  
Planting Material ◽  
Next Generation Sequencing Ngs ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Abstract Next generation sequencing (NGS) of DNAs amplified by rolling circle amplification from 6 tomato (Solanum lycopersicum) plants with leaf curl symptoms identified a number of monopartite begomoviruses, including Tomato yellow leaf curl virus (TYLCV), and a betasatellite (Tomato leaf curl betasatellite [ToLCB]). Both TYLCV and ToLCB have previously been identified infecting tomato in Oman. Surprisingly the NGS results also suggested the presence of the bipartite, legume-adapted begomovirus Mungbean yellow mosaic Indian virus (MYMIV). The presence of MYMIV was confirmed by cloning and Sanger sequencing from four of the six plants. A wider analysis by PCR showed MYMIV infection of tomato in Oman to be widespread. Inoculation of plants with full-length clones showed the host range of MYMIV not to extend to Nicotiana benthamiana or tomato. Inoculation to N. benthamiana showed TYLCV to be capable of maintaining MYMIV in both the presence and absence of the betasatellite. In tomato MYMIV was only maintained by TYLCV in the presence of the betasatellite and then only at low titre and efficiency. This is the first identification of TYLCV with ToLCB and the legume adapted bipartite begomovirus MYMIV co-infecting tomato. This finding has far reaching implications. TYLCV has spread around the World from its origins in the Mediterranean/Middle East, in some instances, in live tomato planting material. The results here may suggest that begomoviruses which do not commonly infect tomato, such as MYMIV, could be spread as a passenger of TYLCV in tomato.

Sign in / Sign up

Export Citation Format

Share Document