miRNA-17-5p Target Prediction and its Role in Senescence Mechanism through p21 Interference

BACKGROUND: Cellular senescence is known to be correlated with the cessation of cell cycle. The progression of cell cycle is promoted by activities of various proteins, including cyclin-dependent kinase (CDK) and cyclin proteins, which work synergistically. CDK-cyclin complexes are influenced by other proteins, such as retinoblastoma (Rb) and E2F proteins. In cell cycle, both Rb and E2F proteins could be affected by one of the CDK inhibitors, that is, p21. MicroRNA (miRNA) is well known for its role in biological processes, including cell cycle. However, the contribution of miRNA in cell cycle is still poorly understood. Some miRNAs play a role in pro-proliferation and anti-proliferation. AIM: This study was performed an in silico study analysis to reveal the relationship between miRNA-17-5p and p21 in the process of cellular senescence. METHODS: The extensive data mining was conducted to determine the miRNA that contributes to the process of anti-aging prevention and the desired target genes through the Human Protein Atlas and cancer database. miRNA target prediction was performed using DIANA-microT-CDS. Gene function of the miRNA-17-5p target was annotated using DAVID GO. RESULTS: The sequence of hsa-miRNA-17-5p (CAAAGUGCUUACAGUGCAGGUAG) has three attachment sites with binding types of 8 mer, 6 mer, and 8 mer at the transcription sites of 447–474, 485–513, and 1132–1154, respectively. The main profile of hsa-miRNA-17-5p showed that it bound to 3’-untranslated region and the coding region (exon). CONCLUSIONS: The miRNA-17-5p was involved in cellular senescence by influencing the process of cell proliferation in the cell cycle pathway.

Conservation and divergence of C-terminal domain structure in the retinoblastoma protein family

The retinoblastoma protein (Rb) and the homologous pocket proteins p107 and p130 negatively regulate cell proliferation by binding and inhibiting members of the E2F transcription factor family. The structural features that distinguish Rb from other pocket proteins have been unclear but are critical for understanding their functional diversity and determining why Rb has unique tumor suppressor activities. We describe here important differences in how the Rb and p107 C-terminal domains (CTDs) associate with the coiled-coil and marked-box domains (CMs) of E2Fs. We find that although CTD–CM binding is conserved across protein families, Rb and p107 CTDs show clear preferences for different E2Fs. A crystal structure of the p107 CTD bound to E2F5 and its dimer partner DP1 reveals the molecular basis for pocket protein–E2F binding specificity and how cyclin-dependent kinases differentially regulate pocket proteins through CTD phosphorylation. Our structural and biochemical data together with phylogenetic analyses of Rb and E2F proteins support the conclusion that Rb evolved specific structural motifs that confer its unique capacity to bind with high affinity those E2Fs that are the most potent activators of the cell cycle.

Identification of E-Box Factor TFE3 as a Functional Partner for the E2F3 Transcription Factor

ABSTRACT Various studies have demonstrated a role for E2F proteins in the control of transcription of genes involved in DNA replication, cell cycle progression, and cell fate determination. Although it is clear that the functions of the E2F proteins overlap, there is also evidence for specific roles for individual E2F proteins in the control of apoptosis and cell proliferation. Investigating protein interactions that might provide a mechanistic basis for the specificity of E2F function, we identified the E-box binding factor TFE3 as an E2F3-specific partner. We also show that this interaction is dependent on the marked box domain of E2F3. We provide evidence for a role for TFE3 in the synergistic activation of the p68 subunit gene of DNA polymerase α together with E2F3, again dependent on the E2F3 marked box domain. Chromatin immunoprecipitation assays showed that TFE3 and E2F3 were bound to the p68 promoter in vivo and that the interaction of either E2F3 or TFE3 with the promoter was facilitated by the presence of both proteins. In contrast, neither E2F1 nor E2F2 interacted with the p68 promoter under these conditions. We propose that the physical interaction of TFE3 and E2F3 facilitates transcriptional activation of the p68 gene and provides strong evidence for the specificity of E2F function.

NPAT Expression Is Regulated by E2F and Is Essential for Cell Cycle Progression

ABSTRACT NPAT is an in vivo substrate of cyclin E-Cdk2 kinase and is thought to play a critical role in coordinated transcriptional activation of histone genes during the G1/S-phase transition and in S-phase entry in mammalian cells. Here we show that NPAT transcription is up-regulated at the G1/S-phase boundary in growth-stimulated cells and that the NPAT promoter responds to activation by E2F proteins. We demonstrate that endogenous E2F proteins interact with the promoter of the NPAT gene in vivo and that induced expression of E2F1 stimulates NPAT mRNA expression, supporting the idea that the expression of NPAT is regulated by E2F. Consistently, we find that the E2F sites in the NPAT promoter are required for its activation during the G1/S-phase transition. Moreover, we show that the expression of NPAT accelerates S-phase entry in cells released from quiescence. The inhibition of NPAT expression by small interfering RNA duplexes impedes cell cycle progression and histone gene expression in tissue culture cells. Thus, NPAT is an important E2F target that is required for cell cycle progression in mammalian cells. As NPAT is involved in the regulation of S-phase-specific histone gene transcription, our findings indicate that NPAT links E2F to the activation of S-phase-specific histone gene transcription.