Spatio-temporal characterisation of changes in the resistance of widely grown soybean cultivars to Soybean mosaic virus across a century of breeding in China

2018 ◽  
Vol 69 (4) ◽  
pp. 395 ◽  
Author(s):  
Le Gao ◽  
Shi Sun ◽  
Kai Li ◽  
Liwei Wang ◽  
Wensheng Hou ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Disease Index ◽  
Soybean Cultivars ◽  
Individual Strain ◽  
Glycine Max L ◽  
Spatio Temporal ◽  
River Valleys ◽  
Over Time

Soybean mosaic virus (SMV) causes significant yield losses and seed-quality deterioration in the soybean (Glycine max (L.) Merr.) growing areas of China, and breeding disease-resistant cultivars is the most common approach for controlling the spread of the disease and the destruction of soybean crop. In this study, 97 widely grown soybean cultivars representing nine decades (1923–2006) of breeding from the four main soybean-producing subregions in China (Northern Heilongjiang (NH), Mid-Southern Heilongjiang (MSH), Jilin-Liaoning (JL) and Yellow–Huai-Hai River Valleys (YHH)) were inoculated with six prevalent SMV strains: SC3, SC7, SC8, SC11, SC15 and SC18. The average disease index (ADI) of the six SMV strains ranged from 26.95 to 48.97, and the numbers of resistant and susceptible cultivars to the six SMV strains ranged from 27 (27.8%) to 64 (66.0%) and 33 (34.0%) to 70 (72.2%), respectively. The ADIs of cultivars from NH, MSH, JL and YHH were 50.82, 47.27, 43.10 and 33.05, respectively. Soybean cultivars released in the 1940s and 1960s had the highest and lowest ADI values, 53.95 and 32.03, respectively. From NH and JL, all individual strain disease index (DI) values exhibited decreasing trend over time, but no decreasing trend in DI values was observed from MSH. From YHH, DI values for SC3 and SC18 displayed apparent increasing trend over time, and DI values for SC15 showed an obvious decreasing trend. In all, 24 soybean cultivars were identified as having broad-spectrum resistance, with ADI values ranging from 0.80 to 35.52 for the six SMV strains, and 13 soybean cultivars were identified as highly resistant to at least one SMV strain. The findings of this study will contribute to monitoring the pattern of spatio-temporal variation in SMV resistance in different soybean-producing areas of China and facilitate conventional and molecular breeding programs for SMV resistance in soybean.

Inheritance of Reaction to Soybean Mosaic Virus in Two Soybean Cultivars

Crop Science ◽  
1989 ◽  
Vol 29 (6) ◽  
pp. 1439-1441 ◽  
Author(s):  
G. R. Buss ◽  
C. W. Roane ◽  
S. A. Tolin ◽  
P. Chen
Keyword(s):  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Soybean Cultivars

scholarly journals Role of Soybean mosaic virus–Encoded Proteins in Seed and Aphid Transmission in Soybean

2013 ◽  
Vol 103 (9) ◽  
pp. 941-948 ◽  
Author(s):  
Sushma Jossey ◽  
Houston A. Hobbs ◽  
Leslie L. Domier
Keyword(s):  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Seed Transmission ◽  
Aphid Transmission ◽  
Plant Introduction ◽  
Sequence Motif ◽  
Coding Region ◽  
Encoded Proteins ◽  
Seed Transmissibility

Soybean mosaic virus (SMV) is seed and aphid transmitted and can cause significant reductions in yield and seed quality in soybean (Glycine max). The roles in seed and aphid transmission of selected SMV-encoded proteins were investigated by constructing mutants in and chimeric recombinants between SMV 413 (efficiently aphid and seed transmitted) and an isolate of SMV G2 (not aphid or seed transmitted). As previously reported, the DAG amino acid sequence motif near the amino terminus of the coat protein (CP) was the major determinant in differences in aphid transmissibility of the two SMV isolates, and helper component proteinase (HC-Pro) played a secondary role. Seed transmission of SMV was influenced by P1, HC-Pro, and CP. Replacement of the P1 coding region of SMV 413 with that of SMV G2 significantly enhanced seed transmissibility of SMV 413. Substitution in SMV 413 of the two amino acids that varied in the CPs of the two isolates with those from SMV G2, G to D in the DAG motif and Q to P near the carboxyl terminus, significantly reduced seed transmission. The Q-to-P substitution in SMV 413 also abolished virus-induced seed-coat mottling in plant introduction 68671. This is the first report associating P1, CP, and the DAG motif with seed transmission of a potyvirus and suggests that HC-Pro interactions with CP are important for multiple functions in the virus infection cycle.

scholarly journals G7H, a New Soybean mosaic virus Strain: Its Virulence and Nucleotide Sequence of CI Gene

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1372-1375 ◽  
Author(s):  
Yul-Ho Kim ◽  
Ok-Sun Kim ◽  
Bong-Choon Lee ◽  
Jung-Kyung Moon ◽  
Sang-Chul Lee ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Virus Strain ◽  
Soybean Mosaic Virus ◽  
Mosaic Symptom ◽  
Inclusion Region ◽  
Soybean Cultivars ◽  
Soybean Mosaic Virus Strain ◽  
Local Lesions ◽  
Differential Cultivars

A new Soybean mosaic virus (SMV) strain was isolated in Korea and designated as G7H. Its virulence on eight differentials and 42 Korean soybean cultivars was compared with existing SMV strains. G7H caused the same symptoms as G7 did on the eight differential cultivars. However, it caused different symptoms on the G7-immune Korean soybean cultivars; G7H caused necrosis in Suwon 97 (Hwangkeumkong) and Suwon 181 (Daewonkong), and a mosaic symptom in Miryang 41 (Duyoukong), while G7 caused only local lesions on those varieties. The nucleotide sequence of the cylindrical inclusion region of G7H was determined and compared with other SMV strains. G7H shared 96.3 and 91.3% nucleotide similarities with G2 and G7, respectively; whereas G7 shared 95.6% nucleotide similarity with G5H.

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

STEM-TIP NECROSIS: A HYPERSENSITIVE, TEMPERATURE DEPENDENT DOMINANT GENE REACTION OF SOYBEAN TO INFECTION BY SOYBEAN MOSAIC VIRUS

1987 ◽  
Vol 67 (3) ◽  
pp. 661-665 ◽  
Author(s):  
J. C. TU ◽  
R. I. BUZZELL
Keyword(s):  
Mosaic Virus ◽  
Type Strain ◽  
Genetic Basis ◽  
Soybean Mosaic Virus ◽  
Dominant Gene ◽  
Particle Morphology ◽  
Hypersensitive Reaction ◽  
Temperature Dependent ◽  
Differential Host ◽  
Glycine Max L

A stem tip necrosis (STN) disease observed in the soybean (Glycine max (L.) Merr.) cultivar Columbia and some of its progeny was studied as to causal agent and the genetic basis for the STN reaction. A virus was isolated which is similar to the ATCC type strain of soybean mosaic virus (SMV), based on the particle morphology and differential host series. Harosoy, although susceptible to SMV, does not develop STN. A line (0X686) pure-breeding for STN was derived from an F2 plant of Columbia × Harosoy. When seedlings of 0X686 were inoculated with SMV they developed typical STN. In the backcross of 0X686 to Harosoy, the BC1F2 progeny segregated in a ratio of 3 STN:1 normal in both the cross and the reciprocal indicating the effect of a nuclear-inherited, dominant gene. This gene appears to be a gene for resistance which results in a severe hypersensitive reaction of the stem tip to systemic SMV. The development of STN in 0X686 was shown to be temperature dependent. At 20 and 24 °C, the majority of the inoculated plants developed STN. At 28 and 32 °C, nearly all the inoculated plants developed typical mosaic symptoms but few had STN.Key words: Soybean, soybean mosaic virus, tip necrosis, hypersensitivity, temperature-dependent, dominant gene

Mapping tightly linked genes controlling potyvirus infection at the Rsv1 and Rpv1 region in soybean

Genome ◽  
2002 ◽  
Vol 45 (3) ◽  
pp. 592-599 ◽  
Author(s):  
M A Gore ◽  
A J Hayes ◽  
S C Jeong ◽  
Y G Yue ◽  
G R Buss ◽  
...  
Keyword(s):  
Disease Resistance ◽  
Microsatellite Markers ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Resistance Response ◽  
Marker Data ◽  
Glycine Max L ◽  
Resistance Gene Candidate ◽  
Rflp Rapd ◽  
Insight Into

Soybean mosaic virus (SMV) and peanut mottle virus (PMV) are two potyviruses that cause yield losses and reduce seed quality in infested soybean (Glycine max (L.) Merr.) fields throughout the world. Rsv1 and Rpv1 are genes that provide soybean with resistance to SMV and PMV, respectively. Isolating and characterizing Rsv1 and Rpv1 are instrumental in providing insight into the molecular mechanism of potyvirus recognition in soybean. A population of 1056 F2 individuals from a cross between SMV- and PMV-resistant line PI 96983 (Rsv1 and Rpv1) and the susceptible cultivar 'Lee 68' (rsv1 and rpv1) was used in this study. Disease reaction and molecular-marker data were collected to determine the linkage relationship between Rsv1, Rpv1, and markers that target candidate disease-resistance genes. F2 lines showing a recombination between two of three Rsv1-flanking microsatellite markers were selected for fine mapping. Over 20 RFLP, RAPD, and microsatellite markers were used to map 38 loci at high-resolution to a 6.8-cM region around Rsv1 and Rpv1. This study demonstrates that Rsv1 and Rpv1 are tightly linked at a distance of 1.1 cM. In addition, resistance-gene candidate sequences were mapped to positions flanking and cosegregating with these resistance loci. Based on comparisons of genetic markers and disease reactions, it appears likely that several tightly linked genes are conditioning a resistance response to SMV. We discuss the specifics of these findings and investigate the utility of two disease resistance related probes for the screening of SMV or PMV resistance in soybean.Key words: NBS, multigene family, and disease resistance.

Characterization of Soybean mosaic virus resistance derived from inverted repeat-SMV-HC-Pro genes in multiple soybean cultivars

2015 ◽  
Vol 128 (8) ◽  
pp. 1489-1505 ◽  
Author(s):  
Le Gao ◽  
Xueni Ding ◽  
Kai Li ◽  
Wenlin Liao ◽  
Yongkun Zhong ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Virus Resistance ◽  
Inverted Repeat ◽  
Soybean Mosaic Virus ◽  
Soybean Cultivars

scholarly journals Soybean Resistance to Soybean Mosaic Virus

Plants ◽  
2020 ◽  
Vol 9 (2) ◽  
pp. 219 ◽  
Author(s):  
Kristin Widyasari ◽  
Mazen Alazem ◽  
Kook-Hyung Kim
Keyword(s):  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Effector Proteins ◽  
Oxygen Species ◽  
R Genes ◽  
Development Of Resistance ◽  
Soybean Resistance ◽  
Soybean Plants ◽  
Made In

Soybean mosaic virus (SMV) occurs in all soybean-growing areas in the world and causes huge losses in soybean yields and seed quality. During early viral infection, molecular interactions between SMV effector proteins and the soybean resistance (R) protein, if present, determine the development of resistance/disease in soybean plants. Depending on the interacting strain and cultivar, R-protein in resistant soybean perceives a specific SMV effector, which triggers either the extreme silent resistance or the typical resistance manifested by hypersensitive responses and induction of salicylic acid and reactive oxygen species. In this review, we consider the major advances that have been made in understanding the soybean–SMV arms race. We also focus on dissecting mechanisms SMV employs to establish infection and how soybean perceives and then responds to SMV attack. In addition, progress on soybean R-genes studies, as well as those addressing independent resistance genes, are also addressed.

Sign in / Sign up

Export Citation Format

Share Document