A simplified RT-PCR assay for the simultaneous detection of tomato chlorosis virus and tomato yellow leaf curl virus in tomato

2021 ◽  
pp. 114282
Author(s):  
Liqin Tu ◽  
Shuhua Wu ◽  
Shexiang Gan ◽  
Wenhao Zhao ◽  
Shuo Li ◽  
...  
Keyword(s):  
Simultaneous Detection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Tomato Chlorosis Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba

Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 836-836 ◽  
Author(s):  
Y. Martínez-Zubiaur ◽  
E. Fiallo-Olivé ◽  
J. Carrillo-Tripp ◽  
R. Rivera-Bustamante
Keyword(s):  
Tomato Yellow Leaf ◽  
Pcr Analysis ◽  
Mixed Infections ◽  
Yellow Leaf ◽  
Rt Pcr ◽  
Specific Primers ◽  
First Report ◽  
Tomato Chlorosis Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

scholarly journals First Report of Tobacco as a Natural Host of Tomato yellow leaf curl virus in Spain

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 910-910 ◽  
Author(s):  
M. I. Font ◽  
C. Córdoba ◽  
A. García ◽  
R. Santiago ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Simultaneous Detection ◽  
Tomato Yellow Leaf ◽  
Natural Host ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yellow Leaf ◽  
Tobacco Plants ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Two begomovirus species, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), have been identified as causal agents of tomato yellow leaf curl disease (TYLCD) in Spain. TYLCSV was reported in Spain in 1992 and TYLCV in 1997 on tomato crops (3). TYLCV was also reported in common bean (Phaseolus vulgaris L.) and pepper (Capsicum annuum L.) crops in southern Spain in 1997 and 1999, respectively. During the summer of 2004, symptoms of yellowing, crumpling, and necrosis of new leaves were observed sporadically in young, field-grown tobacco (Nicotiana tabacum L.) plants in the Badajoz Province. These tobacco plants were next to tomato crops where TYLCV was detected for the first time in Badajoz in 2003. In September 2004, four symptomatic tobacco plants were selected for double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) and polymerase chain reaction (PCR) identification analyses. Serological analyses were carried out in two repetitions and with the following polyclonal antisera: Potato virus Y (PVY) (Loewe Biochemica, Sauerlach, Germany); Tobacco mild green mosaic virus (produced in our laboratory); Tobacco mosaic virus (BIO-RAD, Marnes-La-Coquette, France); and Tomato spotted wilt virus (Loewe Biochemica). A simplified method of duplex PCR was used for a rapid, sensitive, and simultaneous detection of TYLCSV and TYLCV (2). Mixed infections of PVY and TYLCV were detected in all four tobacco samples tested. TYLCV infection was confirmed using the primer pair TY-1/TY-2 specific for the coat protein (CP) gene of begomoviruses (1). The CP fragment was digested with the restriction enzyme AvaII, and the pattern obtained corresponded to that obtained from TYLCV-infected tomato that served as a positive control. Two PCR products from different tobacco samples were sequenced and both showed 100% identity with the corresponding region (Almería) of TYLCV (GenBank Accession No. AJ489258) and 99% with TYLCV-Mild (Spain) (GenBank Accession No. AJ519441), confirming the diagnosis. The symptoms observed in the tobacco plants can not be attributed solely to TYLCV since the virus was present in a mixed infection with PVY. However, tobacco infected with TYLCV may serve as an important alternate host for TYLCV in the tomato cropping system. To our knowledge, this is the first report of N. tabacum as a natural host of TYLCV in Spain. References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) P. Martínez-Culebras et al. Ann. Appl. Biol. 139:251, 2001. (3) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997.

scholarly journals First Report of Tomato yellow leaf curl virus in Hawaii

Plant Disease ◽  
2010 ◽  
Vol 94 (5) ◽  
pp. 641-641 ◽  
Author(s):  
M. J. Melzer ◽  
D. Y. Ogata ◽  
S. K. Fukuda ◽  
R. Shimabuku ◽  
W. B. Borth ◽  
...  
Keyword(s):  
Tomato Plant ◽  
Tomato Yellow Leaf ◽  
Nucleotide Identity ◽  
Yellow Leaf ◽  
Pcr Assay ◽  
Tomato Plants ◽  
Plant Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato yellow leaf curl disease, caused by the begomovirus Tomato yellow leaf curl virus (TYLCV; family Geminiviridae), is an economically important disease of tomato (Solanum lycopersicum L.) that can be very destructive in tropical and subtropical regions (1). In October 2009, tomato plants showing stunted new growth, interveinal chlorosis, and upward curling of leaf margins were reported by a residential gardener in Wailuku, on the island of Maui. Similar symptoms were observed in approximately 200 tomato plants at a University of Hawaii research farm in Poamoho, on the island of Oahu in November 2009. The similarity between these symptoms and those of tomato yellow leaf curl disease and the presence of whiteflies (Bemisia spp.), the vector of TYLCV, suggested the causal agent was a geminivirus such as TYLCV. Total nucleic acids were extracted from a tomato plant sample from Wailuku and Poamoho and used in a PCR assay with degenerate primers PAR1c715 and PAL1v1978 for geminivirus detection (4). The ~1.5-kbp amplicon expected to be produced from a geminivirus template was generated from the symptomatic tomato plant samples but not from a greenhouse-grown control tomato plant. The amplicons were cloned by the pGEM-T Easy vector (Promega, Madison, WI). Three clones from each sample were sequenced, revealing 97 to 99% nucleotide identity to TYLCV sequences in GenBank and a 98.9% nucleotide identity between the Wailuku (Accession No. GU322424) and Poamoho (Accession No. GU322423) isolates. A multiplex PCR assay for the detection and discrimination between the IL and Mld clades of TYLCV was also performed on these isolates (2). A ~0.8-kbp amplicon was generated from both isolates confirming the presence of TYLCV and their inclusion into the TYLCV-IL clade (2). Seven symptomatic and three asymptomatic tomato plant samples from Poamoho were tested for TYLCV using a squash-blot hybridization assay (3) utilizing a digoxigenin-labeled probe derived from the ~1.5-kbp PCR amplicon. All symptomatic tomato plants and one asymptomatic tomato plant were found to be infected with TYLCV. How the virus entered Hawaii and how long it has been present is unknown. The most plausible route is through infected plant material such as an asymptomatic alternative host rather than viruliferous whiteflies. It appears TYLCV is not a recent introduction into Hawaii since the Wailuku gardener observed similar disease symptoms for a few years before submitting samples for testing. In January 2010, TYLCV was also detected in two commercial tomato farms on Oahu, posing a serious threat to the state's $10 million annual tomato crop. References: (1) H. Czosnek and H. Laterrot. Arch. Virol. 142:1392, 1997. (2) P. Lefeuvre et al. J. Virol. Methods 144:165, 2007. (3) N. Navot et al. Phytopathology 79:562, 1989. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Identification of Weed Hosts of Tomato yellow leaf curl virus in Cyprus

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 120-125 ◽  
Author(s):  
L. C. Papayiannis ◽  
N. I. Katis ◽  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Real Time ◽  
Management Strategies ◽  
Extensive Study ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Weed Species ◽  
Pcr Assay ◽  
Tomato Production ◽  
Leaf Curl Virus ◽  
Leaf Curl

An extensive study was conducted during 2007 and 2008 in three major tomato production areas of Cyprus, where Tomato yellow leaf curl virus (TYLCV) is commonly found, to assess the incidence and prevalence of naturally infected weed species that could serve as TYLCV reservoirs. Approximately 4,000 of the most common dicotyledonous plants belonging to 122 species from 25 families were collected, identified, and tested for TYLCV presence using serological and molecular methods. The tests included a previously reported conventional polymerase chain reaction (PCR) assay and a real-time TaqMan PCR assay developed and optimized in this study. Real-time PCR was found to be the most sensitive technique, and enabled the detection of TYLCV in 461 samples of 49 different species belonging to the families Amaranthaceae, Chenopodiaceae, Compositae, Convolvulaceae, Cruciferae, Euphorbiaceae, Geraniaceae, Leguminosae, Malvaceae, Orobanchaceae, Plantaginaceae, Primulaceae, Solanaceae, Umbelliferae, and Urticaceae. The results further indicated that the host range of TYLCV in Cyprus is far more extensive than previously documented and, therefore, new management strategies are required. These should focus on the control of alternative virus hosts during the growing season and in crop-free periods.

scholarly journals Tomato chlorosis virus and Tomato yellow leaf curl virus CAUSING MIXED INFECTION IN PROTECTED EGGPLANT (Solanum melongena) CROPS IN TURKEY

2020 ◽  
Vol 19 (5) ◽  
pp. 81-89
Author(s):  
Hakan Fidan ◽  
Pelin Sarıkaya
Keyword(s):  
Phylogenetic Analyses ◽  
Infected Plant ◽  
Solanum Melongena ◽  
First Record ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Chlorosis Virus ◽  
Solanaceae Family ◽  
Leaf Curl Virus ◽  
Leaf Curl

Eggplant (Solanum melongena) is an important source of food for people. Eggplant cultivations, located in the Mediterranean region province of Antalya, corresponds to 20% of the total eggplant production in Turkey. In Antalya province, yellowing type symptoms were observed in eggplant areas and it was found that these symptoms were not caused by fungal or bacterial cause. The yellowing symptoms characteristic for Solanaceae family, such as tomato and pepper, are also observed in the same family of eggplant. Total nucleic acids were obtained from infected eggplants were tested by RT-PCR/PCR with specific primers of TYLCV (Tomato yellow leaf curl virus) and ToCV (Tomato chlorosis virus). Their PCR amplicons were directly sequenced, and phylogenetic analyses were performed. Additionally, TYLCV infected plants were determined in the strain level. This study is the first record of Tomato chlorosis virus and Tomato yellow leaf curl virus causing infection in eggplant in Antalya province and characterized by yellowing type symptom in infected plant.

scholarly journals Tobacco: A New Natural Host of Tomato chlorosis virus in Spain

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1162-1162 ◽  
Author(s):  
E. Fiallo-Olivé ◽  
A. I. Espino ◽  
M. Botella-Guillén ◽  
E. Gómez-González ◽  
J. A. Reyes-Carlos ◽  
...  
Keyword(s):  
Canary Islands ◽  
Tomato Yellow Leaf ◽  
Natural Host ◽  
Rdrp Gene ◽  
Yellow Leaf ◽  
Rt Pcr ◽  
Tobacco Plants ◽  
Cp Gene ◽  
Tomato Chlorosis Virus ◽  
Leaf Curl Virus

In March 2013, symptoms of mild leaf curling, mosaic, and interveinal yellowing were observed in tobacco (Nicotiana tabacum) plants grown in a row surrounding the exterior of a greenhouse containing a tomato crop in Guía de Isora, Tenerife (Canary Islands, Spain). The tobacco plants were found lightly infested by the whitefly (Hemiptera: Aleyrodidae) Bemisia tabaci. The greenhouses in this area are devoted to the commercial production of tomato. The farmers grow some tobacco plants inside and outside of them as a reservoir of parasitoids and depredators of B. tabaci. This insect is the natural vector of the main viruses severely affecting tomato in the Canary Islands, the begomovirus Tomato yellow leaf curl virus and the crinivirus Tomato chlorosis virus (ToCV). ToCV was detected in Spain in 1997 (2) and has become established in most of the coastal provinces of eastern and southern continental Spain and in the Canary Islands. Approximately 50% of the tomato plants grown inside the greenhouse close to the tobacco plants showed typical ToCV symptoms, and infection by this virus was confirmed in the seven plants tested by reverse transcription (RT)-PCR using specific coat protein gene (CP) primers (see below). Total RNA was extracted with TRIzol Reagent (Invitrogen) from leaves of five tobacco plants showing the symptoms mentioned above and analyzed by dot-blot hybridization using digoxigenin-labeled RNA probes to the CP gene of ToCV. Positive signal was obtained for all five plants. RT-PCR reactions were performed with specific primers for the detection of ToCV, MA380(+) (5′-GTGAGACCCCGATGACAGAT-3′) and MA381(-) (5′-TACAGTTCCTTGCCCTCGTT-3′), specific to the CP gene (ToCV RNA 2) (3), and MA396(+) (5′-TGGTCGAACAGTTTGAGAGC-3′) and MA397(-) (5′-TGAACTCGAATTGGGACAGA-3′), specific to the RNA-dependent RNA polymerase (RdRp) gene (ToCV RNA 1) (1). DNA fragments of the expected size (436 and 763 bp, respectively) were obtained, thus supporting the presence of ToCV in the symptomatic samples. The amplified product of the RdRp gene fragment from one sample was directly sequenced (Macrogen Inc., South Korea) and resulted closely related to ToCV isolates from Sudan (GenBank Accession No. JN411686, 99.6% nt identity) and Spain (DQ983480, 99.4% nt identity), thereby confirming the infection by this virus. Partial sequence of the ToCV isolate from tobacco was deposited in GenBank under accession no. KJ175084. In addition, all five plants resulted positive when analyzed by ELISA for Tomato spotted wilt virus and Potato virus Y and by PCR for Tomato yellow leaf curl virus (data not shown), all three viruses reported to infect naturally tobacco. Although tobacco has been reported as an experimental host of ToCV (4), to our knowledge, this is the first report of this species as a natural host of this virus. The finding of ToCV infecting tobacco raises the question of whether this virus could emerge as a pathogen of this crop and questions the use that farmers make of tobacco as reservoirs of natural enemies for whitefly control in tomato. References: (1) G. Lozano et al. J. Virol. 83:12973, 2009. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) H. P. Trenado et al. Eur. J. Plant Pathol. 118:193, 2007 (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in Mississippi

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1287-1287 ◽  
Author(s):  
D. M. Ingram ◽  
A. Henn
Keyword(s):  
Leaf Size ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Production Operation ◽  
Yellow Leaf ◽  
Pcr Assay ◽  
Tomato Production ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

Sign in / Sign up

Export Citation Format

Share Document