scholarly journals First Report of Tomato yellow leaf curl virus in Mississippi

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1287-1287 ◽  
Author(s):  
D. M. Ingram ◽  
A. Henn
Keyword(s):  
Leaf Size ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Production Operation ◽  
Yellow Leaf ◽  
Pcr Assay ◽  
Tomato Production ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
M. Quiñones ◽  
D. Fonseca ◽  
Y. Martinez ◽  
G. P. Accotto
Keyword(s):  
Field Survey ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Tomato Production ◽  
First Report ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

scholarly journals Identification of Weed Hosts of Tomato yellow leaf curl virus in Cyprus

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 120-125 ◽  
Author(s):  
L. C. Papayiannis ◽  
N. I. Katis ◽  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Real Time ◽  
Management Strategies ◽  
Extensive Study ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Weed Species ◽  
Pcr Assay ◽  
Tomato Production ◽  
Leaf Curl Virus ◽  
Leaf Curl

An extensive study was conducted during 2007 and 2008 in three major tomato production areas of Cyprus, where Tomato yellow leaf curl virus (TYLCV) is commonly found, to assess the incidence and prevalence of naturally infected weed species that could serve as TYLCV reservoirs. Approximately 4,000 of the most common dicotyledonous plants belonging to 122 species from 25 families were collected, identified, and tested for TYLCV presence using serological and molecular methods. The tests included a previously reported conventional polymerase chain reaction (PCR) assay and a real-time TaqMan PCR assay developed and optimized in this study. Real-time PCR was found to be the most sensitive technique, and enabled the detection of TYLCV in 461 samples of 49 different species belonging to the families Amaranthaceae, Chenopodiaceae, Compositae, Convolvulaceae, Cruciferae, Euphorbiaceae, Geraniaceae, Leguminosae, Malvaceae, Orobanchaceae, Plantaginaceae, Primulaceae, Solanaceae, Umbelliferae, and Urticaceae. The results further indicated that the host range of TYLCV in Cyprus is far more extensive than previously documented and, therefore, new management strategies are required. These should focus on the control of alternative virus hosts during the growing season and in crop-free periods.

scholarly journals First Report of Tomato yellow leaf curl virus in Venezuela

Plant Disease ◽  
2007 ◽  
Vol 91 (6) ◽  
pp. 768-768 ◽  
Author(s):  
K. Zambrano ◽  
O. Carballo ◽  
F. Geraud ◽  
D. Chirinos ◽  
C. Fernández ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Leaf Size ◽  
Molecular Data ◽  
Tomato Yellow Leaf ◽  
Nucleotide Identity ◽  
Yellow Leaf ◽  
Mild Strain ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the family Geminiviridae, is a serious production constraint to tomato worldwide. In the new world, the virus had been identified as the causal agent of tomato yellow leaf curl disease in the Caribbean countries of the Dominican Republic, Cuba, and Guadeloupe and also in Florida and the Yucatan Peninsula (1). Molecular data from these TYLCV isolates identified the virus as the TYLCV prototype from Israel. During April 2004, tomato plants showing symptoms such as chlorotic leaf edges, upward leaf cupping, leaf mottling, and reduced leaf size indicative of TYLCV were observed in commercial fields in Zulia state, Venezuela. Whiteflies (Bemisia tabaci Gennadius) were present in the field and appeared to be associated with the disease. Leaf samples from nine symptomatic plants were collected and brought to the lab at Instituto Venezolano de Investigaciones Científicas (IVIC) for further analyses. Geminivirus infection of samples was confirmed by PCR amplification with the degenerate primer pair PAL1v1978 and PAR1c494 (2). TYLCV coat protein gene-specific primers KL04-06_TYLCV CP F and KL04-07_TYLCV CP R (3) were used to confirm the diagnosis. These primers amplified the expected 842-bp PCR product from the nine symptomatic samples. One of the resulting amplicons was cloned into the pCR-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. DQ302033). Sequence comparison with those available in the NCBI database indicated that the sequenced portion of the genome shared 99% nucleotide identity with the TYLCV mild strain from Portugal (GenBank Accession No. AF105975) and 98% nucleotide identity with the TYLCV mild strain from Spain (GenBank Accession No. AF071228), TYLCV Israel isolate (GenBank Accession No. AM234066), and TYLCV Mexico isolate (GenBank Accession No. DQ631892). To our knowledge, this is the first report of TYLCV infecting tomato crops in South America. Further studies are needed to clarify how TYLCV has been introduced into Venezuela. References: (1) J. E. Polston and P. K. Anderson. Plant Dis. 81:1358, 1997. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) K. S. Ling et al. Plant Dis. 90:379, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in Tomato in Guadeloupe

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1397-1397 ◽  
Author(s):  
C. Urbino ◽  
K. Tassius
Keyword(s):  
Puerto Rico ◽  
Pcr Primers ◽  
Tomato Yellow Leaf ◽  
Yellow Mosaic Virus ◽  
Yellow Leaf ◽  
Tomato Production ◽  
First Report ◽  
Embl Accession ◽  
Leaf Curl Virus ◽  
Leaf Curl

In September 2001, symptoms of stunting and chlorotic curled leaves of reduced size were observed on tomato plants in Guadeloupe. These symptoms were different from those described for Potato yellow mosaic virus, which has been present since 1993, but similar to those described for Tomato yellow leaf curl virus (TYLCV). Samples from symptomatic plants were collected and analyzed by polymerase chain reaction (PCR). Primers PC1 (5′-TGACTATGTCGAAGCGACCAGG-3′) and PC2 (5′-CGACATTACAGCCTCAGACTGG-3′) were designed to amplify a 950-bp fragment within the coat protein gene (CP) of TYLCV-IL species (2). Primer pair MP16/MP82 (3) amplified a 550-bp fragment from the conserved nonanucleotide sequence (TAATATTAC) to the 5′ end of the CP gene. Products of expected sizes were obtained with both pairs of primers from all symptomatic samples but not from uninfected samples. A 950-bp and a 550-bp PCR product were cloned into a pGEM-T Easy Vector (Promega, Madison, WI) and sequenced with plasmid specific primers (SP6 and T7). Sequences were compared with those available in the NCBI database using BlastN. Fifteen of the sequences that gave the highest score with BlastN were aligned with the Guadeloupe sequences using Clustal W. The nucleotide sequence of the 950-bp fragment (GenBank Accession No. AY319645) shared at least 97% sequence identity with that of TYLCV from Israel (EMBL Accession No. X15656), Puerto Rico (GenBank Accession No. AY134494), Cuba (EMBL Accession No. AJ223505), and the Dominican Republic (GenBank Accession No. AF024715). Similar percentages of identity were obtained with the 550-bp sequence (GenBank Accession No. AY319646). These results confirm that a begomovirus belonging to the species TYLCV-Israel is infecting tomato in Guadeloupe. To our knowledge, this is the first report of TYLCV in this region of the Caribbean. Puerto Rico is the closest location from which TYLCV was previously reported (1). In May 2002, typical TYLCV symptoms were observed in all tomato production areas at an incidence of 80 to 100%. References: (1) J. Bird et al. Plant Dis. 85:1028, 2001. (2) Y. Martinez et al. Rev. Prot. Veg. 18:168, 2003. (3) P. Umaharan et al. Phytopathology 88:1262, 1998.

scholarly journals First Report of Tomato yellow leaf curl virus in Louisiana

Plant Disease ◽  
2001 ◽  
Vol 85 (2) ◽  
pp. 230-230 ◽  
Author(s):  
R. A. Valverde ◽  
P. Lotrakul ◽  
A. D. Landry ◽  
J. E. Boudreaux
Keyword(s):  
The United States ◽  
Tomato Yellow Leaf ◽  
Yield Reduction ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Tomato Plants ◽  
First Report ◽  
Biotype B ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

scholarly journals Introduction of the Exotic Monopartite Tomato yellow leaf curl virus into West Coast Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (10) ◽  
pp. 1360-1360 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris
Keyword(s):  
United States ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Caribbean Region ◽  
Yellow Leaf ◽  
Fresh Market ◽  
Tomato Production ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Leaf curl symptoms that are reminiscent of begomovirus (genus Begomovirus, family Geminiviridae) infection were observed widespread in the tomato crop during the early fall 2005 through the spring 2006 growing seasons in Sinaloa State, Mexico. Symptoms were widespread in three major valleys (Culiacan, Guasave, and Los Mochis) that are largely dedicated to fresh-market tomato production for the U.S. market from October to June. Symptoms included stunting of leaves, shortened internodes, distortion of leaf margins, and green vein banding. Fruit set was reduced significantly (as much as 90%) on the portion of the plant that developed above the point of symptom expression. Tomato fields were heavily infested with the B biotype of the whitefly Bemisia tabaci (Genn.) vector and no other insect vectors were noted in the fields. Total DNA was extracted from six symptomatic tomato plants (two from each valley) and used as template to amplify, clone, and sequence the core region of the begomovirus CP. BLAST analysis of begomovirus sequences available in the NCBI GenBank database indicated the closest match was the Old World monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) from Israel (Accession No. X15656) at 97.8% shared nucleotide (nt) identity. The full-length genome was amplified for each of six isolates using TempliPhi (Amersham Biosciences, Piscataway, NJ) and cloned into the pGEM7 vector (Promega, Madison, WI). The complete DNA genome sequence was determined for eight clones by primer walking. Cloned TempliPhi products sequenced represented two to three isolates from each valley. Results indicated that the isolates (n = 8) were 98.9 to 100% identical (Accession No. DQ631892) to each other, and they shared 98% identity with TYLCV isolates reported from the Caribbean Region and Florida. This highly virulent begomovirus of tomato, originating in Israel, was first reported in Mexico from 1996 to 1997 when it was identified in tomato plants in the Yucatan Peninsula (1) (>1,500 miles from Sinaloa). The latter report followed the introduction of TYLCV in tomato seedlings from Florida into several eastern U.S. states (3,4) and then into Puerto Rico (2). The introduction of TYLCV into Sinaloa where tomato production is highly concentrated is significant because the region supplies the majority (as much as 93%) of fresh-market tomatoes to the western United States from October to June (>$750 million dollars). Of equal importance is the immediate proximity of the pandemic to California where more than 90% of the processing tomatoes in the United States are grown. References: (1) J. T. Ascencio-Ibáñez et al. Plant Dis. 83:1178, 1999. (2) J. Bird et al. Plant Dis. 85:1028, 2001. (3) M. T. Momol et al. Plant Dis 83:487, 1999. (4) J. E. Polston and P. K. Anderson, Plant Dis. 81:1358, 1997.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First report of natural infection of tomato yellow leaf curl virus on cucumber in China

2020 ◽  
Vol 102 (4) ◽  
pp. 1371-1371
Author(s):  
Feng Zhu ◽  
Qin-Qin Zhang ◽  
Peng-Xiang Zhu ◽  
Qi-Ping Zhang ◽  
Meng-Yao Cao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl
Sign in / Sign up

Export Citation Format

Share Document