Use of RCA-PCR assay for detection of Begomovirus infection in Bhut Jolokia (Capsicum assamicum) in Tezpur region of Assam, India

2016 ◽  
Vol 6 (2) ◽  
pp. 64-69
Author(s):  
Ajitabh Bora ◽  
Hemant Kumar Gogoi ◽  
Mohan C. Kalita
Keyword(s):  
Rolling Circle Amplification ◽  
Viral Disease ◽  
Viral Pathogen ◽  
Rolling Circle ◽  
North East India ◽  
North East ◽  
Detection Assay ◽  
A Genome ◽  
Bhut Jolokia ◽  
Leaf Curl

Bhut Jolokia (Capsicum assamicum), one of the hottest chilli in the world is a chilli cultivar, endemic to North East India and is extensively cultivated in the states of Assam, Nagaland and Manipur. The demand of this chilli is very high in domestic as well as in the international market due to its extreme hotness and pleasant aroma. This plant is severely affected by leaf curl disease caused by Begomovirus, leading to total crop loss. Accurate diagnosis of this viral disease at seedling stage, prior to transplanting, is essential to prevent further spread of the disease. With an aim to device a rapid and accurate detection assay, Rolling Circle Amplification (RCA)-Polymerase Chain Reac-tion (PCR) technique was used for detection of the viral pathogen. RCA tech-nique was employed to increase the viral template and PCR was conducted using a degenerate primer pair. With the help of this assay, 1.4 kbp segment of DNA-A genome of the Begomovirus was amplified. Phylogeny revealed close proximity of the isolate with Tomato leaf curl Bangladesh virus. This is the first report on characterization of Begomovirus infecting Bhut Jolokia in Tezpur region of Assam.

scholarly journals Frequent occurrence of Mungbean yellow mosaic India virus in tomato leaf curl disease affected tomato in Oman

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
M. S. Shahid ◽  
M. Shafiq ◽  
M. Ilyas ◽  
A. Raza ◽  
M. N. Al-Sadrani ◽  
...  
Keyword(s):  
Rolling Circle Amplification ◽  
Monopartite Begomoviruses ◽  
Tomato Leaf ◽  
Bipartite Begomovirus ◽  
Rolling Circle ◽  
Tomato Leaf Curl Disease ◽  
Planting Material ◽  
Next Generation Sequencing Ngs ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Abstract Next generation sequencing (NGS) of DNAs amplified by rolling circle amplification from 6 tomato (Solanum lycopersicum) plants with leaf curl symptoms identified a number of monopartite begomoviruses, including Tomato yellow leaf curl virus (TYLCV), and a betasatellite (Tomato leaf curl betasatellite [ToLCB]). Both TYLCV and ToLCB have previously been identified infecting tomato in Oman. Surprisingly the NGS results also suggested the presence of the bipartite, legume-adapted begomovirus Mungbean yellow mosaic Indian virus (MYMIV). The presence of MYMIV was confirmed by cloning and Sanger sequencing from four of the six plants. A wider analysis by PCR showed MYMIV infection of tomato in Oman to be widespread. Inoculation of plants with full-length clones showed the host range of MYMIV not to extend to Nicotiana benthamiana or tomato. Inoculation to N. benthamiana showed TYLCV to be capable of maintaining MYMIV in both the presence and absence of the betasatellite. In tomato MYMIV was only maintained by TYLCV in the presence of the betasatellite and then only at low titre and efficiency. This is the first identification of TYLCV with ToLCB and the legume adapted bipartite begomovirus MYMIV co-infecting tomato. This finding has far reaching implications. TYLCV has spread around the World from its origins in the Mediterranean/Middle East, in some instances, in live tomato planting material. The results here may suggest that begomoviruses which do not commonly infect tomato, such as MYMIV, could be spread as a passenger of TYLCV in tomato.

scholarly journals Identification and Characterization of Two Novel Geminiviruses Associated with Paper Mulberry (Broussonetia papyrifera) Leaf Curl Disease

Plant Disease ◽  
2020 ◽  
Vol 104 (11) ◽  
pp. 3010-3018 ◽  
Author(s):  
Yuanjian Qiu ◽  
Song Zhang ◽  
Haodong Yu ◽  
Zhiyou Xuan ◽  
Liu Yang ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Close Association ◽  
Phylogenetic Analyses ◽  
Rolling Circle Amplification ◽  
Field Investigation ◽  
Broussonetia Papyrifera ◽  
New Members ◽  
Rolling Circle ◽  
Mulberry Leaf ◽  
Leaf Curl

Paper mulberry (Broussonetia papyrifera) is a perennial woody plant used as source material for Cai Lun paper making, in traditional Chinese medicine, and as livestock feed. To identify the presence of viruses in paper mulberry plants affected by a disease with leaf curl symptoms, high-throughput sequencing of total RNA was performed. Analysis of transcriptome libraries allowed the reconstruction of two geminivirus-like genomes. Rolling-circle amplification and PCR with back-to-back primers confirmed the presence of two geminiviruses with monopartite genomes in these plants, with the names paper mulberry leaf curl virus 1 and 2 (PMLCV-1 and PMLCV-2) proposed. The genomes of PMLCV-1 (3,056 nt) and PMLCV-2 (3,757 to 3,763 nt) encode six proteins, with the V4 protein of PMLCV-1 and the V3 proteins of both viruses having low similarities to any known protein in databases. Alternative splicing of an intron, akin to that of mastre-, becurto-, capula-, and grabloviruses, was identified by small RNA (sRNA)-seq and RNA-seq reads mapping to PMLCV-1 and PMLCV-2 antisense transcripts. Phylogenetic analyses and pairwise comparisons showed that PMLCV-1 and PMLCV-2 are most closely related to, but distinct from, two unassigned geminiviruses, citrus chlorotic dwarf associated virus and mulberry mosaic dwarf associated virus, suggesting that they are two new members of the family Geminiviridae. Field investigation confirmed the close association of the two viruses with leaf curl symptoms in paper mulberry plants and that coinfection can aggravate the symptoms.

Capsaicinoid: A potential antioxidant with close interactions against human iNOS in docking study

2014 ◽  
Vol 4 (4) ◽  
pp. 207-214
Author(s):  
R. Hazarika ◽  
K. Sood ◽  
B. Neog
Keyword(s):  
Antioxidant Activity ◽  
Active Sites ◽  
Docking Study ◽  
Capsicum Chinense ◽  
Docking Analysis ◽  
North East India ◽  
North East ◽  
Oxide Synthase ◽  
Bhut Jolokia ◽  
Inducible Nitric Oxide

Capsicum chinense, popularly known as Bhut jolokia, was collected from three states of North-East India and was studied for variation in its pungency principal viz. capsaicinoid content and antioxidant activity as well as its inter-action affinity with human inducible nitric oxide synthase (iNOS) active sites. HPLC fingerprinting analysis showed capsaicin and dihydrocapsaicin as the major active compounds present in the capsaicinoid extract of C. chinense. In comparison to dihydrocapsaicin, capsaicin was found in high amount. The pungency range was observed between 3, 47,301 SHU to 8, 45,296 SHU in the collected samples. The capsaicinoid extract exhibited antioxidant activity with 46.24 ± 15.34% scavenging of DPPH free radical at 100 ppm. The dock-ing analysis showed that capsaicin interacted more with the active sites of iNOS compared to dihydrocapsaicin. Present investigation revealed considerable difference in capsaicinoid content among the samples collected from three states of North-East India. The capsaicinoid showed noticeable antioxidant activity with potent binding affinity to the active sites of iNOS in the molecular docking analysis.

Sensitive and selective viral DNA detection assay via microbead-based rolling circle amplification

2008 ◽  
Vol 18 (22) ◽  
pp. 5871-5874 ◽  
Author(s):  
Eric Schopf ◽  
Nicholas O. Fischer ◽  
Yong Chen ◽  
Jeffrey B.-H. Tok
Keyword(s):  
Dna Detection ◽  
Rolling Circle Amplification ◽  
Viral Dna ◽  
Rolling Circle ◽  
Detection Assay

scholarly journals Rolling circle amplification with electrochemical detection assay for SARS-CoV-2 

2021 ◽  
Author(s):  
Thanyarat Chaibun ◽  
Jiratchaya Puenpa ◽  
Tatchanun Ngamdee ◽  
Nimaradee Boonapatcharoen ◽  
Pornpat Athamanolap ◽  
...  
Keyword(s):  
Electrochemical Detection ◽  
Rolling Circle Amplification ◽  
Differential Pulse ◽  
Rolling Circle ◽  
Redox Active ◽  
Detection Assay ◽  
Quantitative Results ◽  
Circular Template ◽  
Dna Template ◽  
Field Setting

Abstract This protocol describes the rolling circle amplification (RCA) and electrochemical detection of SARS-CoV-2. The procedure consists of 3 parts, which are the amplification, hybridization and detection steps. In the presence of RNA template, the circular DNA template will be ligated to produce a Padlock DNA, which serves as a template for amplification by phi29 DNA polymerase to produce RCA amplicons. The RCA amplicon is a concatemer containing multiple repeats of sequences that are complementary to the circular template. The RCA amplicons are hybridized with redox active probes and detected by electrochemical biosensor using differential pulse voltammetry (DPV). Due to its isothermal nature, RCA can be performed using a simple water bath or heating block. Overall, the whole assay takes approximately 45 min. The assay enables rapid, quantitative results to be obtained for detection of SARS-CoV-2, either in the laboratory or more importantly, in a field setting.

scholarly journals First Report of Ageratum enation virus, Betasatellite and Alphasatellite Causing Leaf Curl and Enation Disease of Amaranthus hypochondriacus in India

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1285-1285 ◽  
Author(s):  
A. Srivastava ◽  
S. Kumar ◽  
S. K. Raj
Keyword(s):  
Sequence Data ◽  
Disease Incidence ◽  
Rolling Circle Amplification ◽  
Nucleotide Identity ◽  
Post Inoculation ◽  
Specific Primers ◽  
Rolling Circle ◽  
Amaranthus Hypochondriacus ◽  
Close Phylogenetic Relationship ◽  
Leaf Curl

During a survey in February 2011, severe symptoms of upward leaf curling, vein enation on lower side of the leaves, and shortening of internodes were observed on 20 out of 117 Amaranthus hypochondriacus plants (17% disease incidence) examined at breeding plots of CSIR-NBRI, Lucknow. These symptoms are typical of begomovirus infection. PCR with begomovirus-specific primers (3) produced the expected ~1.1-kb product from DNA extracts of 20 symptomatic plants but not from a non-symptomatic plant, suggesting the association of a begomovirus. The full-length begomoviral genome from a representative sample was amplified by rolling circle amplification using Ø-29 DNA polymerase and digested by BamHI, which resulted in a ~2.7 kb product when electrophoresed in 1.0% agarose gel. The product obtained was cloned, sequenced, and sequence data of 2,753 nucleotides was deposited in GenBank (Accession No. JF682242). BLASTn analysis revealed 97 to 98% nucleotide identity and forms a distinct clade with Ageratum enation virus (AEV) isolates. This shows the virus in A. hypochondriacus to be an isolate of AEV. The separate PCRs were also performed with betasatellite and alphasatellite specific primers (1,2) that resulted in ~1.3-kb amplicons from all samples, suggesting their association. The amplification products were cloned and sequenced. An analysis of betasatellite (JX512904) revealed highest 98% nucleotide identity and close phylogenetic relationship with Ageratum leaf curl betasatellite (ALCB, JQ710745). The alphasatellite (JX512905) showed highest 95% identity and close relationship with Hibiscus leaf curl alphasatellite (HLCA, FN794199). This shows the betasatellite and alphasatellite in A. hypochondriacus to be isolates of ALCB and HLCA, respectively. The partial direct repeat clones of the begomovirus (pCAM-AEV), betasatellite (pCAM-ALCB), alphasatellite (pCAM-HLCA) were generated and mobilized into Agrobacterium tumefaciens strain GV3101 and infiltrated in A. hypochondriacus seedlings. The plants inoculated with pCAM-AEV, pCAM-ALCB, and pCAM-HLCA; pCAM-AEV and pCAM-ALCB developed severe leaf curl and enation symptoms on 5/5 plant at 35 days post inoculation, which were similar to those of naturally infected plants, satisfying Koch's postulates. On the other hand, plants inoculated with pCAM-AEV alone or in combination with pCAM-HLCA developed mild symptoms. Plants inoculated with pCAM-ALCB and pCAM-HLCA did not develop symptoms. The results here show that leaf curl and enation disease of A. hypochondriacus in India is caused by AEV and ALCB and that an alphasatellite may be associated with symptomatic plants. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. E. Bull et al. Mol. Biotechnol. 23:83, 2003. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Identification of Chili leaf curl virus Causing Leaf Curl Disease of Petunia in Oman

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
A. A. Al-Shihi ◽  
S. Akhtar ◽  
A. J. Khan
Keyword(s):  
Indian Subcontinent ◽  
Rolling Circle Amplification ◽  
Rapid Evolution ◽  
Post Inoculation ◽  
Multiple Sequence ◽  
Rolling Circle ◽  
Begomovirus Genome ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Petunias (Petunia × hybrida) are the most important ornamental plants in Oman. In 2012, petunias were observed in public parks and airport landscape in Dhofar region with symptoms of upward leaf curling, yellowing and vein clearing, and size reduction in leaves. Almost all plants in the surveyed landscape showed high infestation of Bemisia tabaci and symptoms that suggested infection with a begomovirus. Six symptomatic samples were collected from three different sites. All symptomatic samples were found PCR-positive with diagnostic primers for begomovirus (3) when DNA extracted from infected leaves was used as template. Nucleic acids extracted from the symptomatic leaves were used to amplify circular DNA molecules by rolling circle amplification method. The amplified concatameric products were digested with restriction enzyme PstI, which yielded a product ∼2.8 kb in size. The putative begomovirus fragment was cloned and sequenced in both orientations. Partial sequences of six clones were 99 to 100% similar and thus only two clones, PT-2 and PT-3, were fully sequenced. The whole genomes of both clones were 2,761 bp, and both were deposited in GenBank under accession numbers HF968755 and HF968756 for the isolates PT-2 and PT-3, respectively. Both sequences had six open reading frames; Rep, TrAP, REn, and C4 genes in complementary sense; and CP and V2 genes in virion-sense, typical of the begomovirus genome organization. Upon alignment, the two sequences showed 99.4% nucleotide identity with each other, thus representing isolates of a single begomovirus species. BlastN comparison showed PT-2 and PT-3 from petunia were 94 to 95% identical to the sequences of ChCLV from Oman (JN604490 to JN604500), which were obtained from other hosts. ClustalV multiple sequence alignment showed that isolates PT-2 and PT-3 shared maximum sequence identity of 93.3 and 92.8%, respectively, with an isolate of ChLCV-OM (JN604495). According to ICTV rules for begomoviruses, PT-3 should be considered to be a new strain of ChLCV-OM and PT-2 a variant of the already existing ChLCV-OM strain. We propose the name for this new strain as the “Petunia strain” of Chili leaf curl virus (ChLCV-Pet). Two infectious clones were constructed from the PT-2 and PT-3 sequences, clones as 1.75-genome sequences in a binary vector, suitable for agroinfection to confirm their infectivity. Both clones, PT-2 and PT-3, produced typical leaf curl disease symptoms upon inoculation on petunia 18 days post inoculation. The presence of the same virus in symptomatic field infected and inoculated petunia was confirmed by Southern blot using 650 bp DIG labeled probe prepared from CP region of PT-3 isolate. ChLCV-OM, a monopartite begomovirus, is widely associated with leaf curl disease of tomato and pepper in Oman, with its origin traced to the Indian subcontinent (2). Identification of a new strain of ChLCV from petunia provides evidence of an ongoing rapid evolution of begomoviruses in this region. Although petunia has been tested as an experimental host for some begomoviruses (1,4), this is the first report of petunia as natural host for ChLCV, a begomovirus previously reported in tomato and pepper in Oman. References: (1) Cui et al. J. Virol. 78:13966, 2004. (2) Khan et al. Virus Res. 177:87, 2013. (3) Khan et al. Plant Dis. 97:1396, 2013. (4) Urbino et al. Arch. Virol. 149:417, 2003.

scholarly journals First Report of Tomato yellow leaf curl Kanchanaburi virus Infecting Eggplant in Laos

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 428-428 ◽  
Author(s):  
Y. F. Tang ◽  
Z. F. He ◽  
Z. G. Du ◽  
L. H. Lu
Keyword(s):  
Rolling Circle Amplification ◽  
Mosaic Disease ◽  
Tomato Yellow Leaf ◽  
Full Length ◽  
Bipartite Begomovirus ◽  
Yellow Leaf ◽  
Putative Orfs ◽  
Rolling Circle ◽  
First Report ◽  
Leaf Curl

Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) reported to infect tomato and eggplant in Thailand and Vietnam (1,2). In April 2013, eggplant (Solanum melongena L.) plants exhibiting yellow mosaic symptoms were found in a suburb of Vientiane, Laos. Three symptomatic samples were collected. Total DNA was extracted from leaves by the CTAB method, and used as template for PCR using the degenerate primer pair AV494/CoPR (3). The PCR results suggested that the plants were infected by a begomovirus. The begomoviral genome was amplified by rolling circle amplification (RCA) with TempliPhi kit (GE Healthcare) following the manufacturer's protocol. RCA product was digested with the endonucleases BamH I, EcoR I, Hind III, Kpn I, Pst I, and Xba I, respectively. The fragments about 2.1 kbp (with Pst I digestion) and 1.5 kbp (with Xba I digestion) in size were cloned and sequenced. The sequence of the 2.1-kbp fragment showed similarity with begomovirus DNA-A component. A pair of primers for amplification of the full-length DNA-A, AF (5′-CTTCATCGTTTCTCAGCATCAT-3′) and AR (5′-CACTTGCACACGATCTCTAAGA-3′) were designed from the 2.1-kbp sequence. The full-length DNA-A was 2,752 nucleotides and encoded six putative ORFs (GenBank Accession No. KF218820). The sequence of the 1.5-kbp fragment shared similarity with begomoviruses DNA-B. The begomoviral circular DNA-B was amplified using the pair of primers BF (5′-GTAACAGCCGAAGTGCACG-3′) and BR (5′-AATGGAGAGACACCAGTCTGCC-3′) designed from the 1.5-kbp sequence. PCR yielded a product of expected size (~1.4 kbp). The full-length DNA-B sequence was obtained by assembling the two sequences. The DNA-B was 2,734 nucleotides and encoded two putative ORFs (GenBank Accession No. KF218821). The sequences of DNA-A and DNA-B of isolate Laos shared the highest nucleotide sequences identities at 99.0% and 98.0% with those of TYLCKaV-[TH:Kan 1:01] (AF511529), and [TH:Kan 2:Egg:01] (AF511527), respectively. The results indicated that the virus associated with eggplant yellow mosaic disease was an isolate of TYLCKaV. To our knowledge, this is the first report of this begomovirus in Laos. Our results indicate that this virus may be spreading in Southeast Asia and scientists there should be aware of this virus when developing begomovirus-resistant varieties of tomato or eggplant. References: (1) S. K. Green et al. Plant Dis. 87:446, 2003. (2) C. Ha et al. J. Gen. Virol. 89:312, 2008.(3) Z. F. He et al. Arch. Virol. 154:1199, 2009.

scholarly journals First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1746-1746 ◽  
Author(s):  
Y. H. Cheng ◽  
T. C. Deng ◽  
C. C. Chen ◽  
C. H. Chiang ◽  
C. A. Chang
Keyword(s):  
Rolling Circle Amplification ◽  
Pcr Primers ◽  
Passion Fruit ◽  
The Other ◽  
Passiflora Edulis ◽  
Rolling Circle ◽  
First Report ◽  
Immature Fruit ◽  
Leaf Curl Virus ◽  
Leaf Curl

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) ‘Tainung No. 1’ is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5′TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3′/5′CGCAGTTT CTGGAGGATATTAAG3′/5′TCGCATGCCACTTCCTCAGT3′) were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

Sign in / Sign up

Export Citation Format

Share Document