A Genome-Phenome Association study in native microbiomes identifies a mechanism for cytosine modification in DNA and RNA

Shotgun metagenomic sequencing is a powerful approach to study microbiomes in an unbiased manner and of increasing relevance for identifying novel enzymatic functions. However, the potential of metagenomics to relate from microbiome composition to function has thus far been underutilized. Here, we introduce the Metagenomics Genome-Phenome Association (MetaGPA) study framework, which allows linking genetic information in metagenomes with a dedicated functional phenotype. We applied MetaGPA to identify enzymes associated with cytosine modifications in environmental samples. From the 2365 genes that met our significance criteria, we confirm known pathways for cytosine modifications and proposed novel cytosine-modifying mechanisms. Specifically, we characterized and identified a novel nucleic acid modifying enzyme, 5-hydroxymethylcytosine carbamoyltransferase, that catalyzes the formation of a previously unknown cytosine modification, 5-carbamoyloxymethylcytosine, in DNA and RNA. Our work introduces MetaGPA as a novel and versatile tool for advancing functional metagenomics.

Distinct Cytosine Modification Profiles Define Epithelial-to-Mesenchymal Cell-State Transitions

Background: Epithelial-to-mesenchymal transition (EMT) is an early step in the invasion-metastasis cascade, involving progression through a number of cell intermediate states. Due to challenges with isolating intermediate cell states in EMT, genome-wide cytosine modification mechanisms that define transition through EMT states are not completely understood. We measured multiple DNA cytosine methylation modification marks, complemented with chromatin accessibility and gene expression, across clonal populations residing in specific EMT states. Results: Clones exhibiting intermediate EMT phenotypes demonstrated increased global 5-hydroxymethylcytosine (5hmC), decreased 5-methylcytosine (5mC), and more accesible chromatin. Open chromatin regions containing CpG loci with abundant 5hmC were enriched in motifs of key EMT transcription factors, ZEB1 and Snail. The magnitude of altered gene expression in intermediate cell states was higher for genes both with increased gene promoter 5hmC and differentially accessible chromatin compared with genes that exhibited differentially accessible chromatin alone, implicating functional epigenetic duality in regulation of EMT.Conclusion: Our results indicate the importance of both distinct and shared epigenetic profiles at the cytosine and chromatin level associated with EMT processes that contribute to gene regulation and which may be targeted to prevent the progression of EMT.

Ten-eleven translocation protein 1 modulates medulloblastoma progression

Background Medulloblastoma (MB) is the most common malignant pediatric brain tumor that originates in the cerebellum and brainstem. Frequent somatic mutations and deregulated expression of epigenetic regulators in MB highlight the substantial role of epigenetic alterations. 5-hydroxymethylcytosine (5hmC) is a highly abundant cytosine modification in the developing cerebellum and is regulated by ten-eleven translocation (TET) enzymes. Results We investigate the alterations of 5hmC and TET enzymes in MB and their significance to cerebellar cancer formation. We show total abundance of 5hmC is reduced in MB, but identify significant enrichment of MB-specific 5hmC marks at regulatory regions of genes implicated in stem-like properties and Nanog-binding motifs. While TET1 and TET2 levels are high in MBs, only knockout of Tet1 in the smoothened (SmoA1) mouse model attenuates uncontrolled proliferation, leading to a favorable prognosis. The pharmacological Tet1 inhibition reduces cell viability and platelet-derived growth factor signaling pathway-associated genes. Conclusions These results together suggest a potential key role of 5hmC and indicate an oncogenic nature for TET1 in MB tumorigenesis, suggesting it as a potential therapeutic target for MBs.

A Genome-Phenome Association study in native microbiomes identifies a mechanism for cytosine modification in DNA and RNA

Shotgun metagenomic sequencing is a powerful approach to study microbiomes in an unbiased manner and of increasing relevance for identifying novel enzymatic functions. However, the potential of metagenomics to relate from microbiome composition to function has thus far been underutilized. Here, we introduce the Metagenomics Genome-Phenome Association (MetaGPA) study framework, which allows to link genetic information in metagenomes with a dedicated functional phenotype. We applied MetaGPA to identify enzymes associated with cytosine modifications in environmental samples. From the 2365 genes that met our significance criteria, we confirm known pathways for cytosine modifications and proposed novel cytosine-modifying mechanisms. Specifically, we characterized and identified a novel nucleic acid modifying enzyme, 5-hydroxymethylcytosine carbamoyltransferase, that catalyzes the formation of a previously unknown cytosine modification, 5-carbamoyloxymethylcytosine, in DNA and RNA. Our work introduces MetaGPA as a novel and versatile tool for advancing functional metagenomics.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Epigenomic analysis of Parkinson’s disease neurons identifies Tet2 loss as neuroprotective

PD pathogenesis may involve the epigenetic control of enhancers that modify neuronal functions. Here, we comprehensively profile DNA methylation at enhancers, genome-wide, in neurons of 57 PD patients and 48 control individuals. We found a widespread increase in cytosine modifications at enhancers in PD neurons, which is partly explained by elevated hydroxymethylation levels. Epigenetic dysregulation of enhancers in PD converge on transcriptional abnormalities affecting neuronal signaling and immune activation pathways. In particular, PD patients exhibit an epigenetic and transcriptional upregulation of TET2, a master-regulator of cytosine modification status. TET2 inactivation in a neuronal cell line results in cytosine modification changes that are reciprocal to those observed in PD neurons. Furthermore, Tet2 inactivation in mice fully prevents dopaminergic neuronal loss in the substantia nigra induced by prior inflammation. Tet2 loss in mice also attenuates transcriptional immune responses to an inflammatory trigger. Thus, widespread epigenetic dysregulation of enhancers in PD neurons may, in part, be mediated by increased TET2 expression. Decreased Tet2 activity is neuroprotective, in vivo, and may be a novel therapeutic target for PD.

5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4

We designed a novel method to double-strand Agilent microarrays such that 5mC and 5hmC are incorporated on one DNA strand. Using protein binding microarrays we demonstrate the utility of this method in exploring how cytosine modification outside of CG dinucleotide alter the DNA binding of sequence-specific transcription factors.