Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Single-Round Patterned DNA Library Microarray Aptamer Lead Identification

A method for identifying an aptamer in a single round was developed using custom DNA microarrays containing computationally derived patterned libraries incorporating no information on the sequences of previously reported thrombin binding aptamers. The DNA library was specifically designed to increase the probability of binding by enhancing structural complexity in a sequence-space confined environment, much like generating lead compounds in a combinatorial drug screening library. The sequence demonstrating the highest fluorescence intensity upon target addition was confirmed to bind the target molecule thrombin with specificity by surface plasmon resonance, and a novel imino proton NMR/2D NOESY combination was used to screen the structure for G-quartet formation. We propose that the lack of G-quartet structure in microarray-derived aptamers may highlight differences in binding mechanisms between surface-immobilized and solution based strategies. This proof-of-principle study highlights the use of a computational driven methodology to create a DNA library rather than a SELEX based approach. This work is beneficial to the biosensor field where aptamers selected by solution based evolution have proven challenging to retain binding function when immobilized on a surface.

Crystal structure of metallo-DNA duplex containing T-Hg(II)-T base pairs

The DNA duplex containing mercury-mediated base pairs (T-Hg(II)-T) is an attractive biomacromolecular nanomaterials. In a recent study, it was confirmed that the Hg(II) ion significantly stabilizes a DNA duplex by binding selectively to a T-T mispair [1]. Based on the phenomenon observed, a DNA-based sensing system that selectively and sensitively detects Hg(II) ions in aqueous solution was developed [2]. In the present study, we have solved the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs [3]. The Hg(II) ion occupies the center between two T residues. The geometry of the T-Hg(II)-T base pair is very similar to that of the canonical Watson-Crick base pairs. The distance of N3-Hg(II) bond is 2.0 Å, suggesting that the N3 nitrogen releases an imino-proton even at neutral pH (pKa of N3 position of T is 9.8) and directly bonds to Hg(II). In the B-form DNA, the helical axis runs through the center of base pairs, and the Hg(II) ions are therefore aligned along the helical axis. The distance between the two neighboring Hg(II) ions is 3.3 Å. The relatively short Hg(II)-Hg(II) distance indicates that the metallophilic attraction could exit between them and may stabilize the B-form duplex. To support this, the DNA duplex is largely distorted and adopts an unusual non-helical conformation in the absence of Hg(II). In conclusion, the Hg(II) ion is essential for maintaining the B-form conformation of the DNA duplex containing T-T mispairs. The structure of the Hg(II)-DNA hybrid duplex itself and the Hg(II)-induced structural switching from the non-helical form to the B-form provide the basis for the structure-based design of metal-conjugated nucleic acid nanomaterials.

The contribution of pseudouridine to stabilities and structure of RNAs

Thermodynamic data are reported revealing that pseudouridine (Ψ) can stabilize RNA duplexes when replacing U and forming Ψ-A, Ψ-G, Ψ-U and Ψ-C pairs. Stabilization is dependent on type of base pair, position of Ψ within the RNA duplex, and type and orientation of adjacent Watson–Crick pairs. NMR spectra demonstrate that for internal Ψ-A, Ψ-G and Ψ-U pairs, the N3 imino proton is hydrogen bonded to the opposite strand nucleotide and the N1 imino proton may also be hydrogen bonded. CD spectra show that general A-helix structure is preserved, but there is some shifting of peaks and changing of intensities. Ψ has two hydrogen donors (N1 and N3 imino protons) and two hydrogen bond acceptors because the glycosidic bond is C-C rather than C-N as in uridine. This greater structural potential may allow Ψ to behave as a kind of structurally driven universal base because it can enhance stability relative to U when paired with A, G, U or C inside a double helix. These structural and thermodynamic properties may contribute to the biological functions of Ψ.

Dissociation of imino proton(s) of a highly water-soluble metal-free phthalocyanine and determination of its pKa value in water

Dissociation of imino proton(s) in the cavity of the macrocycle of a highly water-soluble, metal-free phthalocyanine ( H 2( H 4 tsppc ); where H 4 tsppc denotes tetrakis{(2′,6′-dimethyl-4′-sulfonic acid)phenoxy}phthalocyaninate) in ethanolic and aqueous solutions has spectrophotometrically been investigated. The spectral changes associated with reaction with NaOH have been found to involve one-proton transfer process in aqueous media while two-protons process in ethanolic media. The acid-dissociation constant of the first imino proton in water (in the presence of Triton X-100) has been determined to be 12.5 ± 0.2 (as pKa) at 25 °C. The doubly deprotonated species in EtOH has been easily converted to its corresponding cobalt(II) derivative by thermal reaction with anhydrous CoCl 2.