scholarly journals Virus Diseases of Cereal and Oilseed Crops in Australia: Current Position and Future Challenges

Viruses ◽  
2021 ◽  
Vol 13 (10) ◽  
pp. 2051
Author(s):  
Roger A. C. Jones ◽  
Murray Sharman ◽  
Piotr Trębicki ◽  
Solomon Maina ◽  
Benjamin S. Congdon
Keyword(s):  
Mosaic Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Extreme Weather Events ◽  
Tobacco Streak Virus ◽  
Streak Virus ◽  
Virus Diseases ◽  
Diverse Range ◽  
Oilseed Crops ◽  
Yellow Dwarf Virus

This review summarizes research on virus diseases of cereals and oilseeds in Australia since the 1950s. All viruses known to infect the diverse range of cereal and oilseed crops grown in the continent’s temperate, Mediterranean, subtropical and tropical cropping regions are included. Viruses that occur commonly and have potential to cause the greatest seed yield and quality losses are described in detail, focusing on their biology, epidemiology and management. These are: barley yellow dwarf virus, cereal yellow dwarf virus and wheat streak mosaic virus in wheat, barley, oats, triticale and rye; Johnsongrass mosaic virus in sorghum, maize, sweet corn and pearl millet; turnip yellows virus and turnip mosaic virus in canola and Indian mustard; tobacco streak virus in sunflower; and cotton bunchy top virus in cotton. The currently less important viruses covered number nine infecting nine cereal crops and 14 infecting eight oilseed crops (none recorded for rice or linseed). Brief background information on the scope of the Australian cereal and oilseed industries, virus epidemiology and management and yield loss quantification is provided. Major future threats to managing virus diseases effectively include damaging viruses and virus vector species spreading from elsewhere, the increasing spectrum of insecticide resistance in insect and mite vectors, resistance-breaking virus strains, changes in epidemiology, virus and vectors impacts arising from climate instability and extreme weather events, and insufficient industry awareness of virus diseases. The pressing need for more resources to focus on addressing these threats is emphasized and recommendations over future research priorities provided.

Virus diseases of pasture grasses in Australia: incidences, losses, epidemiology, and management

2013 ◽  
Vol 64 (3) ◽  
pp. 216 ◽  
Author(s):  
Roger A. C. Jones
Keyword(s):  
Mosaic Virus ◽  
Host Resistance ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Grass Species ◽  
Virus Diseases ◽  
Pasture Grass ◽  
Pasture Grasses ◽  
Mediterranean Pasture ◽  
Yellow Dwarf Virus

This paper reviews current knowledge for Australia over the occurrence, losses caused, epidemiology, and management of virus diseases of pasture grasses. It also reviews all records of viruses in wild grasses likely to act as alternative host reservoirs for virus spread to nearby pastures or crops. Currently, 21 viruses have been found infecting 36 pasture or forage grass species and 59 wild grass species. These viruses are transmitted by arthropod vectors (mites or insects) or, in one instance, via grass seeds. Their modes of transmission are critical factors determining their incidences within pastures in different climatic zones. Large-scale surveys of perennial grass pastures growing in regions with temperate–Mediterranean climates revealed that Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and Ryegrass mosaic virus (RyMV) sometimes reach high infection incidences. The same was true for BYDV and CYDV when perennial pasture grasses and wild grasses growing outside pastures were surveyed to establish their occurrence. Smaller scale surveys of grasses growing both inside and outside annual pastures found that Wheat streak mosaic virus (WSMV) infection could also reach high incidences in some annual grass species. Herbage yield loss data are available demonstrating potentially serious impacts on pasture production under Australian conditions from BYDV infection in perennial ryegrass swards, and from RyMV infection in both perennial and Italian ryegrass swards. Also, infection with BYDV or RyMV diminished the ability of infected pasture grass plants to compete with pasture legumes or weeds. Host resistance to BYDV, CYDV, and/or RyMV has been identified within a few temperate–Mediterranean pasture grasses, and is available for use in Australian pasture breeding programs. Integrated Disease Management tactics involving phytosanitary, cultural, chemical, and host resistance measures were devised against BYDV, CYDV, and RyMV infection in mixed species pasture, but no field experiments were undertaken with pasture grasses to validate their inclusion. Several other grass viruses that occur in other countries, but have not been looked for in Australia, are potentially important, especially in temperate–Mediterranean pasture grass species. With few exceptions, research on viruses of perennial or annual tropical–subtropical pasture or wild grass species growing within or outside pastures has focussed only on virus identification and characterisation studies, and information on incidences in pastures, losses caused, epidemiology, and management is lacking. Critical research and development gaps that need addressing are identified.

scholarly journals Occurrence and molecular characterization of wheat streak mosaic virus in wheat in Serbia

2020 ◽  
Vol 35 (2) ◽  
pp. 117-131
Author(s):  
Ana Vucurovic ◽  
Ivana Stankovic ◽  
Katarina Zecevic ◽  
Branka Petrovic ◽  
Goran Delibasic ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Mosaic Virus ◽  
Wheat Streak Mosaic Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Streak Virus ◽  
Nucleotide Position ◽  
Rt Pcr ◽  
Cp Gene ◽  
Yellow Dwarf Virus

The wheat streak mosaic virus (WSMV), vectored by the wheat curl mite, is globally distributed and threatens wheat production worldwide. Since its first occurrence in Serbia in the 1960s, WSMV presence has not been monitored. In 2019, a total of 62 samples of fi ve wheat cultivars from eight locations in Serbia were collected and tested for the presence of nine common wheat viruses: WSMV, barley yellow dwarf virus-PAV, -MAV, -SGV, and -RMV, cereal yellow dwarf virus-RPV, wheat spindle streak virus, brome mosaic virus, and soil-borne wheat mosaic virus, using individual or multiplex RT-PCR. WSMV was detected in 58.1% of the tested samples in seven wheat crops at five different locations. Species-specific primers failed to detect the presence of the other eight tested viruses. For further confirmation of WSMV, RT-PCR with the WS8166F/WS8909R primers covering the coat protein (CP) gene was carried out for both amplification and sequencing. The amplified product of the correct predicted size (750 bp) derived from four selected isolates, 98-19, 99-19, 102-19 and 120-19, was sequenced and deposited in GenBank (MT461299, MT461300, MT461301 and MT461302, respectively). Serbian WSMV isolates showed very high nucleotide identity (98.16-99.02%) and shared a deletion of triplet codon GCA at nucleotide position 8412- 8414 resulting in deletion of glycine amino acid (Gly2761). Phylogenetic analysis conducted on CP gene sequences revealed the existence of four clades, named A, B, C and D, and one recently introduced clade B1. All Serbian wheat WSMV isolates grouped into clade B together with other European isolates and one isolate from Iran. The results of this study provide the first insight into molecular characterisation of Serbian WSMV isolates, indicating their close relationship with other European isolates and existence of a single genotype in the country. Phylogenetic analysis also confirms the dispersal of WSMV isolates throughout Europe from a single locus.

scholarly journals The virus infection of South-Hungarian corn fields

2011 ◽  
pp. 52-55
Author(s):  
Melinda Apró ◽  
Mária Papp ◽  
Eszter Cseh ◽  
Richard Gáborjányi ◽  
József Horváth ◽  
...  
Keyword(s):  
Virus Infection ◽  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Brome Mosaic Virus ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Virus Diseases ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus ◽  
Das Elisa

The past years cereal diseases, including the virus diseases have been increased in Hungary as well as worldwide. The aim of our work was to survey the virus infection of South Hungarian wheat fields. Leaf samples were collected in Szeged at the experimental farm of Cereal Research Nonprofit Co., in April and Junes of 2009 and 2010. DAS ELISA tests were carried out using Loewe antisera of Brome mosaic virus (BMV), Barley yellow dwarf virus (BYDV), Barley stripe mosaic virus (BSMV), Brome streak mosaic virus (BStMV), Wheat dwarf virus (WDV), and Wheat streak mosaic virus (WSMV) and measured with Labsystem Multiscan RC Elisa reader at 405nm. In the samples of 2009 the Wheat dwarf and Wheat streak mosaic viruses were dominated. It was also significant the appearance of the. Barley yellow dwarf virus. 2010. was favourable for the spread of the virus vectors, therefore the incidence of virus diseases increased.

Occurrence of Viruses in Wheat in the Great Plains Region, 2008

2009 ◽  
Vol 10 (1) ◽  
pp. 14 ◽  
Author(s):  
Mary Burrows ◽  
Gary Franc ◽  
Charlie Rush ◽  
Tamla Blunt ◽  
Dai Ito ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Great Plains ◽  
Barley Yellow Dwarf Virus ◽  
Average Frequency ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
High Plains ◽  
Virus Infections ◽  
Yellow Dwarf Virus ◽  
First Time

Field surveys in 2008 determined the prevalence and diversity of viruses present in the Great Plains wheat crops. Symptomatic plants (n = 754) in nine states were tested for Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV, formerly known as High Plains virus), Triticum mosaic virus (TriMV), Barley yellow dwarf virus-PAV (BYDV-PAV), and Cereal yellow dwarf virus-RPV (CYDV-RPV), using indirect ELISA. Virus prevalence varied greatly, with average frequency of detection highest for WSMV (47%), followed by WMoV (19%), TriMV (17%), BYDV-PAV (7%), and lowest for CYDV-RPV (2%). Most positive plant samples (37%) had one virus present, with decreasing frequencies for co-infection by two (19%), three (5%), or four viruses (1%). TriMV was detected for the first time in Colorado, Nebraska, Oklahoma, South Dakota, Texas, and Wyoming. WMoV was identified for the first time in Montana and Wyoming. Chlorotic streaks were more frequently associated with WSMV, WMoV, and TriMV (R = 0.166 to 0.342; P < 0.05), and stunting was more frequently associated with WMoV (R = 0.142; P = 0.004) or TriMV (R = 0.107; P = 0.033) than WSMV. Symptom severity did not increase with co-infection as compared to single virus infections, with the exception of plants co-infected with mite transmitted viruses in Texas. Accepted for publication 1 May 2009. Published 6 July 2009.

scholarly journals Status and Epidemiology of Maize Lethal Necrotic Disease in Northern Tanzania

Pathogens ◽  
2019 ◽  
Vol 9 (1) ◽  
pp. 4 ◽  
Author(s):  
Fatma Hussein Kiruwa ◽  
Samuel Mutiga ◽  
Joyce Njuguna ◽  
Eunice Machuka ◽  
Senait Senay ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Plant Diseases ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Maize Dwarf Mosaic Virus ◽  
Rt Pcr ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Yellow Dwarf Virus

Sustainable control of plant diseases requires a good understanding of the epidemiological aspects such as the biology of the causal pathogens. In the current study, we used RT-PCR and Next Generation Sequencing (NGS) to contribute to the characterization of maize lethal necrotic (MLN) viruses and to identify other possible viruses that could represent a future threat in maize production in Tanzania. RT-PCR screening for Maize Chlorotic Mottle Virus (MCMV) detected the virus in the majority (97%) of the samples (n = 223). Analysis of a subset (n = 48) of the samples using NGS-Illumina Miseq detected MCMV and Sugarcane Mosaic Virus (SCMV) at a co-infection of 62%. The analysis further detected Maize streak virus with an 8% incidence in samples where MCMV and SCMV were also detected. In addition, signatures of Maize dwarf mosaic virus, Sorghum mosaic virus, Maize yellow dwarf virus-RMV and Barley yellow dwarf virus were detected with low coverage. Phylogenetic analysis of the viral coat protein showed that isolates of MCMV and SCMV were similar to those previously reported in East Africa and Hebei, China. Besides characterization, we used farmers’ interviews and direct field observations to give insights into MLN status in different agro-ecological zones (AEZs) in Kilimanjaro, Mayara, and Arusha. Through the survey, we showed that the prevalence of MLN differed across regions (P = 0.0012) and villages (P < 0.0001) but not across AEZs (P > 0.05). The study shows changing MLN dynamics in Tanzania and emphasizes the need for regional scientists to utilize farmers’ awareness in managing the disease.

scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

scholarly journals Occurrence of Viruses and Associated Grain Yields of Paired Symptomatic and Nonsymptomatic Tillers in Kansas Winter Wheat Fields

2016 ◽  
Vol 106 (2) ◽  
pp. 202-210 ◽  
Author(s):  
Dorith Rotenberg ◽  
William W. Bockus ◽  
Anna E. Whitfield ◽  
Kaylee Hervey ◽  
Kara D. Baker ◽  
...  
Keyword(s):  
Winter Wheat ◽  
Grain Yield ◽  
Mosaic Virus ◽  
The State ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Grain Yields ◽  
Yellow Dwarf Virus ◽  
Variety Performance ◽  
Performance Trial

Vector-borne virus diseases of wheat are recurrent in nature and pose significant threats to crop production worldwide. In the spring of 2011 and 2012, a state-wide sampling survey of multiple commercial field sites and university-managed Kansas Agricultural Experiment Station variety performance trial locations spanning all nine crop-reporting regions of the state was conducted to determine the occurrence of Barley yellow dwarf virus-PAV (BYDV-PAV), Cereal yellow dwarf virus-RPV, Wheat streak mosaic virus (WSMV), High plains virus, Soilborne wheat mosaic virus, and Wheat spindle streak mosaic virus using enzyme-linked immunosorbent assays (ELISA). As a means of directly coupling tiller infection status with tiller grain yield, multiple pairs of symptomatic and nonsymptomatic plants were selected and individual tillers were tagged for virus species and grain yield determination at the variety performance trial locations. BYDV-PAV and WSMV were the two most prevalent species across the state, often co-occurring within location. Of those BYDV-PAV- or WSMV-positive tillers, 22% and 19%, respectively, were nonsymptomatic, a finding that underscores the importance of sampling criteria to more accurately assess virus occurrence in winter wheat fields. Symptomatic tillers that tested positive for BYDV-PAV produced significantly lower grain yields compared with ELISA-negative tillers in both seasons, as did WSMV-positive tillers in 2012. Nonsymptomatic tillers that tested positive for either of the two viruses in 2011 produced significantly lower grain yields than tillers from nonsymptomatic, ELISA-negative plants, an indication that these tillers were physiologically compromised in the absence of virus-associated symptoms. Overall, the virus survey and tagged paired-tiller sampling strategy revealed effects of virus infection on grain yield of individual tillers of plants grown under field conditions and may provide a complementary approach toward future estimates of the impact of virus incidence on crop health in Kansas.

scholarly journals Occurrence of Winter Cereal Viruses in New South Wales, Australia, 2006 to 2014

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 313-317 ◽  
Author(s):  
Andrew Milgate ◽  
Dante Adorada ◽  
Grant Chambers ◽  
Mary Ann Terras
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
New South ◽  
New South Wales ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Winter Cereal ◽  
Barley Yellow Dwarf ◽  
South Wales ◽  
Yellow Dwarf Virus

Winter cereal viruses can cause significant crop losses; however, detailed knowledge of their occurrence in New South Wales, Australia is very limited. This paper reports on the occurrence of Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and their serotypes between 2006 and 2014. Detection of WMoV is confirmed in eastern Australia for the first time. The BYDV and CYDV 2014 epidemic is examined in detail using 139 samples of wheat, barley, and oat surveyed from southern New South Wales. The presence of virus was determined using enzyme-linked immunosorbent assays. The results reveal a high frequency of the serotype Barley yellow dwarf virus - MAV as a single infection present in 27% of samples relative to Barley yellow dwarf virus - PAV in 19% and CYDV in 14%. Clear differences emerged in the infection of different winter cereal species by serotypes of BYDV and CYDV. These results are contrasted to other Australian and international studies.

scholarly journals First Record of Barley yellow striate mosaic virus and Cereal yellow dwarf virus-RPV Infecting Wheat in Uzbekistan

Plant Disease ◽  
2001 ◽  
Vol 85 (10) ◽  
pp. 1122-1122 ◽  
Author(s):  
K. M. Makkouk ◽  
S. G. Kumari ◽  
Z. Kadirova ◽  
A. Zueva
Keyword(s):  
Mosaic Virus ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Western Blots ◽  
Cereal Yellow Dwarf Virus ◽  
Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Yellow Dwarf Virus

A preliminary survey to identify virus diseases affecting wheat in Uzbekistan was conducted during May 2001. The survey covered 12 wheat fields from 2 cereal-growing regions (Tashkent-Angren and Tashkent-Samarkand). A total of 250 wheat samples with symptoms suggestive of virus infection were collected and tested for the presence of nine viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria, using the following antisera: monoclonal antibodies for Cereal yellow dwarf virus-RPV (CYDV-RPV) (ATCC PVAS-669 [American Type Culture Collection, Manassas, VA]) and Barley yellow dwarf virus-MAV (BYDV-MAV) (ATCC PVAS-673); and polyclonal antibodies for BYDV-SGV and BYDV-RMV (3); BYDV-PAV, Barley stripe mosaic virus, and Wheat streak mosaic virus (from Virology Laboratory, ICARDA); Wheat dwarf virus (provided by J. Vacke, Research Institute of Crop Production, Prague, Czeck Republic); and Barley yellow striate mosaic virus (BYSMV) isolated from Lebanon (2). The most common virus present was BYDV-PAV (detected in 12% of the 250 samples tested), followed by BYDV-SGV (10.8%), BYSMV (5.6%), BYDV-RMV (2.4%), BYDV-MAV (2%), and CYDV-RPV (1.2%). CYDV-RPV was detected in three fields; one field was 50 km southeast of Tashkent, and the other two fields were between Tashkent and Samarkand. The majority of BYSMV-positive samples originated from the same field, ≈40 km northeast of Samarkand. Field symptoms of BYSMV-infected plants included yellow flag leaf and stunting. All samples that produced a positive reaction to BYSMV-Lebanon antiserum were tested against four other rhabdovirus antisera: BYSMV-Italy, BYSMV-Morocco, Cereal chlorotic mottle virus, and American wheat striate mosaic virus. Serological tests showed that 100% of the samples reacted strongly with BYSMV-Italy and BYSMV-Morocco. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by western blots, extracts from BYSMV-infected plants were found to contain 66- and 47-kDa structural proteins, typical of G and N proteins of rhabdoviruses, both of which reacted strongly with BYSMV-Italy antiserum. To our knowledge, this is the first report of BYSMV and CYDV-RPV in Uzbekistan. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk et al. Plant Dis. 85:446, 2001. (3) G. N. Webby and R. M. Lister. Plant Dis. 76:1125, 1992.

Sign in / Sign up

Export Citation Format

Share Document