scholarly journals First Report of Bacterial Blight of Rutabaga (Brassica napus var. napobrassica) Caused by Pseudomonas syringae pv. alisalensis in California

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 112-112 ◽  
Author(s):  
S. T. Koike ◽  
K. Kammeijer ◽  
C. T. Bull ◽  
Doug O'Brien
Keyword(s):  
Brassica Napus ◽  
Pseudomonas Syringae ◽  
Bacterial Pathogen ◽  
Acid Methyl Ester ◽  
Hypersensitive Reaction ◽  
Bacterial Suspension ◽  
Experimental Conditions ◽  
First Report ◽  
Plastic Bags ◽  
Initial Symptoms

In 2005, commercial, organically grown rutabaga (Brassica napus var. napobrassica) in San Benito County, CA showed symptoms of a previously undescribed disease on approximately 30% of the plants. Initial symptoms consisted of small (1 to 2 mm in diameter), angular, water-soaked flecks that often were surrounded by chlorotic haloes. These flecks enlarged and coalesced into large, irregularly shaped, gray brown lesions that could be as long as 10 mm. Lesions were visible from both adaxial and abaxial leaf surfaces and generally retained the chlorotic borders. A blue-green fluorescing pseudomonad was consistently isolated from lesions on King's medium B. Eight isolates were characterized and were levan positive, oxidase negative, and arginine dihydrolase negative. Isolates did not rot potato slices but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Samsun). These data indicated that the bacteria belonged to Lelliot's LOPAT group 1 (2). This was confirmed with data from fatty acid methyl ester analysis (MIS-TSBA version 4.10; MIDI, Inc., Newark, DE) that showed that the isolates were highly similar (similarity = 0.922 or greater) to Pseudomonas syringae. Amplification of repetitive bacterial sequences (rep-PCR) using the BOXA1R primer and the polymerase chain reaction resulted in identical banding patterns for the rutabaga isolates and the P. syringae pv. alisalensis pathotype strain. Pathogenicity was demonstrated by growing inocula of six isolates in nutrient broth shake cultures for 48 h (24°C), adjusting the bacterial suspension to 106 CFU/ml, and misting the resulting suspensions onto rutabaga (cv. American Purple Top). Plants were enclosed in plastic bags for 24 h and then incubated in a greenhouse (24 to 26°C). Control plants were misted with sterile water and treated the same way. After 5 to 7 days, foliar symptoms similar to symptoms seen in the field developed on all inoculated plants, and reisolated bacteria were characterized and found to be P. syringae pv. alisalensis. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. To our knowledge, this is the first report of commercially grown rutabaga as a host of P. syringae pv. alisalensis and the first report of a B. napus host of this pathogen. This bacterial pathogen has previously been reported on commercial plantings of arugula (Eruca sativa), broccoli (Brassica oleracea var. botrytis), and broccoli raab (Brassica rapa var. rapa) in California and under experimental conditions it causes disease on additional hosts, including members of the Poaceae (1). References: (1) N. A. Cintas et al. Plant Dis. 86:992, 2002. (2) R. A. Lelliott. J. Appl. Bacteriol. 29:470, 1966.

scholarly journals First Report of Bacterial Blight of Romanesco Cauliflower (Brassica oleracea var. botrytis) Caused by Pseudomonas syringae pv. alisalensis in California

Plant Disease ◽  
2006 ◽  
Vol 90 (12) ◽  
pp. 1551-1551 ◽  
Author(s):  
S. T. Koike ◽  
K. Kammeijer ◽  
C. T. Bull ◽  
D. O'Brien
Keyword(s):  
Brassica Oleracea ◽  
Pseudomonas Syringae ◽  
Bacterial Pathogen ◽  
Acid Methyl Ester ◽  
Hypersensitive Reaction ◽  
Bacterial Suspension ◽  
First Report ◽  
Plastic Bags ◽  
Initial Symptoms ◽  
Infested Field

In 2005, a new disease was detected on commercial, organically grown romanesco (green) cauliflower (Brassica oleracea var. botrytis) grown in San Benito County, California. Initial symptoms consisted of small (1 to 2 mm in diameter), angular, water-soaked flecks. These flecks developed into tan-to-gray, angular lesions measuring as much as 5 mm in diameter. Lesions were usually surrounded by chlorotic borders. Coalescing lesions caused the leaf to turn papery in texture and have a blighted appearance. A blue-green fluorescing pseudomonad was consistently isolated from lesions on King's medium B. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Samsun). These data indicated that the bacteria belonged to Lelliot's LOPAT group 1 (2). This was confirmed with data from fatty acid methyl ester analysis (MIS-TSBA version 4.10, MIDI, Inc., Newark, DE), which showed that the strains were highly similar (similarity = 0.921 or greater) to Pseudomonas syringae. Amplification of repetitive bacterial sequences (rep-PCR) using the BOXA1R primer and the polymerase chain reaction resulted in identical banding patterns for the romanesco strains and the P. syringae pv. alisalensis pathotype strain. Pathogenicity was demonstrated by growing inoculum of six strains in nutrient broth shake cultures for 48 h (24°C), adjusting the bacterial suspension to 106 CFU/ml, and spraying the resulting suspension onto green cauliflower (cv. Romanesco Precoce). Plants were enclosed in plastic bags for 24 h and then incubated in a greenhouse (24 to 26°C). Control plants were misted with sterile water and treated the same way. After 5 days, foliar symptoms identical to symptoms seen in the field developed on all inoculated plants, and reisolated strains were characterized and found to be identical to P. syringae pv. alisalensis by the tests described above. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. To our knowledge, this is the first report of commercially grown romanesco green cauliflower as a host of P. syringae pv. alisalensis. The infested field had approximately 30% of the plants affected, with perhaps 10% sustaining some crop loss. This bacterial pathogen has previously been reported on commercial plantings of arugula (Eruca sativa), broccoli (Brassica oleracea var. botrytis), and broccoli raab (Brassica rapa var. rapa) and under experimental (greenhouse) conditions causes disease on additional hosts, including members of the Poaceae (1). References: (1) N. A. Cintas et al. Plant Dis. 86:992, 2002. (2) R. A. Lelliott. J. Appl. Bacteriol. 29:470, 1966.

scholarly journals A New Bacterial Leaf Spot Disease of Broccolini, Caused by Pseudomonas syringae pathovar maculicola, in California

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1207-1207 ◽  
Author(s):  
N. A. Cintas ◽  
C. T. Bull ◽  
S. T. Koike ◽  
H. Bouzar
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Similarity Index ◽  
Acid Methyl Ester ◽  
Hypersensitive Reaction ◽  
Nutrient Broth ◽  
Leaf Spot Disease ◽  
Fluorescent Pseudomonad ◽  
Bacterial Leaf Spot ◽  
Initial Symptoms

In 1998, a new disease was detected on 3-week-old commercial broccolini (Brassica oleracea L. var. botrytis × B. alboglabra) transplants in a Salinas Valley, Monterey County, CA greenhouse. Initial symptoms were small (2 to 4 mm diameter) circular to angular, water-soaked spots. As the disease progressed, spots remained relatively small, but turned tan to brown. When diseased tissues were macerated and streaked on King's medium B, a blue-green fluorescent pseudomonad was consistently isolated. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices, but induced a hypersensitive reaction on tobacco (Nicotiana tabacum L. ‘Turk’). Fatty acid methyl ester analysis (MIS-TSBA, version 4.10, MIDI Inc., Newark, DE) indicated that strains had a high similarity index (0.82 or higher) to Pseudomonas syringae, and GN (version 3.50, Biolog, Inc., Hayward, CA) profiles also identified strains as P. syringae. The bacterium associated with the disease, therefore, was identified as P. syringae van Hall. Pathogenicity was demonstrated by growing inoculum in nutrient broth shake cultures for 48 h, misting the broth cultures (1×106 CFU/ml) onto broccolini (cv. Aspabrock), and subjecting the plants to 48 h of high humidity. Control plants were misted with sterile nutrient broth. After 4 to 5 days in a greenhouse, leaf spot symptoms developed on all inoculated broccolini plants, and reisolated strains were characterized and found to be P. syringae. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. Repetitive sequence-based polymerase chain reaction using the BOXA1R primer resulted in identical banding patterns for the broccolini pathogen and for known isolates of P. syringae pv. maculicola from crucifers. In host range testing, P. syringae pv. maculicolawas pathogenic to broccolini plants. The broccolini isolates and P. syringae pv. maculicola isolates had the same pathogenicity results when crucifers and tomatoes were tested as hosts; broccoli and cauliflower (B. oleracea var. botrytis) were infected, and tomato results were variable. These tests suggest that the broccolini pathogen is the bacterial leaf spot pathogen, Pseudomonas syringae pv. maculicola, that occurs on broccoli and cauliflower transplants (1). To our knowledge, this is the first report of this pathogen causing a disease on commercially grown broccolini. Reference: (1) S. T. Koike et al. Plant Dis. 82:727, 1998.

scholarly journals Bacterial Blight, a New Disease of Broccoli Caused by Pseudomonas syringae in California

Plant Disease ◽  
2000 ◽  
Vol 84 (3) ◽  
pp. 370-370 ◽  
Author(s):  
S. T. Koike ◽  
N. A. Cintas ◽  
C. T. Bull
Keyword(s):  
Pseudomonas Syringae ◽  
Bacterial Blight ◽  
Acid Methyl Ester ◽  
Hypersensitive Reaction ◽  
Nutrient Broth ◽  
New Disease ◽  
Initial Symptoms ◽  
Salinas Valley ◽  
Bacterial Blight Pathogen ◽  
Dark Green

In 1998 and 1999, a new disease was detected in commercial broccoli (Brassica oleracea var. botrytis) grown in the Salinas Valley, Monterey County, CA. Initial symptoms consisted of large, water-soaked, dark green, angular leaf sections that were bordered by major leaf veins. Diseased areas were as large as 10 × 3 cm. As the disease developed, affected areas turned tan and papery, and leaf margins sometimes became tattered. The numerous small (<1 cm diameter), round to angular spots that also were present retained their size and did not develop into larger lesions. A blue-green fluorescing pseudomonad was consistently isolated from both types of lesions on King's medium B. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction in tobacco (Nicotiana tabacum L. ‘Turk’). Fatty acid methyl ester analysis (MIS-TSBA version 4.10, MIDI, Inc., Newark, DE) indicated that the strains were highly similar (similarity ≥0.843) to Pseudomonas syringae. Biolog GN (version 3.50, Biolog, Inc., Hayward, CA) profiles also identified the strains as P. syringae. Therefore, the bacterium associated with the disease was identified as P. syringae. Pathogenicity of 13 strains was demonstrated by greenhouse tests. The strains were grown as nutrient broth shake cultures for 48 h at 24°C, diluted to 106 CFU/ml, and misted onto broccoli (cvs. Patriot and Titleist) and broccoli raab (B. rapa subsp. rapa cv. Spring). Control plants were misted with sterile nutrient broth. After 4 to 5 days in a greenhouse (24 to 26°C), large angular leaf lesions developed on all inoculated broccoli and broccoli raab plants. Strains were reisolated from symptomatic tissue and identified as P. syringae. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. Unlike most P. syringae strains, those isolated from broccoli were sensitive to a bacteriophage recovered from a P. syringae pathovar that infects broccoli raab. These results suggest that the broccoli pathogen may be related to the bacterial blight pathogen of broccoli raab (1). This is the first report of this pathogen causing a disease on commercially grown broccoli. Reference: (1) S. T. Koike et al. Plant Dis. 82:727, 1998.

scholarly journals First Report of Pseudomonas viridiflava Causing a Bacterial Blight of Artichoke Bract Leaves

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1223-1223 ◽  
Author(s):  
P. F. Sarris ◽  
E. A. Trantas ◽  
E. Mpalantinaki ◽  
F. N. Ververidis ◽  
S. E. Gouma ◽  
...  
Keyword(s):  
Hypersensitive Reaction ◽  
Bacterial Suspension ◽  
Biochemical Tests ◽  
First Report ◽  
Fluorescent Pigment ◽  
Initial Symptoms ◽  
Pseudomonas Viridiflava ◽  
Dark Green ◽  
Pith Necrosis ◽  
Reference Strains

In 2006, a disease was observed on two artichoke (Cynara scolymus L. cv. Lardati) fields in Crete, Greece, covering ~2 ha. Symptoms developed after several days of rainy and windy weather and >70% of capitula were affected, resulting in unmarketable produce. Initial symptoms were water-soaked, dark green spots on bracts with many sunken, necrotic, often elongated lesions, each with a brown-black center and surrounded by a water-soaked halo with a dark red-brown margin. Symptoms were more severe on inner bracts. Isolations from symptomatic, surface-disinfected bracts onto King's B agar medium (KB) consistently yielded yellow bacterial colonies that produced a green-blue fluorescent pigment. Ten selected artichoke isolates, all gram-negative, presented the LOPAT profile (- - + - +) and were levan negative, oxidase negative, potato rot positive, arginine dihydrolase negative, and showed tobacco hypersensitive reaction. All isolates used L-arabinose, D(-)-tartrate, and L-lactate, but not sucrose, L(+)-tartrate, or trigonelline. Results were identical to those obtained with the reference strain of Pseudomonas viridiflava NCPPB 1249 (3), and strains PV3005 and PV3006 from eggplant (1). Based on these biochemical tests, 10 isolates were identified as P. viridiflava group II members of the LOPAT determinative scheme of Lelliott (1,2). Two artichoke isolates (PV608 and PV609) were selected for molecular characterization. The identity and phylogenetic analysis were determined by multilocus sequence typing with the gyrB, rpoD, and rpoB genes (PV608 Accession Nos. JN383375, JN383363, and JQ267546; PV609 Accession Nos. JN383376, JN383364, and JQ267547). BLAST searches showed highest nucleotide sequence identity (96%) with GenBank sequences of P. viridiflava reference strains NCPPB 963 and CFBP 2107. Pathogenicity of 10 artichoke isolates and reference strains was tested twice on detached capitulum bracts of artichoke cv. Lardati, as well as 4-week-old tomato plants of cv. ACE, and Chrysanthemum indicum cv. Reagan plants. Each isolate was inoculated onto 10 bracts by placing 15 μl of bacterial suspension (5 × 106 CFU/ml) of a 48-h culture in KB broth on the surface of the bract, and pricking the bract through the drop of bacterial suspension with a sterile needle. Each isolate was also inoculated onto five tomato and five chrysanthemum plants by dipping a sterile toothpick in the appropriate bacterial culture and pricking the surface of the stem. Ten control plants were inoculated similarly with sterile, distilled water. Inoculated bracts and plants were kept in boxes lined with moist filter paper at 25 to 30°C and 80 to 100% relative humidity. Lesions developed on detached bracts within 72 h and were similar to those observed on the naturally infected plants. On tomato and chrysanthemum plants, pith necrosis and wilting symptoms were induced within 1 week of inoculation. Symptoms were not observed on control bracts and plants. Bacterial colonies were reisolated from bract lesions and stems with pith necrosis, but not from control plants, and the reisolates had the same LOPAT profile as the original isolates of P. viridiflava, thus fulfilling Koch's postulates. To our knowledge, this is the first report in the world of P. viridiflava causing a disease of artichoke bracts. References: (1) D. E. Goumas et al. Eur. J. Plant Pathol. 104:181, 1998. (2) Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (3) M. L. Saunier et al. Appl. Environ. Microbiol. 62:2360, 1996.

scholarly journals Pseudomonas syringae Leaf Blight, a New Disease of Kalmia latifolia

Plant Disease ◽  
1998 ◽  
Vol 82 (10) ◽  
pp. 1171-1171
Author(s):  
M. L. Putnam
Keyword(s):  
Pseudomonas Syringae ◽  
Acid Methyl Ester ◽  
Leaf Blight ◽  
Bacterial Suspension ◽  
Agar Culture ◽  
Kalmia Latifolia ◽  
Plastic Bags ◽  
Biolog System ◽  
Young Leaves ◽  
Affected Tissue

In spring and fall of 1997, and in February 1998, Kalmia latifolia cv. Olympic Fire plants with severe leaf blight symptoms were submitted to the Oregon State University Plant Clinic from a commercial nursery. The primary symptom was a dark purple leaf blight, often associated with the leaf mid-rib. Disease progressed down the petioles and into twigs, causing blackening of affected tissues and leaf drop. Abundant bacterial streaming was observed oozing from the margins of affected tissue when examined at ×100. Isolations from affected tissues were made onto King's medium B (KB). A fluorescent bacterium was recovered and identified as Pseudomonas syringae by the Biolog system of identification. Identity was confirmed by fatty acid methyl ester analysis performed by Larry Barnes (Texas A&M University, College Station). Attempts to determine the pathovar were unsuccessful. A single colony isolate of the bacterium was raised on KB. Koch's postulates were completed by the following procedures. A bacterial suspension was made from a 24-h-old agar culture of this isolate with phosphate buffer with 0.2% gelatin (PBG). The concentration of the suspension was adjusted to 8 × 107 cells per ml by direct enumeration. Five milliliters of the suspension was atomized onto young leaves on six twigs of Kalmia latifolia. Controls consisted of young leaves on four twigs atomized with 5 ml of PBG. Twigs receiving the inoculum or the PBG were enclosed in plastic bags and maintained at room temperature near a north-facing window. Symptoms appeared 6 days later: dark purple spots on the margins of inoculated leaves and blight symptoms near the leaf mid-rib. Symptoms did not appear on PBG-sprayed leaves. Pseudomonas syringae was successfully reisolated from surface-disinfested inoculated leaves but not from leaves sprayed with PBG. This is the first report of Pseudomonas syringae causing a leaf blight of Kalmia.

scholarly journals First Report of Bacterial Blight of Mulberries Caused by Pseudomonas syringae pv. mori in the Eastern Anatolia Region of Turkey

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
F. Sahin ◽  
R. Kotan ◽  
M. F. Dönmez
Keyword(s):  
Pseudomonas Syringae ◽  
Bacterial Blight ◽  
Disease Incidence ◽  
Similarity Index ◽  
Acid Methyl Ester ◽  
Central Anatolia ◽  
Eastern Anatolia ◽  
First Report ◽  
Fame Analysis ◽  
Initial Symptoms

During spring 1999, a severe bacterial blight disease was observed on white mulberry (Morus alba L.) trees grown in the Erzincan, Erzurum, and Artvin provinces in the eastern Anatolia region of Turkey. Initial symptoms appeared as small, water-soaked spots on leaves and shoots. The spots eventually expanded and resulted in dark brown to black, elongated, stripe-like lesions on shoots. Diseased leaves wilted at the twig tips and later died. Disease incidence was close to 100% in the regions surveyed. Fluorescent bacteria were isolated consistently from lesions on diseased leaves and shoots on King's medium B. Morphological and biochemical characteristics of 16 presumptive strains tested were rod-shaped, aerobic, gram negative, oxidase negative, and catalase and levan positive. None of the strains reduced nitrate or hydrolyzed gelatin. All strains were confirmed as Pseudomonas syringae by gas-chromatography fatty acid methyl ester (GC-FAME) analysis, with a similarity index ranging from 0.82 to 0.94. The pathogen was identified as P. syringae pv. mori based on pathogenicity tests performed by spray-inoculating healthy leaves (M. alba cv. Beyaz Dut) on 1-year-old host twigs with suspensions of 108 CFU/ml each strain (2). Inoculated plants and sterile water-sprayed controls were maintained in a greenhouse at 18 to 28°C. Plants were covered with polyethylene bags for 48 h after inoculation. Within 7 to 10 days, necrotic spots typical of those found in the nursery were observed on inoculated leaves. No symptoms were seen on control plants. The pathogen was reisolated from lesions on inoculated leaves. Recovered strains were identical to initial strains, based on morphological and biochemical tests and GC-FAME analysis. To our knowledge, the occurrence and incidence of this disease in different geographic regions of Turkey, except the central Anatolia and Aegean regions, have not been studied (1). This is the first report of bacterial blight of mulberries at high incidence in the eastern Anatolia region of Turkey. References: (1) K. Türkolu and Y. E. Öktem. Plant Prot. Bull 13:19, 1973. (2) J. M. Young et al. N. Z.J. Agric. Res. 21:159, 1978.

scholarly journals First Report of Bacterial Blight of Strelitzia augusta Caused by Pseudomonas syringae pv. lachrymans

Plant Disease ◽  
2005 ◽  
Vol 89 (9) ◽  
pp. 1010-1010 ◽  
Author(s):  
G. Polizzi ◽  
I. Castello ◽  
G. Parlavecchio ◽  
G. Cirvilleri
Keyword(s):  
Pseudomonas Syringae ◽  
Cross Sections ◽  
Plate Count ◽  
Bacterial Suspension ◽  
First Report ◽  
Small Water ◽  
Plate Count Agar ◽  
Leaf Spots ◽  
Initial Symptoms ◽  
Pathogenicity Tests

White bird of paradise tree (Strelitzia augusta Thunb.), originally from South Africa, is a tender perennial cultivated as an ornamental plant and is used in gardens in Italy. During February of 2004, a new blight disease was noticed on potted S. augusta at different ages (6 months to 4 years) in several commercial nurseries of eastern Sicily. Field inspections revealed disease incidences as high as 40%. Initial symptoms were small, water-soaked leaf spots that expanded throughout the veins in dark brown streaks. Stem cross sections revealed browning of the vascular tissues, which might involve the entire stem. In some cases, the necrosis extended to the apical bud, causing death of the plant. Thirty explants from infected tissues were washed in sterile water and plated on plate count agar (PCA) from which two types of bacterial colonies were consistently isolated. Pathogenicity tests were performed on S. augusta plants. Twenty-four plants were inoculated (12 per bacterial isolate) using two different procedures: spray with a bacterial suspension (106 CFU/ml) and wounding with an infected needle on the midribs. The same number of noninoculated plants was used as controls. All plants were maintained at 24 to 26°C with 95 to 100% relative humidity until symptoms occurred 4 days later. Just one of the two tested bacterial types was pathogenic. The symptoms were similar to those previously observed in the field. No symptoms were observed in the plants spray inoculated with the bacterial suspension, proving that the bacteria were unable to infect in the absence of a wound. The controls showed no symptoms. Koch's postulates were fulfilled by the reisolation of the infective strain which was sent to the CBS (Centraalbu-reau voor Schimmelcultures) and identified as Pseudomonas syringae pv. Lachrymans/pisi using the Biolog MicroLog3 4.01C program (Biolog Inc., Hayward, CA). Further pathogenicity tests have been carried out on zucchini and pea pods to characterize the pathovar using 48SR1 of P. syringae pv. syringae and B4 of P. syringae pv. pisi as reference strains. Necrotic, sunken, water-soaked spots surrounded by a chlorotic halo, reported in the literature as typical symptoms of P. syringae pv. lachry-mans (Smith & Bryan) Young, Dye & Wilkie (1), were observed on zucchini when inoculated with our strain. Our P. syringae strain did not cause the typical symptoms of P. syringae pv. pisi on inoculated pea pods. The results of the pathogenicity tests and the inability of the P. syringae strain isolated from S. augusta to utilize homoserine, used to discriminate pv. pisi from other pathovars of P. syringae, allowed us to identify the strain as P. syringae pv. lachrymans. Low temperature damage and late transplant may have promoted the spread of the disease in the nurseries. Under these conditions, the economic importance of this disease for the crop can be considered high. To our knowledge, this is first report of P. syringae pv. lachrymans on S. augusta. Reference: (1) K. Pohronezny et al. Plant Dis. Rep. 62:306, 1978.

scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Gupta ◽  
N. Bharat ◽  
A. Chauhan ◽  
A. Vikram
Keyword(s):  
Host Range ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Molecular Techniques ◽  
Bacterial Suspension ◽  
Leaf Spot Disease ◽  
Rrna Gene ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

scholarly journals First Report of Acidovorax avenae subsp. citrulli as a Pathogen of Cucumber

Plant Disease ◽  
1999 ◽  
Vol 83 (10) ◽  
pp. 965-965 ◽  
Author(s):  
H. L. Martin ◽  
R. G. O'Brien ◽  
D. V. Abbott
Keyword(s):  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Cucumis Sativus L ◽  
First Report ◽  
Plastic Bags ◽  
Initial Symptoms ◽  
Leaf Surfaces ◽  
Commercial Crop ◽  
Slow Growing ◽  
Dead Tissue

In March 1999, a foliar bacterial disease was observed in a commercial crop of cucumber (Cucumis sativus L.) cv. Jetset in Gumlu in northern Queensland, Australia. Initial symptoms consisted of angular, chlorotic, water-soaked lesions that later dried to necrotic areas of light brown, dead tissue. White bacterial ooze was commonly found on the undersides of young water-soaked lesions. Lesions were delimited by veins and distributed uniformly over leaf surfaces, and more than 20% of the crop was affected. No symptoms were observed on plant stems or fruits. Bacterial streaming from the edges of freshly cut young lesions was clearly visible in a droplet of water under ×100 magnification in the laboratory. Isolations were made from young lesions on King's medium B (1). A slow-growing, white, gram-negative, nonfluorescent bacterium was consistently isolated. Three isolates of the bacterium were identified, using the Biolog software program (Biolog, Hayward CA), and in each instance, the bacterium was confirmed as Acidovorax avenae subsp. citrulli, with a similarity of >0.80. Koch's postulates were completed with 8-day-old glasshouse-grown cucumber (cv. Jetset) seedlings. Seedlings were misted until runoff with a bacterial suspension of 3 × 108 CFU/ml and enclosed in plastic bags for ≈30 h at 22°C. Water-soaked lesions were observed on cucumber cotyledons 4 days after inoculation. This is the first report of A. avenae subsp. citrulli as a pathogen of cucumber. Reference: (1) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954.

scholarly journals First Report of Bacterial Wilt Caused by Ralstonia solanacearum on Plectranthus amboinicus in Martinique

Plant Disease ◽  
2021 ◽  
Author(s):  
Peninna Deberdt ◽  
Gilles Cellier ◽  
Régine Coranson-Beaudu ◽  
Mathis Delmonteil--Girerd ◽  
Joanye Canguio ◽  
...  
Keyword(s):  
Bacterial Wilt ◽  
Ralstonia Solanacearum ◽  
Disease Incidence ◽  
Bacterial Suspension ◽  
Diagnostic Pcr ◽  
Tomato Plants ◽  
First Report ◽  
Initial Symptoms ◽  
Plectranthus Amboinicus ◽  
Negative Controls

Plectranthus amboinicus, commonly known as Gwo ten in the French West Indies (Martinique), is a semi-succulent perennial plant of the Lamiaceae family. This aromatic plant wich is widespread naturally throughout the tropics is of economic importance because of the therapeutic and nutritional properties attributed to its natural phytochemical compounds wich are highly valued in the pharmaceutical industry. In March 2019, wilted P. amboinicus plants intercropped with tomato plants (cv. Heatmaster) in order to reduce the insect-pest damages on tomato, were observed in a field located at the CIRAD experimental station in Lamentin, Martinique (14.663194 N, -60.999167 W). Average disease incidence of 65.74% was recorded on P. amboinicus, in 3 plots with an area of 22.04 m2. The initial symptoms observed were irregular, black, necrotic lesions on leaves. After 10 days, plants wilted and black stripes were observed on stems. Within 4 weeks, more than 50% of plants were fully wilted. Longitudinal stem sections of the wilted plants showed brown vascular discoloration. The cut stems of the wilted plants released a whitish bacterial ooze in water. In all, 108 stem sections were collected, surface disinfected with 70% ethanol and each was crushed in 2 mL of Tris-buffer, then processed for bacterial isolation by plating on modified Semi-Selective Medium from South Africa SMSA (Engelbrecht 1994). Typical Ralstonia solanacearum colonies grew on SMSA medium for 100 of the 108 samples after incubation for 48h at 28°C and were identified as Ralstonia solanacearum using diagnostic PCR with 759/760 primers (Opina et al. 1997). A phylotype-specific multiplex PCR (Fegan and Prior 2005) classified all the strains in R. solanacearum Phylotype IIA. A subset of 11 strains was selected for sequevar identification. All the strains were identified as sequevar I-39 (100% nucleotide identity with strain ANT92 - Genbank accession EF371828), by partial egl sequencing (Fegan and Prior 2005) (GenBank Accession Nos. MT314067 to MT314077). This sequevar has been reported to be widespread in the Caribbean and tropical America on vegetable crops (particularly on tomato), but not on P. amboinicus (Deberdt et al. 2014; Ramsubhag et al. 2012; Wicker et al. 2007). To fulfil Koch’s postulates, a reference strain, isolated from diseased P. amboinicus (CFBP 8733, Phylotype IIA/sequevar 39), was inoculated on 30 healthy P. amboinicus plants. A common tomato cultivar grown in Martinique (cv. Heatmaster) was also inoculated on 30 plants with the same bacterial suspension. Three-weeks-old plants of both crops grown in sterilized field soil were inoculated by soil drenching with 20 ml of a calibrated suspension (108 CFU/mL). P. amboinicus and tomato plants drenched with sterile water served as a negative controls. Plants were grown in a fully controlled environment at day/night temperatures of 30–26°C ± 2°C under high relative humidity (80%). The P. amboinicus plants started wilting 9 days after inoculation, and within four weeks 60% of the P. amboinicus plants had wilted. The tomato plants started wilting 5 days after inoculation with 62% of wilted plants within four weeks. R. solanacearum was recovered from all symptomatic plants on modified SMSA medium. No symptoms were observed and no R. solanacearum strains were isolated from negative controls plants. To our knowledge, this is the first report of R. solanacearum causing bacterial wilt on Gwo ten (P. amboinicus) in Martinique. The importance of this discovery lies in the reporting of an additional host for R. solanacearum, which can be associated with other crops as tomato crop in order to reduce the abundance of insect-pests. Further studies need to be conducted to assess the precise distribution of bacterial wilt disease on P. amboinicus in Martinique and to develop a plan of action avoiding its association with R. solanacearum host crops as tomato for reducing epidemic risk.

Sign in / Sign up

Export Citation Format

Share Document