scholarly journals First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1746-1746 ◽  
Author(s):  
Y. H. Cheng ◽  
T. C. Deng ◽  
C. C. Chen ◽  
C. H. Chiang ◽  
C. A. Chang
Keyword(s):  
Rolling Circle Amplification ◽  
Pcr Primers ◽  
Passion Fruit ◽  
The Other ◽  
Passiflora Edulis ◽  
Rolling Circle ◽  
First Report ◽  
Immature Fruit ◽  
Leaf Curl Virus ◽  
Leaf Curl

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) ‘Tainung No. 1’ is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5′TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3′/5′CGCAGTTT CTGGAGGATATTAAG3′/5′TCGCATGCCACTTCCTCAGT3′) were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

scholarly journals Identification of Chili leaf curl virus Causing Leaf Curl Disease of Petunia in Oman

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
A. A. Al-Shihi ◽  
S. Akhtar ◽  
A. J. Khan
Keyword(s):  
Indian Subcontinent ◽  
Rolling Circle Amplification ◽  
Rapid Evolution ◽  
Post Inoculation ◽  
Multiple Sequence ◽  
Rolling Circle ◽  
Begomovirus Genome ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Petunias (Petunia × hybrida) are the most important ornamental plants in Oman. In 2012, petunias were observed in public parks and airport landscape in Dhofar region with symptoms of upward leaf curling, yellowing and vein clearing, and size reduction in leaves. Almost all plants in the surveyed landscape showed high infestation of Bemisia tabaci and symptoms that suggested infection with a begomovirus. Six symptomatic samples were collected from three different sites. All symptomatic samples were found PCR-positive with diagnostic primers for begomovirus (3) when DNA extracted from infected leaves was used as template. Nucleic acids extracted from the symptomatic leaves were used to amplify circular DNA molecules by rolling circle amplification method. The amplified concatameric products were digested with restriction enzyme PstI, which yielded a product ∼2.8 kb in size. The putative begomovirus fragment was cloned and sequenced in both orientations. Partial sequences of six clones were 99 to 100% similar and thus only two clones, PT-2 and PT-3, were fully sequenced. The whole genomes of both clones were 2,761 bp, and both were deposited in GenBank under accession numbers HF968755 and HF968756 for the isolates PT-2 and PT-3, respectively. Both sequences had six open reading frames; Rep, TrAP, REn, and C4 genes in complementary sense; and CP and V2 genes in virion-sense, typical of the begomovirus genome organization. Upon alignment, the two sequences showed 99.4% nucleotide identity with each other, thus representing isolates of a single begomovirus species. BlastN comparison showed PT-2 and PT-3 from petunia were 94 to 95% identical to the sequences of ChCLV from Oman (JN604490 to JN604500), which were obtained from other hosts. ClustalV multiple sequence alignment showed that isolates PT-2 and PT-3 shared maximum sequence identity of 93.3 and 92.8%, respectively, with an isolate of ChLCV-OM (JN604495). According to ICTV rules for begomoviruses, PT-3 should be considered to be a new strain of ChLCV-OM and PT-2 a variant of the already existing ChLCV-OM strain. We propose the name for this new strain as the “Petunia strain” of Chili leaf curl virus (ChLCV-Pet). Two infectious clones were constructed from the PT-2 and PT-3 sequences, clones as 1.75-genome sequences in a binary vector, suitable for agroinfection to confirm their infectivity. Both clones, PT-2 and PT-3, produced typical leaf curl disease symptoms upon inoculation on petunia 18 days post inoculation. The presence of the same virus in symptomatic field infected and inoculated petunia was confirmed by Southern blot using 650 bp DIG labeled probe prepared from CP region of PT-3 isolate. ChLCV-OM, a monopartite begomovirus, is widely associated with leaf curl disease of tomato and pepper in Oman, with its origin traced to the Indian subcontinent (2). Identification of a new strain of ChLCV from petunia provides evidence of an ongoing rapid evolution of begomoviruses in this region. Although petunia has been tested as an experimental host for some begomoviruses (1,4), this is the first report of petunia as natural host for ChLCV, a begomovirus previously reported in tomato and pepper in Oman. References: (1) Cui et al. J. Virol. 78:13966, 2004. (2) Khan et al. Virus Res. 177:87, 2013. (3) Khan et al. Plant Dis. 97:1396, 2013. (4) Urbino et al. Arch. Virol. 149:417, 2003.

scholarly journals First Report of Sweet potato leaf curl virus on Blue Morning Glory in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 700-700 ◽  
Author(s):  
E. Fiallo-Olivé ◽  
N. I. Katis ◽  
J. Navas-Castillo
Keyword(s):  
Sweet Potato ◽  
Rolling Circle Amplification ◽  
Morning Glory ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Potato Leaf ◽  
First Report ◽  
Crete Island ◽  
Leaf Curl Virus ◽  
Leaf Curl

Blue morning glory (Ipomoea indica, Convolvulaceae) plants are widespread along the Greek coast, where they grow as weeds in addition to being cultivated as ornamentals. Yellow vein symptoms are frequently observed on these plants. These symptoms are similar to those reported for isolates of Sweet potato leaf curl virus (SPLCV) infecting I. indica in Italy and Spain (1,3). SPLCV belongs to the sweepoviruses, a unique group within the genus Begomovirus in the family Geniminiviridae that infects sweet potato (I. batatas) crops around the world. In May 2013, three leaf samples of I. indica showing yellow vein symptoms were collected in Kolymbari (Crete Island), where ~50% of the observed plants were symptomatic, and five asymptomatic leaf samples were collected in Kremasti and Mandriko (Rhodes Island). Total DNA, isolated from all samples, was used as a template in rolling-circle amplification (RCA) using ϕ29 DNA polymerase (TempliPhi kit, GE Healthcare, Little Chalfont, UK) and the product was digested with a set of restriction endonucleases. The samples from Kolymbari and one sample from Kremasti yielded amplification products that were shown to contain a single BamHI site. The DNA fragments of ~2.8 kbp obtained from one sample from each island were cloned into pBluescript II SK(+) (Stratagene, La Jolla, CA). Inserts of two clones from the Kolymbari sample and one clone from the Kremasti sample were completely sequenced (Macrogen, Seoul, South Korea). Sequences were aligned with available sequences of sweepoviruses using MUSCLE and pairwise identity scores were calculated with SDT as described (4). The sequences obtained from Kolymbari (2,830 nt, GenBank Accession Nos. KF697069 and KF697070) were 98.8% similar between them and showed the highest nucleotide identity (97.7%) with a SPLCV isolate obtained from an I. indica plant in Sicily Island (Italy) (AJ586885) (1). The sequence obtained from Kremasti (2,804 nt, KF697071) showed the highest nucleotide identity (92.4%) with a SPLCV isolate (previously named as Ipomoea yellow vein virus, which is currently a synonym of SPLCV [2]) obtained from an I. indica plant from southern Spain (EU839578) (3). Nucleotide sequence identities were above the 91% threshold for begomovirus species demarcation (2), thus confirming that the begomoviruses found infecting I. indica in Greece are isolates of SPLCV. It is worth to note that the infected I. indica plant from Kremasti did not show any conspicuous symptoms, thus highlighting the importance of this species as an alternative host for SPLCV, which could thus affect the sweet potato crop that is grown in Greece in familiar plots. To our knowledge, this is the first report of SPLCV in Greece. References: (1) R. W. Briddon et al. Plant Pathol. 55:286, 2006. (2) ICTV Geminiviridae Study Group. New species and revised taxonomy proposal for the genus Begomovirus (Geminiviridae). ICTV. Retrieved from http://talk.ictvonline.org/files/proposals/taxonomy_proposals_plant1/ m/plant04/4720.aspx , 20 November 2013. (3) G. Lozano et al. J. Gen. Virol. 90:2550, 2009. (4) B. Muhire et al. Arch. Virol. 158:1411, 2013.

scholarly journals First Report of Tomato yellow leaf curl Kanchanaburi virus Infecting Eggplant in Laos

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 428-428 ◽  
Author(s):  
Y. F. Tang ◽  
Z. F. He ◽  
Z. G. Du ◽  
L. H. Lu
Keyword(s):  
Rolling Circle Amplification ◽  
Mosaic Disease ◽  
Tomato Yellow Leaf ◽  
Full Length ◽  
Bipartite Begomovirus ◽  
Yellow Leaf ◽  
Putative Orfs ◽  
Rolling Circle ◽  
First Report ◽  
Leaf Curl

Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) reported to infect tomato and eggplant in Thailand and Vietnam (1,2). In April 2013, eggplant (Solanum melongena L.) plants exhibiting yellow mosaic symptoms were found in a suburb of Vientiane, Laos. Three symptomatic samples were collected. Total DNA was extracted from leaves by the CTAB method, and used as template for PCR using the degenerate primer pair AV494/CoPR (3). The PCR results suggested that the plants were infected by a begomovirus. The begomoviral genome was amplified by rolling circle amplification (RCA) with TempliPhi kit (GE Healthcare) following the manufacturer's protocol. RCA product was digested with the endonucleases BamH I, EcoR I, Hind III, Kpn I, Pst I, and Xba I, respectively. The fragments about 2.1 kbp (with Pst I digestion) and 1.5 kbp (with Xba I digestion) in size were cloned and sequenced. The sequence of the 2.1-kbp fragment showed similarity with begomovirus DNA-A component. A pair of primers for amplification of the full-length DNA-A, AF (5′-CTTCATCGTTTCTCAGCATCAT-3′) and AR (5′-CACTTGCACACGATCTCTAAGA-3′) were designed from the 2.1-kbp sequence. The full-length DNA-A was 2,752 nucleotides and encoded six putative ORFs (GenBank Accession No. KF218820). The sequence of the 1.5-kbp fragment shared similarity with begomoviruses DNA-B. The begomoviral circular DNA-B was amplified using the pair of primers BF (5′-GTAACAGCCGAAGTGCACG-3′) and BR (5′-AATGGAGAGACACCAGTCTGCC-3′) designed from the 1.5-kbp sequence. PCR yielded a product of expected size (~1.4 kbp). The full-length DNA-B sequence was obtained by assembling the two sequences. The DNA-B was 2,734 nucleotides and encoded two putative ORFs (GenBank Accession No. KF218821). The sequences of DNA-A and DNA-B of isolate Laos shared the highest nucleotide sequences identities at 99.0% and 98.0% with those of TYLCKaV-[TH:Kan 1:01] (AF511529), and [TH:Kan 2:Egg:01] (AF511527), respectively. The results indicated that the virus associated with eggplant yellow mosaic disease was an isolate of TYLCKaV. To our knowledge, this is the first report of this begomovirus in Laos. Our results indicate that this virus may be spreading in Southeast Asia and scientists there should be aware of this virus when developing begomovirus-resistant varieties of tomato or eggplant. References: (1) S. K. Green et al. Plant Dis. 87:446, 2003. (2) C. Ha et al. J. Gen. Virol. 89:312, 2008.(3) Z. F. He et al. Arch. Virol. 154:1199, 2009.

scholarly journals First Report of Okra enation leaf curl virus and Associated Cotton leaf curl Multan betasatellite and Cotton leaf curl Multan alphasatellite Infecting Cotton in Pakistan: A New Member of the Cotton Leaf Curl Disease Complex

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1447-1447 ◽  
Author(s):  
U. Hameed ◽  
M. Zia-Ur-Rehman ◽  
H.-W. Herrmann ◽  
M. S. Haider ◽  
J. K. Brown
Keyword(s):  
Rolling Circle Amplification ◽  
Economic Security ◽  
Cotton Leaf ◽  
First Report ◽  
Begomovirus Genome ◽  
Cotton Leaf Curl Disease ◽  
Total Dna ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Cotton (Gossypium hirsutum L.) is an important and widely cultivated crop in Pakistan, upon which many rely for economic security. Cotton leaf curl disease (CLCuD) is caused by a complex comprising of more than eight species in the genus Begomovirus (family Geminiviridae) with associated betasatellite and alphasatellites. During 2011, characteristic symptoms of leaf curl disease were widespread (>40%), and the whitefly Bemisia tabaci (Genn.) vector of the leaf curl complex was abundant in commercial cotton fields in Burewala, Pakistan. Symptoms included vein thickening, upward or downward leaf curling, and foliar enations. To test for the presence of a begomovirus(es), total DNA was extracted from 100 mg of symptomatic leaf tissues from five different plants (isolates CLCuDBur1 to 5) using the CTAB method (1). Total DNA extracts were used for rolling circle amplification (RCA) using TempliPhi DNA Amplification Kit (GE Healthcare). Of the five field isolates, the RCA product for only one, CLCuDBur3, digested with HindIII, produced an apparently full-length ~2.7 kb fragment, suggesting that CLCuD-Bur3 represented a distinct isolate. The 2.7-kb fragment was cloned into the plasmid vector pGEM-3Zf+ (Promega, Madison, WI). To test for the presence of associated alphasatellites and betasatellites, the PCR primers, AlphaF/R and BetaF/R (2), were used to amplify the putative 1.4-kbp molecules. The resultant 1.4-kb PCR products were ligated into the pGEMT-Easy vector and cloned. Cloned inserts for each were subjected to DNA sequencing, bidirectionally. The cloned monopartite, helper begomovirus genome (HF567945), one betasatellite (HF567946), and one alphasatellite (HF567947) sequences were determined and found to be 2,742, 1,358, and 1,376 bases long, respectively. Pairwise sequence comparisons were carried out for each using the 10 most closely related species or strains (identified in GenBank using BLASTn) using MEGA5 software. The CLCuDBur3 genome sequence shared its highest identity (99.6%) with Okra enation leaf curl virus (OELCuV) (KC019308), so CLCuDBur3 is a variant of OELCuV, a begomovirus reported previously from Abelmoschus esculentus (L.) (okra) plants in India. The betasatellite and alphasatellite shared their highest nt identity at 96 and 98.7% with Cotton leaf curl Multan betasatellite (CLCuMB) (AM774311) and Cotton leaf curl Multan alphasatellite (CLCuMA), respectively (misnamed as CLCuBuA in GenBank) (FN658728). Additionally, the HindIII-digested RCA products were analyzed by Southern blot hybridization using a DIG-labeled DNA probe specific for the intergenic region of either Cotton leaf curl Burewala virus (CLCuBuV) or OELCuV. The OELCuV, but not the CLCuBuV, probe hybridized with HindIII digested RCA products (CLCuDBur3 genome), confirming the presence of OELCuV and the absence of CLCuBuV, the latter being the most prevalent begomovirus species infecting cotton in Pakistan. This is the first report of OELCuV infecting cotton plants in Pakistan, underscoring the discovery of yet another begomovirus member of the CLCuD complex. Further, the possible co-infection of cotton by OELCuV and other recognized species of the CLCuD complex could facilitate further diversification (potentially, through recombination) and lead to the emergence of new variants with the potential to cause damage to the cotton crop in Pakistan. References: (1) J. J. Doyle and J. L. Doyle. Focus. 12:13, 1990. (2) M. Zia-Ur-Rehman et al. Plant Dis. 97:1122, 2013.

scholarly journals First Report of Chickpea chlorotic dwarf virus Infecting Hot Pepper in India

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
H.-S. Byun ◽  
E.-J. Kil ◽  
S. Kim ◽  
H. Hwang ◽  
J. H. Lee ◽  
...  
Keyword(s):  
Rolling Circle Amplification ◽  
Rna Extraction ◽  
Dwarf Virus ◽  
Viral Gene ◽  
Hot Pepper ◽  
Viral Dna ◽  
First Report ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Hot pepper (Capsicum annuum) cultivated in India has been identified as a host of geminiviruses causing leaf curl disease such as Chilli leaf curl virus and Pepper leaf curl virus, leading to serious crop losses (3). In June 2013, hot pepper plants growing in Bangalore showed stunting and upward leaf curling. Viral DNA was extracted from a hot pepper with a Viral Gene-spin Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea) and amplified by rolling circle amplification using the illustra TempliPhi 100 Amplification Kit (GE Healthcare, Uppsala, Sweden) (2). Amplified products were digested by restriction enzyme KpnI (Takara Bio, Shiga, Japan), cloned, and sequenced (Macrogen, Seoul, Korea). Based on a BLAST search, a 2.6-kb DNA obtained from one plant sample was identified as Chickpea chlorotic dwarf virus (CpCDV), belonging to the genus Mastrevirus (family Geminiviridae) (GenBank Accession No. KF632712). The CpCDV-Bangalore isolate is 2,585 bases in length and exhibits 85.9 to 98.5% identity to previously reported CpCDV isolates. To our knowledge, this is the first report of CpCDV infecting hot pepper in India. CpCDV was recently reported from pepper plants in Oman (KF111683) (1), but it shared the lowest sequence identity (85.9%) with CpCDV-Bangalore isolate. References: (1) S. Akhtar et al. Plant Dis. 98:286, 2014. (2) E.-J. Kil et al. Arch. Virol. 159:2387. (3) D. M. J. B. Senanayake et al. Plant Pathol. 56:343, 2007.

scholarly journals First Report of Tomato yellow leaf curl virus in Tomato in Guadeloupe

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1397-1397 ◽  
Author(s):  
C. Urbino ◽  
K. Tassius
Keyword(s):  
Puerto Rico ◽  
Pcr Primers ◽  
Tomato Yellow Leaf ◽  
Yellow Mosaic Virus ◽  
Yellow Leaf ◽  
Tomato Production ◽  
First Report ◽  
Embl Accession ◽  
Leaf Curl Virus ◽  
Leaf Curl

In September 2001, symptoms of stunting and chlorotic curled leaves of reduced size were observed on tomato plants in Guadeloupe. These symptoms were different from those described for Potato yellow mosaic virus, which has been present since 1993, but similar to those described for Tomato yellow leaf curl virus (TYLCV). Samples from symptomatic plants were collected and analyzed by polymerase chain reaction (PCR). Primers PC1 (5′-TGACTATGTCGAAGCGACCAGG-3′) and PC2 (5′-CGACATTACAGCCTCAGACTGG-3′) were designed to amplify a 950-bp fragment within the coat protein gene (CP) of TYLCV-IL species (2). Primer pair MP16/MP82 (3) amplified a 550-bp fragment from the conserved nonanucleotide sequence (TAATATTAC) to the 5′ end of the CP gene. Products of expected sizes were obtained with both pairs of primers from all symptomatic samples but not from uninfected samples. A 950-bp and a 550-bp PCR product were cloned into a pGEM-T Easy Vector (Promega, Madison, WI) and sequenced with plasmid specific primers (SP6 and T7). Sequences were compared with those available in the NCBI database using BlastN. Fifteen of the sequences that gave the highest score with BlastN were aligned with the Guadeloupe sequences using Clustal W. The nucleotide sequence of the 950-bp fragment (GenBank Accession No. AY319645) shared at least 97% sequence identity with that of TYLCV from Israel (EMBL Accession No. X15656), Puerto Rico (GenBank Accession No. AY134494), Cuba (EMBL Accession No. AJ223505), and the Dominican Republic (GenBank Accession No. AF024715). Similar percentages of identity were obtained with the 550-bp sequence (GenBank Accession No. AY319646). These results confirm that a begomovirus belonging to the species TYLCV-Israel is infecting tomato in Guadeloupe. To our knowledge, this is the first report of TYLCV in this region of the Caribbean. Puerto Rico is the closest location from which TYLCV was previously reported (1). In May 2002, typical TYLCV symptoms were observed in all tomato production areas at an incidence of 80 to 100%. References: (1) J. Bird et al. Plant Dis. 85:1028, 2001. (2) Y. Martinez et al. Rev. Prot. Veg. 18:168, 2003. (3) P. Umaharan et al. Phytopathology 88:1262, 1998.

scholarly journals First Report of the Occurrence of Sweet potato leaf curl virus in Tall Morningglory (Ipomoea purpurea) in China

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 764-764 ◽  
Author(s):  
C. X. Yang ◽  
Z. J. Wu ◽  
L. H. Xie
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Ipomoea Batatas ◽  
Rolling Circle Amplification ◽  
The United States ◽  
Natural Occurrence ◽  
Potato Leaf ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Natural occurrence of Sweet potato leaf curl virus (SPLCV) has been reported in Ipomoea batatas (sweet potato, Convolvulaceae) or I. indica (Convolvulaceae) in several countries including the United States, Sicily, and China (1–3). In September of 2007, while collecting samples showing begomovirus-like symptoms in the Chinese province of Fujian, we observed tall morningglory (I. purpurea (L.) Roth, also known as Pharbitis purpurea (L.) Voigt), plants with slightly yellow mosaic and crinkled leaves. Total DNA was extracted from leaves of these plants and tested by rolling circle amplification (4). Amplification products were digested by the restriction enzyme BamHI for 30 min. Restriction products (2.8 kb) were then cloned into pMD18T vector (Takara Biotechnology, China) and sequenced. Comparison of complete DNA sequences by Clustal V analysis revealed that these samples were infected by the same virus, and an isolate denoted F-p1 was selected for further sequence analysis. F-p1 was 2,828 nucleotides, with the typical genomic organization of begomoviral DNA-A (GenBank Accession No. FJ515896). F-p1 was compared with the DNA sequences available in the NCBI database using BLAST. The whole DNA sequence showed the highest nucleotide sequence identity (92.1%) with an isolate of SPLCV (GenBank Accession No. FJ176701) from Jiangsu Province of China. The result confirmed that the samples from the symptomatic tall morningglory were infected by SPLCV. To our knowledge, this is the first report of the natural occurrence of SPLCV in I. purpurea, a common weed species in China. References: (1). P. Lotrakul et al. Plant Dis. 82:1253, 1998. (2). R. W. Briddon et al. Plant Pathol. 55:286, 2006. (3) Y. S. Luan et al. Virus Genes 35:379, 2007. (4) D. Haible et al. J. Virol. Methods 135:9, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Sign in / Sign up

Export Citation Format

Share Document