Faculty Opinions recommendation of Multicilin drives centriole biogenesis via E2f proteins.

2016 ◽  
Author(s):  
Xueliang Zhu
Keyword(s):  
E2f Proteins

scholarly journals Role for E2F in Control of Both DNA Replication and Mitotic Functions as Revealed from DNA Microarray Analysis

2001 ◽  
Vol 21 (14) ◽  
pp. 4684-4699 ◽  
Author(s):  
Seiichi Ishida ◽  
Erich Huang ◽  
Harry Zuzan ◽  
Rainer Spang ◽  
Gustavo Leone ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Gene Regulation ◽  
Dna Replication ◽  
Dna Microarrays ◽  
Cell Cycle Analysis ◽  
Cell Synchrony ◽  
Mammalian Cell Cycle ◽  
Induced Genes ◽  
Regulated Gene Expression ◽  
E2f Proteins

ABSTRACT We have used high-density DNA microarrays to provide an analysis of gene regulation during the mammalian cell cycle and the role of E2F in this process. Cell cycle analysis was facilitated by a combined examination of gene control in serum-stimulated fibroblasts and cells synchronized at G1/S by hydroxyurea block that were then released to proceed through the cell cycle. The latter approach (G1/S synchronization) is critical for rigorously maintaining cell synchrony for unambiguous analysis of gene regulation in later stages of the cell cycle. Analysis of these samples identified seven distinct clusters of genes that exhibit unique patterns of expression. Genes tend to cluster within these groups based on common function and the time during the cell cycle that the activity is required. Placed in this context, the analysis of genes induced by E2F proteins identified genes or expressed sequence tags not previously described as regulated by E2F proteins; surprisingly, many of these encode proteins known to function during mitosis. A comparison of the E2F-induced genes with the patterns of cell growth-regulated gene expression revealed that virtually all of the E2F-induced genes are found in only two of the cell cycle clusters; one group was regulated at G1/S, and the second group, which included the mitotic activities, was regulated at G2. The activation of the G2 genes suggests a broader role for E2F in the control of both DNA replication and mitotic activities.

scholarly journals The accumulation of an E2F-p130 transcriptional repressor distinguishes a G0 cell state from a G1 cell state.

1996 ◽  
Vol 16 (12) ◽  
pp. 6965-6976 ◽  
Author(s):  
E J Smith ◽  
G Leone ◽  
J DeGregori ◽  
L Jakoi ◽  
J R Nevins
Keyword(s):  
Cell Cycle ◽  
Target Genes ◽  
Kinase Activity ◽  
Transcriptional Repressor ◽  
Negative Control ◽  
Cyclin Dependent Kinase ◽  
Cell State ◽  
Quiescent Cells ◽  
Cycle Dependent ◽  
E2f Proteins

Previous studies have demonstrated cell cycle-dependent specificities in the interactions of E2F proteins with Rb family members. We now show that the formation of an E2F-p130 complex is unique to cells in a quiescent, G0 state. The E2F-p130 complex does not reform when cells reenter a proliferative state and cycle through G1. The presence of an E2F-p130 complex in quiescent cells coincides with the E2F-mediated repression of transcription of the E2F1 gene, and we show that the E2F sites in the E2F1 promoter are important as cells enter quiescence but play no apparent role in cycling cells. In addition, the decay of the E2F-p130 complex as cells reenter the cell cycle requires the action of G1 cyclin-dependent kinase activity. We conclude that the accumulation of the E2F-p130 complex in quiescent cells provides a negative control of certain key target genes and defines a functional distinction between these G0 cells and cells that exist transiently in G1.

scholarly journals Distinct Cellular Factors Regulate the c-myb Promoter through Its E2F Element

1999 ◽  
Vol 19 (12) ◽  
pp. 8442-8450 ◽  
Author(s):  
Miguel R. Campanero ◽  
Monica Armstrong ◽  
Erik Flemington
Keyword(s):  
Cell Types ◽  
Cell Cycles ◽  
Functional Studies ◽  
Shift Analysis ◽  
Cellular Factors ◽  
Elevated Expression ◽  
Contact Residues ◽  
Nih 3T3 ◽  
Different Cell Types ◽  
E2f Proteins

ABSTRACT Most E2F-driven promoters are transiently activated around the G1/S transition. Although the promoter for the c-myb proto-oncogene harbors an E2F element, it is induced early in G1 following entry into the cell cycle. Furthermore, this promoter remains active throughout subsequent cell cycles. Since E2F sites function as repressor elements during G1 (due to the association of pRb with E2F factors), we investigated whether the E2F element in the c-myb promoter is regulated differently than E2F elements in promoters that are repressed during G1. By gel shift analysis, the E2F element from the c-myb promoter was found to form a unique complex, referred to as E2Fmyb-sp, which was not observed with E2F elements from several other promoters. Antibodies to DP-1, E2F1 to -5, p107, or pRb failed to either supershift or block E2Fmyb-sp complex formation. Methylation interference experiments indicate that the DNA contact residues for the E2Fmyb-sp complex are distinct from but overlapping with residues required for the binding of E2F proteins. In addition to the identification of E2Fmyb-sp, we have found that SP-1 binds to the c-myb E2F element. Functional studies revealed that E2Fmyb-sp and/or SP-1 are required to achieve full activation of the c-myb promoter in different cell types and to maintain elevated expression of the c-myb promoter during G1 in NIH 3T3 cells. These studies demonstrate that E2F elements can be regulated differently through the binding of unique sets of proteins.

scholarly journals miRNA-17-5p Target Prediction and its Role in Senescence Mechanism through p21 Interference

2021 ◽  
Vol 9 (A) ◽  
pp. 455-462
Author(s):  
Sinta Murlistyarini ◽  
Teguh Wahju Sardjono ◽  
Lukman Hakim ◽  
Sri Widyarti ◽  
Didik Huswo Utomo ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Cellular Senescence ◽  
Target Genes ◽  
Target Prediction ◽  
Coding Region ◽  
Attachment Sites ◽  
Human Protein Atlas ◽  
Transcription Sites ◽  
Cell Cycle Pathway ◽  
E2f Proteins

BACKGROUND: Cellular senescence is known to be correlated with the cessation of cell cycle. The progression of cell cycle is promoted by activities of various proteins, including cyclin-dependent kinase (CDK) and cyclin proteins, which work synergistically. CDK-cyclin complexes are influenced by other proteins, such as retinoblastoma (Rb) and E2F proteins. In cell cycle, both Rb and E2F proteins could be affected by one of the CDK inhibitors, that is, p21. MicroRNA (miRNA) is well known for its role in biological processes, including cell cycle. However, the contribution of miRNA in cell cycle is still poorly understood. Some miRNAs play a role in pro-proliferation and anti-proliferation. AIM: This study was performed an in silico study analysis to reveal the relationship between miRNA-17-5p and p21 in the process of cellular senescence. METHODS: The extensive data mining was conducted to determine the miRNA that contributes to the process of anti-aging prevention and the desired target genes through the Human Protein Atlas and cancer database. miRNA target prediction was performed using DIANA-microT-CDS. Gene function of the miRNA-17-5p target was annotated using DAVID GO. RESULTS: The sequence of hsa-miRNA-17-5p (CAAAGUGCUUACAGUGCAGGUAG) has three attachment sites with binding types of 8 mer, 6 mer, and 8 mer at the transcription sites of 447–474, 485–513, and 1132–1154, respectively. The main profile of hsa-miRNA-17-5p showed that it bound to 3’-untranslated region and the coding region (exon). CONCLUSIONS: The miRNA-17-5p was involved in cellular senescence by influencing the process of cell proliferation in the cell cycle pathway.

scholarly journals Conservation and divergence of C-terminal domain structure in the retinoblastoma protein family

2017 ◽  
Vol 114 (19) ◽  
pp. 4942-4947 ◽  
Author(s):  
Tyler J. Liban ◽  
Edgar M. Medina ◽  
Sarvind Tripathi ◽  
Satyaki Sengupta ◽  
R. William Henry ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Coiled Coil ◽  
Retinoblastoma Protein ◽  
Structural Features ◽  
Transcription Factor Family ◽  
Pocket Proteins ◽  
Cyclin Dependent Kinases ◽  
Pocket Protein ◽  
E2f Transcription Factor ◽  
E2f Proteins

The retinoblastoma protein (Rb) and the homologous pocket proteins p107 and p130 negatively regulate cell proliferation by binding and inhibiting members of the E2F transcription factor family. The structural features that distinguish Rb from other pocket proteins have been unclear but are critical for understanding their functional diversity and determining why Rb has unique tumor suppressor activities. We describe here important differences in how the Rb and p107 C-terminal domains (CTDs) associate with the coiled-coil and marked-box domains (CMs) of E2Fs. We find that although CTD–CM binding is conserved across protein families, Rb and p107 CTDs show clear preferences for different E2Fs. A crystal structure of the p107 CTD bound to E2F5 and its dimer partner DP1 reveals the molecular basis for pocket protein–E2F binding specificity and how cyclin-dependent kinases differentially regulate pocket proteins through CTD phosphorylation. Our structural and biochemical data together with phylogenetic analyses of Rb and E2F proteins support the conclusion that Rb evolved specific structural motifs that confer its unique capacity to bind with high affinity those E2Fs that are the most potent activators of the cell cycle.

scholarly journals Identification of E-Box Factor TFE3 as a Functional Partner for the E2F3 Transcription Factor

2003 ◽  
Vol 23 (11) ◽  
pp. 3707-3720 ◽  
Author(s):  
Paloma H. Giangrande ◽  
Timothy C. Hallstrom ◽  
Chainarong Tunyaplin ◽  
Kathryn Calame ◽  
Joseph R. Nevins
Keyword(s):  
Cell Fate ◽  
Protein Interactions ◽  
Transcriptional Activation ◽  
Cell Cycle Progression ◽  
Physical Interaction ◽  
Synergistic Activation ◽  
E Box ◽  
Mechanistic Basis ◽  
E2f Proteins

ABSTRACT Various studies have demonstrated a role for E2F proteins in the control of transcription of genes involved in DNA replication, cell cycle progression, and cell fate determination. Although it is clear that the functions of the E2F proteins overlap, there is also evidence for specific roles for individual E2F proteins in the control of apoptosis and cell proliferation. Investigating protein interactions that might provide a mechanistic basis for the specificity of E2F function, we identified the E-box binding factor TFE3 as an E2F3-specific partner. We also show that this interaction is dependent on the marked box domain of E2F3. We provide evidence for a role for TFE3 in the synergistic activation of the p68 subunit gene of DNA polymerase α together with E2F3, again dependent on the E2F3 marked box domain. Chromatin immunoprecipitation assays showed that TFE3 and E2F3 were bound to the p68 promoter in vivo and that the interaction of either E2F3 or TFE3 with the promoter was facilitated by the presence of both proteins. In contrast, neither E2F1 nor E2F2 interacted with the p68 promoter under these conditions. We propose that the physical interaction of TFE3 and E2F3 facilitates transcriptional activation of the p68 gene and provides strong evidence for the specificity of E2F function.

scholarly journals E2F-1:DP-1 induces p53 and overrides survival factors to trigger apoptosis.

1995 ◽  
Vol 15 (12) ◽  
pp. 6864-6874 ◽  
Author(s):  
S W Hiebert ◽  
G Packham ◽  
D K Strom ◽  
R Haffner ◽  
M Oren ◽  
...  
Keyword(s):  
Cell Cycle Progression ◽  
Binding Activity ◽  
Functional Link ◽  
Cycle Progression ◽  
Survival Factors ◽  
Dna Binding Activity ◽  
Induce Cell Cycle Progression ◽  
Induced Apoptosis ◽  
Related Proteins ◽  
E2f Proteins

The E2F DNA binding activity consists of a heterodimer between E2F and DP family proteins, and these interactions are required for association of E2F proteins with pRb and the pRb-related proteins p107 and p130, which modulate E2F transcriptional activities. E2F-1 expression is sufficient to release fibroblasts from G0 and induce entry into S phase, yet it also initiates apoptosis. To investigate the mechanisms of E2F-induced apoptosis, we utilized interleukin-3 (IL-3)-dependent 32D.3 myeloid cells, a model of hematopoietic progenitor programmed cell death. In the absence of IL-3, E2F-1 alone was sufficient to induce apoptosis, and p53 levels were diminished. DP-1 alone was not sufficient to induce cell cycle progression or alter rates of death following IL-3 withdrawal. However, overexpression of both E2F-1 and DP-1 led to the rapid death of cells even in the presence of survival factors. In the presence of IL-3, levels of endogenous wild-type p53 increased in response to E2F-1, and coexpression of DP-1 further augmented p53 levels. These results provide evidence that E2F is a functional link between the tumor suppressors p53 and pRb. However, induction of p53 alone was not sufficient to trigger apoptosis, suggesting that the ability of E2F to override survival factors involves additional effectors.

scholarly journals NPAT Expression Is Regulated by E2F and Is Essential for Cell Cycle Progression

2003 ◽  
Vol 23 (8) ◽  
pp. 2821-2833 ◽  
Author(s):  
Guang Gao ◽  
Adrian P. Bracken ◽  
Karina Burkard ◽  
Diego Pasini ◽  
Marie Classon ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Mammalian Cells ◽  
Cell Cycle Progression ◽  
S Phase ◽  
Histone Gene ◽  
Cycle Progression ◽  
Histone Gene Transcription ◽  
E2f Proteins ◽  
Phase Entry

ABSTRACT NPAT is an in vivo substrate of cyclin E-Cdk2 kinase and is thought to play a critical role in coordinated transcriptional activation of histone genes during the G1/S-phase transition and in S-phase entry in mammalian cells. Here we show that NPAT transcription is up-regulated at the G1/S-phase boundary in growth-stimulated cells and that the NPAT promoter responds to activation by E2F proteins. We demonstrate that endogenous E2F proteins interact with the promoter of the NPAT gene in vivo and that induced expression of E2F1 stimulates NPAT mRNA expression, supporting the idea that the expression of NPAT is regulated by E2F. Consistently, we find that the E2F sites in the NPAT promoter are required for its activation during the G1/S-phase transition. Moreover, we show that the expression of NPAT accelerates S-phase entry in cells released from quiescence. The inhibition of NPAT expression by small interfering RNA duplexes impedes cell cycle progression and histone gene expression in tissue culture cells. Thus, NPAT is an important E2F target that is required for cell cycle progression in mammalian cells. As NPAT is involved in the regulation of S-phase-specific histone gene transcription, our findings indicate that NPAT links E2F to the activation of S-phase-specific histone gene transcription.

Activity of the human cytochrome c1 promoter is modulated by E2F

2000 ◽  
Vol 351 (1) ◽  
pp. 251-256 ◽  
Author(s):  
Katarina LUCIAKOVA ◽  
Peter BARATH ◽  
Ronggui LI ◽  
Ahmed ZAID ◽  
B. Dean NELSON
Keyword(s):  
Mammalian Cells ◽  
Promoter Activity ◽  
Mitochondrial Genes ◽  
Transcription Start ◽  
Mobility Shift ◽  
Transactivation Domains ◽  
Human Cytochrome ◽  
Cytochrome C1 ◽  
Gel Mobility Shift ◽  
E2f Proteins

The human cytochrome c1 promoter is strongly activated in transfected Drosophila SL2 cells expressing exogenous human E2F1. Transfection-deletion experiments, DNase I protection by E2F1 and gel mobility-shift experiments locate E2F1 activation sites to two regions on either side of the transcription start site. Deletion of either region prevents E2F1 activation in transfected SL2 cells, suggesting a co-operative interaction between them. E2F6, a member of the E2F family that lacks transactivation domains but contains specific suppressor domains, inhibits cytochrome c1 promoter activity when co-transfected into HeLa cells, indicating that the E2F proteins modulate the cytochrome c1 promoter in mammalian cells. However, E2F is not a general regulator of oxidative phosphorylation genes since three additional nuclear-encoded mitochondrial genes were unaffected by E2F1 or E2F6.

Sign in / Sign up

Export Citation Format

Share Document