Biological Response Profiling Reveals the Functional Differences of Main Alkaloids in Rhizoma Coptidis

Rhizoma Coptidis (RC) is a widely used traditional Chinese medicine. Although modern research has found that some alkaloids from RC are the pharmacologically active constituents, the differences in their biological effects are not completely clear. This study analyzed the differences in the typical alkaloids in RC at a systematic level and provided comprehensive information on the pharmaceutical mechanisms of the different alkaloids. The ethanol RC extract (RCE) was characterized using HPLC assay. HepG2, 3T3-L1, and RAW264.7 cells were used to detect the cytotoxicity of alkaloids. Transcriptome analyses were performed to elucidate the cellular pathways affected by RCE and alkaloids. HPLC analysis revealed that the typical alkaloids of RCE were berberine, coptisine, and palmatine. Coptisine and berberine displayed a stronger inhibitory effect on cell proliferation than palmatine. The overlapping ratios of differentially expressed genes between RCE and berberine, coptisine, and palmatine were 70.8%, 52.6%, and 42.1%, respectively. Pathway clustering analysis indicated that berberine and coptisine possessed a certain similarity to RCE, and both compounds affected the cell cycle pathway; moreover, some pathways were uniquely enriched by berberine or coptisine. Berberine and coptisine had different regulatory effects on genes involved in lipid metabolism. These results provide comprehensive information on the pharmaceutical mechanisms of the different RC alkaloids and insights into their better combinatory use for the treatment of diseases.

What's New in Molecular Targeted Therapies for Head and Neck Cancer?

Head and neck cancer is the 6th most frequently diagnosed solid tumor in the world. Alcohol consumption, smoking, and HPV infection are associated with the incidence of head and neck squamous cell carcinoma (HNSCC). Although a multidisciplinary approach is a key strategy for the treatment of locally advanced HNSCC, systemic therapy is the mainstream of recurrent or metastatic HNSCC treatment. Stage IV HNSCC has a relatively poor prognosis with median overall survival of around one year. There have been many clinical trials to investigate the efficacy of target agents in the treatment of HNSCC. In the HPV-negative HNSCC, TP53 and CDKN2A are the most commonly mutated genes. In the HPV-positive HNSCC, the PI3K pathway is frequently altered. EGFR, PI3K, cell cycle pathway, MET, HRAS, and IL6/JAK/STAT pathway are explored targets in HNSCC. In this study, we review the target pathways and agents under research. We also introduce here umbrella trials of recurrent or metastatic HNSCC conducted by the Korea Cancer Study Group. The combination of target agents with immune checkpoint inhibitors or cytotoxic chemotherapies would be a future step in the precision medicine of HNSCC treatment.

Comparative Genome Analysis of Genes Regulating Compound Inflorescences in Tomato

Inflorescences are the main factor affecting fruit yield. The quantity and quality of inflorescences are closely related to fruit quality and yield. The presence of compound inflorescences in cherry tomatoes is well established, and it has been discovered by chance that compound racemes also exist in tomatoes. To explore the formation of compound inflorescences in tomato, transcriptome sequencing was performed on Moneymaker (MM) and Compound Inflorescence (CI) plants. In-florescences were collected in three periods (early, middle and late) in three replicates, for a total of 18 samples. Data analysis showed that the DEGs were most enriched in metabolic pathways and plant hormone signal transduction pathways. The DEGs were also enriched in the cell cycle pathway, photosynthesis pathway, carbon metabolism pathway and circadian rhythm pathway. We found that the FALSIFLORA (FA), COMPOUND INFLORESCENCE (S) and ANANTHA (AN) genes were involved in compound inflorescence development, not only revealing novel genes but also providing a rich theoretical basis for compound inflorescence development.

Impact and Molecular Mechanism of Microplastics on Zebrafish in the Presence and Absence of Copper Nanoparticles

The adverse effects of microplastics (MPs) in aquatic environments have attracted increasing attention and posed health risks along with nanomaterials. Therefore, the toxic effects of polystyrene microplastics (PS-MPs) with different particle sizes (0.07, 0.7 and 7 μm) on zebrafish in the presence and absence of copper nanoparticles (Cu-NPs) were evaluated. The acute toxicity of MPs on zebrafish was 7 μm > 0.07 μm > 0.7 μm. Both 0.07 and 7 μm MPs acted on chromosomes and significantly affected cell cycle process by affecting palmitoyl hydrolase activity; while 0.7 μm MPs acted on extracellular space and significantly affected the activity of endopeptidase inhibitor to affect the cholesterol transport. And 0.07 and 7 μm MPs dominantly affected “cell cycle” pathway by inhibiting DNA replication, delaying the progression of S phase and G2/M phase, and affecting the accurate arrangement and separation of chromosomes; while the 0.7 μm MPs activated numerous platelets to aggregate and adhere in damaged parts, enhanced the coagulation function of platelets, and promoted the formation of fibrin clots, thus abnormally activating the “hemostasis” pathway. The presence of Cu-NPs significantly changed the toxicity-related pathways induced by 7 μm MPs from “cell cycle” into “hemostasis,” but not for the smaller-sized MPs (0.07 and 0.7 μm). The combined exposure of Cu-NPs and 7 μm MPs acted on the extracellular region and significantly affected cholesterol transport by affecting the activity of cholesterol transporters. This study provides theoretical insights for the health risks of MPs to aquatic species and even humans in the actual ecosystem.

Carcinogenic effect of adenylosuccinate lyase (ADSL) in prostate cancer development and progression through the cell cycle pathway

Background Prostate cancer (PCa) is still a serious male malignant disease across the world. However, no exact pathogenesis had been explained. Although adenylosuccinate lyase (ADSL) gene was identified to be important in PCa early in 1987, its comprehensive functions for PCa have not been presented. Methods The cBioPortal for Cancer Genomics, Oncomine and GEO database were retrieved to investigate the associations between of the ADSL gene and PCa. Then, the PC-3, DU145 and C4-2B cell lines were applied in vitro experiments. RNA sequencing and further western blot (WB) were applied to explore the potential mechanisms of ADSL gene in PCa. Results Based on PCa clinical datasets, we firstly found ADSL gene highly expressed in PCa tissues. Moreover, its transcript level increased in the metastatic PCa further. Elevated ADSL gene expression indicated a poor prognosis of PCa. While inhibiting the expression of ADSL with siRNA, the ability of cell proliferation and migration all declined markedly, with increased cell apoptosis inversely. Most of cells were blocked in the G0/G1 phase. Additionally, RNA sequencing also discovered the inactivity of cell cycle pathway after ADSL knockdown, which had also confirmed on the proteins levels. Conclusions Our study identified the ADSL as an oncogene of PCa through regulating the cell cycle pathway firstly, with explicit cell and clinical phenotypes. Further mechanisms were needed to confirm its carcinogenic effect.

Clinical Significance And Potential Mechanisms of The RNA Methyltransferase KIAA1429 In Osteosarcoma

Background: KIAA1429, a member of the RNA methyltransferase complex, is involved in cancer progression. However, the clinical significance of KIAA1429 in osteosarcoma (OS) and the underlying mechanisms by which it contributes to disease progression remain unclear. Methods: The clinical significance of KIAA1429 in OS was evaluated based on the RT-qPCR, microarray, RNA sequencing, and published data. Two lentivirus-mediated KIAA1429-targeting siRNA constructs were transfected into SW1353 cells, and CCK-8 and flow cytometry assays were applied to investigate the biological function of KIAA1429 in OS cells. KIAA1429-related genes in OS were identified from lists of co-expressed genes (CEGs) and differentially expressed genes (DEGs). Functional enrichment analysis was employed to explore the potential mechanisms by which KIAA1429 contributes to the progression of OS.Results: The mRNA expression of KIAA1429 was notably overexpressed in 250 OS samples than 71 non-cancer samples (SMD=0.74). SROC curve analysis showed that KIAA1429 exhibits diagnostic capacity between OS samples and non-cancer samples (AUC=0.83). Survival analysis showed that overexpression of KIAA1429 was associated with shorter overall survival time. Knocking down KIAA1429 reduced the level of m6A methylation, inhibited proliferation, and accelerated apoptosis in OS cells. A total of 395 KIAA1429-related genes were identified, and were enriched in the cell cycle pathway. Protein–protein interaction (PPI) network analysis showed that CDK1, CCNA2, and CCNB1 were KIAA1429-related genes that act as major network hubs in OS. Conclusion: KIAA1429 plays an oncogenic role in OS and may facilitate the progression of OS through a mechanism involving the regulation of CDK1, CCNA2, and CCNB1.

miRNA-17-5p Target Prediction and its Role in Senescence Mechanism through p21 Interference

BACKGROUND: Cellular senescence is known to be correlated with the cessation of cell cycle. The progression of cell cycle is promoted by activities of various proteins, including cyclin-dependent kinase (CDK) and cyclin proteins, which work synergistically. CDK-cyclin complexes are influenced by other proteins, such as retinoblastoma (Rb) and E2F proteins. In cell cycle, both Rb and E2F proteins could be affected by one of the CDK inhibitors, that is, p21. MicroRNA (miRNA) is well known for its role in biological processes, including cell cycle. However, the contribution of miRNA in cell cycle is still poorly understood. Some miRNAs play a role in pro-proliferation and anti-proliferation. AIM: This study was performed an in silico study analysis to reveal the relationship between miRNA-17-5p and p21 in the process of cellular senescence. METHODS: The extensive data mining was conducted to determine the miRNA that contributes to the process of anti-aging prevention and the desired target genes through the Human Protein Atlas and cancer database. miRNA target prediction was performed using DIANA-microT-CDS. Gene function of the miRNA-17-5p target was annotated using DAVID GO. RESULTS: The sequence of hsa-miRNA-17-5p (CAAAGUGCUUACAGUGCAGGUAG) has three attachment sites with binding types of 8 mer, 6 mer, and 8 mer at the transcription sites of 447–474, 485–513, and 1132–1154, respectively. The main profile of hsa-miRNA-17-5p showed that it bound to 3’-untranslated region and the coding region (exon). CONCLUSIONS: The miRNA-17-5p was involved in cellular senescence by influencing the process of cell proliferation in the cell cycle pathway.

Astragaloside IV Suppresses Hepatic Proliferation in Regenerating Rat Liver after 70% Partial Hepatectomy via Down-Regulation of Cell Cycle Pathway and DNA Replication

Astragaloside IV (AS-IV) is one of the major bio-active ingredients of huang qi which is the dried root of Astragalus membranaceus (a traditional Chinese medicinal plant). The pharmacological effects of AS-IV, including anti-oxidative, anti-cancer, and anti-diabetic effects have been actively studied, however, the effects of AS-IV on liver regeneration have not yet been fully described. Thus, the aim of this study was to explore the effects of AS-IV on regenerating liver after 70% partial hepatectomy (PHx) in rats. Differentially expressed mRNAs, proliferative marker and growth factors were analyzed. AS-IV (10 mg/kg) was administrated orally 2 h before surgery. We found 20 core genes showed effects of AS-IV, many of which were involved with functions related to DNA replication during cell division. AS-IV down-regulates MAPK signaling, PI3/Akt signaling, and cell cycle pathway. Hepatocyte growth factor (HGF) and cyclin D1 expression were also decreased by AS-IV administration. Transforming growth factor β1 (TGFβ1, growth regulation signal) was slightly increased. In short, AS-IV down-regulated proliferative signals and genes related to DNA replication. In conclusion, AS-IV showed anti-proliferative activity in regenerating liver tissue after 70% PHx.

Characterization of the Immune Cell Infiltration Profile in Pancreatic Carcinoma to Aid in Immunotherapy

The tumor microenvironment (TME) is comprised of tumor cells, infiltrating immune cells, and stroma. Multiple reports suggest that the immune cell infiltration (ICI) in TME is strongly associated with responsiveness to immunotherapy and prognosis of certain cancers. Thus far, the ICI profile of pancreatic carcinoma (PC) remains unclear. Here, we employed two algorithms to characterize the ICI profile of PC patients. Based on our results, we identified 2 ICI patterns and calculated the ICI score by using principal component analysis. Furthermore, we revealed that patients with low ICI scores had a better prognosis, compared to high ICI scores. Moreover, we discovered that a low tumor mutation burden (TMB) offered better overall survival (OS), relative to high TMB. In this study, a high ICI score referred to elevated PD-L1/TGF-β levels, increased activation of cell cycle pathway and DNA repair pathway, as well as reduced expression of immune-activation-related genes. We also demonstrated that three metabolic pathways were suppressed in the low ICI score group. These data may explain why a high ICI score equates to a poor prognosis. Based on our analysis, the ICI score can be used as an effective predictor of PC prognosis. Hence, establishing an ICI profile, based on a large patient population, will not only enhance our knowledge of TME but also aid in the development of immunotherapies specific to PC.