First Report of Neofusicoccum nonquaesitum Causing Branch Cankers on Giant Sequoia (Sequoiadendron giganteum) in North America

Between 2001 and 2007, samples from three California native plants showing canker symptoms were submitted to the California Department of Food and Agriculture's Plant Pest Diagnostics laboratory. Giant sequoia (Sequoiadendron giganteum) and coast redwood (Sequoia sempervirens) showed branch cankers and dieback, whereas tanoak (Lithocarpus densiflora) had bleeding bole cankers. Samples were collected from mature trees in private landscapes in El Dorado, Sacramento, and Alameda counties in California. A fungus was isolated on one-half strength acidified potato dextrose agar (APDA) from the canker margins of all three hosts. Colonies were moderately fast growing, initially white, later turning olivaceous black. Pycnidia developed singly or in small groups and contained conidia that measured 18 to 29 × 6 to 8 μm (average 21.5 × 6.8 μm). Conidia were aseptate, hyaline, and fusiform, with truncate bases. rDNA sequences of the internal transcribed spacer (ITS) region of the isolates (GenBank JQ282157 through JQ282159), amplified using primers ITS1 and ITS4 (2), were 100% identical to the holotype isolate of Neofusicoccum nonquaesitum Inderb., Trouillas, Bostock & Michailides (1) by a BLAST query (GenBank GU251163). Pathogenicity of the N. nonquaesitum isolate from giant sequoia (CDFA4) was tested on five saplings using cultures grown on APDA for 14 days. A single wound was made approximately 2 cm above the soil line on the cambium of each plant using a 3-mm cork borer. One 3-mm colonized agar plug was placed on each wound and secured with Parafilm. Plugs of APDA were placed onto wounds of five plants as controls. All plants were kept in a growth chamber at 23°C with a 12-h photoperiod. After 4 days, Parafilm was removed to reveal dark brown cankers measuring 12 to 43 mm long on the inoculated plants. Fourteen days after inoculation, cankers were black, sunken, and measured 79 to 117 mm (average 91.4 mm) long. Most of the inoculated plants were wilted with chlorotic to necrotic foliage. Mature pycnidia with cirri developed in most of the cankers. N. nonquaesitum was reisolated on APDA from all of the cankers. No symptoms developed on the control plants. The experiment was repeated once with similar results. Botryosphaeria dothidea, also in the Botryosphaeriaceae, has been reported to cause similar cankers on giant sequoia and coast redwood in California (3). However, rDNA sequencing of the ITS region of this isolate obtained from the American Type Culture Collection (ATCC 60344) (GenBank JQ284384) showed it matched the type specimen of Neofusicoccum australe (GenBank GU251219), not our isolate. To our knowledge, this is the first report of N. nonquaesitum as a pathogen of giant sequoia in North America. This study expands the host range of N. nonquaesitum from almond (Prunus dulcis), California bay (Umbellularia californica), and blueberry (Vaccinium spp.) (1) to include giant sequoia, coast redwood, and tanoak, which are economically important trees in California forests and landscapes. References: (1) P. Inderbitzin et al. Mycologia 102:1350, 2010. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990. (3) J. J. Worrall et al. Plant Dis. 70:757, 1986.

Download Full-text

First Report of Leaf Smut of Gaillardia × grandiflora Caused by Entyloma gaillardianum in North America

Plant Health Progress ◽

10.1094/php-2010-0428-01-br ◽

2010 ◽

Vol 11 (1) ◽

pp. 51 ◽

Cited By ~ 3

Author(s):

Dean A. Glawe ◽

Tess Barlow ◽

Steven T. Koike

Keyword(s):

North America ◽

Leaf Spot ◽

Its Region ◽

Morphological Features ◽

Causal Agent ◽

Leaf Spot Disease ◽

First Report ◽

Spot Disease ◽

Leaf Smut

In the summer of 2009, a leaf spot disease occurred on 100% of Gaillardia × grandiflora cv. Goblin in a commercial nursery in coastal Monterey Co., CA. Nearly all of the affected plants were unsalable. The causal agent was determined to be Entyloma gaillardianum based on morphological features, host, and ITS region. This species has not been reported previously from this host in North America. Accepted for publication 16 March 2010. Published 28 April 2010.

Download Full-text

First Report of Powdery Mildew of Platanus occidentalis Caused by Erysiphe platani in Korea

Plant Disease ◽

10.1094/pdis-10-12-0982-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 843-843 ◽

Cited By ~ 2

Author(s):

Y. J. La ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

North America ◽

Powdery Mildew ◽

Its Region ◽

The United States ◽

Control Measures ◽

Base Substitution ◽

Width Ratio ◽

First Report ◽

Platanus Occidentalis ◽

Young Leaves

Platanus occidentalis L., called American sycamore or American plane, is native to North America. The trees are commonly planted throughout the world on the sides of roads and in parks. In June 2012, diseased leaves exhibiting signs of powdery mildew from a park in Daegu City of Korea were sent to Plant Clinic of Seoul National University for diagnosis. Our observations in Daegu City during September and October 2012 showed that nearly 99% of the approximately 1,000 trees surveyed were infected with a powdery mildew. Voucher specimens (n = 6) were deposited at the Korea University Herbarium (KUS). Symptoms were characterized by chlorosis, distortion, or cupping of young leaves. White superficial colonies developed amphigenously on leaves. Hyphae were flexuous to straight, branched, septate, 4 to 7 μm wide, and had lobed appressoria. Conidiophores were 120 to 350 × 5 to 7.5 μm and produced conidia singly. Foot-cells of conidiophores were straight, cylindric, and 115 to 200 μm long. Conidia were hyaline, ellipsoid-ovoid, measured 33 to 47.5 × 17.5 to 29 μm with a length/width ratio of 1.5 to 2.0, lacked distinct fibrosin bodies, and showed reticulate wrinkling of the outer walls. Germ tubes were produced on the subterminal position of conidia. No chasmothecia were observed. The structures and measurements were compatible with those of the anamorphic state of Erysiphe platani (Howe) U. Braun & S. Takam. (1). To confirm the identification, the complete internal transcribed spacer (ITS) region of the rDNA from isolate KUS-F26959 was amplified with nested PCR and sequenced. The resulting sequence of 625 bp was deposited in GenBank (Accession No. JX997805). A GenBank BLAST search of this sequence showed only one base substitution with the four sequences (JQ365940 to JQ365943) of E. platani on Platanus spp. Pathogenicity was confirmed through inoculation tests by gently pressing diseased leaves onto young leaves of three 2-year-old disease-free seedlings. Three non-inoculated plants were used as control. Plants were maintained in a greenhouse at 24 to 30°C. Inoculated leaves developed symptoms after 7 days, whereas the control plants remained symptomless. The fungus present on the inoculated leaves was morphologically identical to that observed on the original diseased leaves, fulfilling Koch's postulates. Since E. platani first was recorded in the United States in 1874, it has been regarded as endemic in North America. From the second half of the 20th century, introduction and expansion of the range of this fungus to South America, South Africa, Australia and New Zealand, Europe, and Asia have been reported (1,2). To our knowledge, this is the first report of E. platani infections of P. occidentalis in Korea. This species was recorded on P.× hispanica from Japan in 1999 (4) and on P. orientalis from China in 2006 (3), suggesting invasive spread of the sycamore powdery mildew in East Asia. Since American sycamores are widely planted in Korea, control measures should be made to prevent further spread of the disease. References: (1) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No.11. CBS, Utrecht, 2012. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved October 22, 2012. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) S, Tanda. J. Agric. Sci., Tokyo Univ. Agric. 43:253, 1999.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America

Plant Disease ◽

10.1094/pdis-94-2-0279b ◽

2010 ◽

Vol 94 (2) ◽

pp. 279-279 ◽

Cited By ~ 1

Author(s):

A. M. Minnis ◽

A. Y. Rossman ◽

D. L. Clement ◽

M. K. Malinoski ◽

K. K. Rane

Keyword(s):

North America ◽

Powdery Mildew ◽

Dna Sequence ◽

Sequence Data ◽

Its Region ◽

Podosphaera Leucotricha ◽

First Report ◽

Pyrus Calleryana ◽

Dna Sequence Data ◽

Callery Pear

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

Download Full-text

Neofusicoccum parvum, a New Agent of Sequoia Canker and Dieback Identified in Geneva, Switzerland

Forests ◽

10.3390/f12040434 ◽

2021 ◽

Vol 12 (4) ◽

pp. 434

Author(s):

Martine Haenzi ◽

Bastien Cochard ◽

Romain Chablais ◽

Julien Crovadore ◽

François Lefort

Keyword(s):

Pure Culture ◽

Lake Area ◽

Koch’S Postulates ◽

Neofusicoccum Parvum ◽

Rdna Sequencing ◽

Giant Sequoia ◽

Sequoiadendron Giganteum ◽

Pure Cultures ◽

Fusicoccum Aesculi ◽

Koch's Postulates

Fungi were isolated in pure cultures from decaying giant sequoias in Geneva (Switzerland). Isolates were genetically identified by ITS rDNA sequencing. Young giant sequoia trees were artificially infected with a pure culture of Botryosphaeria parva. Henle-Koch’s Postulates demonstrated that Botryosphaeria parva was pathogenic to Sequoiadendron giganteum. When analysing the microorganisms associated to canker and dieback symptoms in a giant sequoias (Sequoiadendron giganteum) in Geneva, the fungus Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips, teleomorph Botryosphaeria parva (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips, was isolated, whereas such symptoms are commonly associated to Fusicoccum aesculi (teleomorph Botryosphaeria dothidea). These two fungal species belong to the same genus Botryosphaeria of the Botryosphaeriaceae family. Because Neofusicoccum parvum was causing cankers and diebacks in other woody species around the world, we extended the analysis to other trees displaying sequoia dieback symptoms in order to evaluate the involvement of Neofusicoccum parvum in such increasing symptoms in sequoias in Geneva. Dried twigs, trunk, and branch cankers from diseased trees were sampled on several distinct sites. From all samples, isolated fungi in pure cultures showed a phenotype typical of Botryosphaeriaceae species. Isolates were then genetically identified at the species level. Subsequently Neofusicoccum parvum was inoculated to young giant sequoia trees, re-isolated in pure culture from provoked symptoms, and re-identified to fulfil Henle-Koch’s postulates. The identification confirmed that Neofusicoccum parvum was present on all sites, while Fusicoccum aesculi was retrieved only once alone. The inoculation of Neofusicoccum parvum isolates on young sequoias demonstrated for the first time that this fungus was able to develop cankers in Sequoiadendron gigantean. Neofusicoccum parvum could, therefore, be the major cause for dying of giant sequoias in the Geneva Lake area.

Download Full-text

First Report of Curvularia eragrostidis Causing Postharvest Rot on Pineapple in Brazil

Plant Disease ◽

10.1094/pdis-03-14-0288-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1277-1277 ◽

Cited By ~ 4

Author(s):

A. P. S. Ferreira ◽

D. B. Pinho ◽

A. R. Machado ◽

O. L. Pereira

Keyword(s):

Mechanical Damage ◽

Morphological Characteristics ◽

Its Region ◽

Longitudinal Section ◽

Culture Collection ◽

Ananas Comosus ◽

Single Spore ◽

First Report ◽

Agar Plug ◽

Postharvest Rot

Pineapple (Ananas comosus L. Merril.) is the main plant of the Bromeliaceae, cultivated economically for the fruits' appealing flavor and a refreshing sugar-acid balance. In 2013, fruits with no initially visible symptoms began to show a postharvest rot after 3 days in a market in the municipality of Viçosa, Minas Gerais, Brazil. The rot can rarely be detected from the outside of the fruit, but a longitudinal section allows observation of extension of the affected area toward the center of the fruit. The symptoms initially appear as a dark brown to black rot on surface of the fruits, which gradually enlarges in size, leading to increased rot and disposal of infected fruits. Until now, this disease occurred sporadically and caused small losses. A fungus was isolated from rot observed in fruits from cultivar Pérola and a single-spore culture was deposited in the culture collection of the Universidade Federal de Viçosa (Accession No. COAD 1588). After 7 days of incubation at 25°C, the strain displayed radial growth and gray-white to black colonies. Microscopic observations revealed brown to light brown conidiophores present singly or in groups. The septate, simple or rarely branched conidiophores are straight or curved, up to 245 μm long and 5 μm wide, and some have a geniculate growth pattern near the apex. The conidia are ellipsoidal or barrel-shaped and 22 to 25 μm long and 10 to 12.5 μm wide. The median septum appears as a black band and the cells at each end of the conidia are pale, whereas the intermediate cells are brown or dark brown. Based on morphological characteristics, the fungus was identified as Curvularia eragrostidis (4). To confirm this identification, DNA was extracted and sequences of the internal transcribed spacer (ITS), 28S and 18S rDNA regions were obtained and deposited in GenBank (Accession Nos. KJ541818 to KJ541820). The sequence of the ITS region exhibited 99% identity over 530 bp with other C. eragrostidis sequence in GenBank (JN943449) and Bayesian inference analysis placed our isolate in the same clade with others C. eragrostidis (study S15670 deposited in TreeBASE). Koch's postulates were conducted by inoculating six fruits of pineapple previously disinfected with 2% sodium hypochlorite and washed in sterile distilled water. For inoculation, the isolate was grown in potato dextrose agar (PDA) for 15 days at 25°C. Six millimeter diameter disks were removed from the surface of fruits with a sterile cork borer and replaced with PDA disks containing mycelia from the margins of the culture. An agar plug was deposited in three control fruits and all fruits were maintained at 25°C in plastic trays. Inoculated fruits showed symptoms 7 days after inoculation that were similar to those initially observed in the infected fruits, while control fruits showed no symptoms. C. eragrostidis is a cosmopolitan pathogen that infects hosts from several botanical families (2,4). In Brazil, this fungus causes leaf spot on A. comosus (3) and also infects Allium sativum, Dioscorea alata, D. cayenensis, Oryza sativa, Sorghum bicolor, Vigna unguiculata, and Zea mays (1). To our knowledge, this is the first report of C. eragrostidis causing postharvest rot disease in pineapple in Brazil. Because invasion of the fungus can occur through minute fractures, fruits should be carefully handled to avoid mechanical damage. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases , 18 February 2014. (2) D. S. Manamgoda et al. Fungal Divers. 51:3, 2011. (3) J. J. Ponte et al. Fitopatologia 10:21, 1975. (4) A. Sivanesan. Mycological Papers 158:113, 1987.

Download Full-text

First Report of Foliar Infection of Starflower by Phytophthora ramorum

Plant Disease ◽

10.1094/pdis.2003.87.5.599b ◽

2003 ◽

Vol 87 (5) ◽

pp. 599-599 ◽

Cited By ~ 11

Author(s):

D. Hüberli ◽

W. Van Sant-Glass ◽

J. G. Tse ◽

M. Garbelotto

Keyword(s):

Its Region ◽

Deionized Water ◽

Phytophthora Ramorum ◽

Santa Cruz ◽

Coast Redwood ◽

First Report ◽

Big Sur ◽

Zoospore Release ◽

Lithocarpus Densiflorus ◽

Water Plants

In March 2002, Phytophthora ramorum S. Werres & A.W.A.M. de Cock was isolated from pacific or western starflower (Trientalis latifolia Hook.), an herbaceous perennial of the Primulaceae family, at Castro Canyon in Big Sur, Monterey County, California. Affected leaves had numerous necrotic lesions >5 mm in diameter surrounded by a yellow halo, and the lesions coalesced with time. Isolates were identified as P. ramorum by the large chlamydospores, caduceus, semipapillate sporangia, and sequences of the internal transcribed spacer (ITS) region of the rDNA (1,2). The same symptoms were observed on starflower in a second location at the Soquel Demonstration Forest, Santa Cruz County. Although P. ramorum was not isolated from symptomatic leaves on the plants in Santa Cruz County, the ITS region of the pathogen was amplified and sequenced using P. ramorum-specific primers. Both sites were mixed forests of coast redwood (Sequoia sempervirens), bay laurel (Umbellularia californica), and tanoak (Lithocarpus densiflorus), which are confirmed hosts of P. ramorum. To test for pathogenicity to starflower, asymptomatic plants were carefully excavated from the two forest locations, replanted in 15-cm paper cups in the original forest soil, and the foliage was inoculated with zoospores of P. ramorum isolate Pr-52, an isolate used in previous inoculations. The zoospores were produced by placing agar disks (1 cm in diameter) from the margin of 8- to 14-day-old colonies growing on V8 juice agar into 20 to 30 ml of sterile deionized water in petri dishes. After 2 days incubation at 20°C in the dark, zoospore release was induced by placing dishes at 4°C for 20 min and then to room temperature for 45 to 60 min. Three hundred μl of the zoospore suspension (approximately 2 × 104 zoospores/ml) was poured into 500-μl modified microcentrifuge tubes in which tips of leaves of starflower were submerged. Control leaves were dipped in sterile deionized water. Plants were placed in a humid-chamber consisting of moist paper towels placed on the tray and covered with a clear-plastic lid that was sprayed with sterile water. The chambers were maintained at 20 to 24°C in the laboratory. Two or three leaves were inoculated, and one leaf was left as the control on each of seven or eight plants in two separate trials. In both trials, water-soaked lesions were observed on the leaves 12 h after inoculation with P. ramorum. At 8 or 11 days after inoculation, necrotic lesions were present on all inoculated leaves starting from the leaf tips. Lesions averaged 29 mm (range 13 to 39 mm) and 45 mm (range 31 to 56 mm) in length in the respective trials. Some lesions covered entire leaves. P. ramorum was reisolated on Phytophthora-selective agar medium (1) from the lesions in both trials. Control leaves had no lesions, and P. ramorum was not reisolated. Infection of starflower and other understory species appears to occur under infested tree hosts such as bay laurel, which is known as a source of inoculum for P. ramorum. To our knowledge, this is the first report of an herbaceous host for P. ramorum and the first report of the disease on the Primulaceae. Previously, only woody hosts were known. Starflower is unlikely to play a major role in the natural spread of the disease, but the pathogen may be spread via movement of plants through the horticultural industry. Furthermore, Trientalis spp. in Europe where P. ramorum is present may also be potential hosts. References: (1) D. M. Rizzo et al. Plant Dis. 86:205, 2002. (2) S. Werres et al. Mycol. Res. 105:1155, 2001.

Download Full-text

First Report of Brown Ring Patch Caused by Waitea circinata var. circinata on Poa annua in Pennsylvania

Plant Disease ◽

10.1094/pdis-93-9-0962a ◽

2009 ◽

Vol 93 (9) ◽

pp. 962-962

Author(s):

M. A. Fidanza ◽

S. J. McDonald ◽

F. P. Wong ◽

T. H. Mysliwiec ◽

R. M. Averell

Keyword(s):

Its Region ◽

Creeping Bentgrass ◽

Poa Annua ◽

Fungal Mycelium ◽

First Report ◽

Annual Bluegrass ◽

Bright Yellow ◽

Agar Plug ◽

Putting Green ◽

Waitea Circinata

In late May and early June of 2008, bright yellow, thin, irregular-shaped rings that were 10 to 15 cm in diameter were observed on 30% of an annual bluegrass (Poa annua L.) putting green in Coopersburg, PA. The 46-year-old silt-loam soil green was mowed at a 3.1-mm height and consisted of 80% annual bluegrass and 20% creeping bentgrass (Agrostis stolonifera L., unknown cultivar). During the appearance of ring symptoms, the overall minimum and maximum daily air temperature ranged from 19.9 to 31.1°C, respectively, along with 40.3 mm of total rain accumulation. In late May, only individual affected annual bluegrass plants exhibited a bright yellow chlorosis of upper and lower leaf blades and crown. By early June, affected annual bluegrass plants appeared dark brown and water soaked, turning reddish brown and then tan as they dessicated, wilted, and died. Fungal mycelium, similar in appearance to Rhizoctonia spp., was found among affected leaf blades and within the thatch layer. A single fungal isolate was obtained from affected annual bluegrass tissue and grown on potato dextrose agar (PDA) plus 0.1 g of chloramphenicol per liter. Fungal colony morphology and sequencing of the ITS1F/ITS4-amplified rDNA internal transcribed spacer (ITS) region confirmed the isolate as Waitea circinata var. circinata, with ≥90% similar homology match to published W. circinata var. circinata ITS sequences (GenBank Accession No. DQ900586) (2,4). To confirm pathogenicity, the isolate was inoculated onto 6-week-old annual bluegrass (0.001 g of surface-sterilized seed per cm2) grown in 5- × 5-cm2 plastic pots containing autoclaved 70% sand and 30% potting soil. Plants were maintained daily at a 4.0-mm height using a hand-held scissors. One 6-mm-diameter plug of the isolate was removed from the active edge of a 5-day-old culture grown on PDA and placed in contact with the lower leaf blades of the target plants. Four pots were inoculated with the isolate and four pots were inoculated with an isolate-free agar plug for each of two experimental runs. After inoculation, all pots were placed in a moist chamber at 28°C. In both experiments leaf blade chlorosis and a modest amount of aerial mycelium was observed in all four isolate-introduced pots at 5 to 7 days after inoculation. Symptoms were similar to those expressed in the field, and by 21 to 28 days, all isolate-infected plants died, whereas the noninoculated plants remained healthy and nonsymptomatic. W. circinata var. circinata was reisolated from symptomatic tissue of those inoculated plants and again confirmed by colony traits and rDNA ITS region sequences. This pathogen was reported previously as the causal agent of brown ring patch on annual bluegrass and rough bluegrass (Poa trivialis L.) in the western United States. (1,2). To our knowledge, this is the first report of brown ring patch in Pennsylvania. The economic impact of this disease could be significant since intensive fungicide practices are used to produce high-quality putting green surfaces in the region (3). References: (1) C. Chen et al. Plant Dis. 91:1687, 2007. (2) K. de la Cerda et al. Plant Dis. 91:791, 2007. (3) J. Kaminski and F. Wong. Golf Course Mgmt. 75(9):98, 2007. (4) T. Toda et al. Plant Dis. 89:536, 2005.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera euphorbiae-hirtae on Euphorbia tithymaloides in California

Plant Disease ◽

10.1094/pdis-05-12-0461-pdn ◽

2012 ◽

Vol 96 (12) ◽

pp. 1822-1822

Author(s):

S. Rooney-Latham ◽

J. F. Bischoff

Keyword(s):

Powdery Mildew ◽

Disease Incidence ◽

Its Region ◽

Virgin Islands ◽

California Department ◽

First Report ◽

Food And Agriculture ◽

Trace Back ◽

Ventura County ◽

The Uk

Euphorbia tithymaloides (Euphorbiaceae; known as ‘Jacob's ladder,’ ‘Devil's Backbone’) is a perennial, succulent spurge, grown primarily as a border plant in ornamental landscapes. In June 2011 and February 2012, the California Department of Food and Agriculture Plant Pest Diagnostics Lab, Sacramento, CA, received an unusual powdery mildew sample on greenhouse-grown E. tithymaloides from a Ventura County, CA nursery. Disease incidence at the nursery was 100%. White mycelial patches were present on the stems and on both sides of the leaves. Over time, heavily infected branches defoliated and brownish, roughened, scabby lesions developed on the stems. Hyphae were thin-walled, up to 8 μm wide and developed nipple-shaped appressoria. Ellipsoid-ovoid conidia measured 21.0 to 32.5 × 13 to 18 μm (avg. 26.4 × 13.9 μm, n = 20) and formed in chains. The rDNA internal transcribed spacer (ITS) region was amplified with primers PFITS-F and PF5.8-R (4). The 387-bp sequence (GenBank JX006103) was 99% similar (346/347 bp) to Podosphaera euphorbia-hirtae (AB040306) from Acalypha australis (Euphorbiaceae) (3). Based on ITS similarity and culture morphology, the fungus was identified as P. euphorbiae-hirtae U. Braun & Somani (1,3). Pathogenicity was confirmed through inoculation by gently pressing diseased leaves from the nursery onto the youngest leaves of three plants each of E. tithymaloides cultivars ‘Nano’ and ‘Variegated.’ Leaves of an equal number of control plants were pressed with healthy leaves. Plants were incubated in a dew chamber for 48 h after which they were transferred to a 22°C growth chamber with a 12-h photoperiod. The experiment was repeated once. White powdery mildew colonies formed after 7 days on ‘Variegated’ and 13 days on ‘Nano’. Conidia measured 27.5 to 35.0 × 11 to 15 μm (avg. 30.5 × 12.6 μm, n = 30) which was within the range of P. euphorbia-hirtae. No symptoms developed on the control plants. P. euphorbiae-hirtae has been reported in Asia and the UK on E. tithymaloides and in Asia on A. australis (2). An asexual Oidium stage on Euphorbiaceae in Asia, Africa, Australia, Florida, Puerto Rico, Cuba, and the U.S. Virgin Islands may correspond to P. euphorbiae-hirtae (2). To our knowledge, this is the first report of P. euphorbiae-hirtae in California. Following the 2011 and 2012 detections, all E. tithymaloides plants in the Ventura County, CA nursery were destroyed. A regulatory trace back survey found that the plants were shipped from a Florida supplier, which was also shown to have an outbreak of P. euphorbiae-hirtae. The original source of the Florida E. tithymaloides plants was a 2010 shipment from Costa Rica. The host range of P. euphorbiae-hirtae is restricted to three landscape species in the Euphorbiaceae. References: (1) U. Braun. Beih. Nova Hedwigia 89:143, 1987. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/index.cfm May 1, 2012. (3) T. Hirata. et al. Can. J. Bot. 78:1521, 2000. (4) R. Singh et al. Plant Dis. 93:1348, 2009.

Download Full-text

First Report of Oak Anthracnose Caused by Apiognomonia errabunda on Oriental White Oak in Korea

Plant Disease ◽

10.1094/pdis-02-13-0181-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1121-1121

Author(s):

C. K. Lee ◽

S. H. Lee ◽

J. H. Park ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

North America ◽

Morphological Characteristics ◽

Its Region ◽

Culture Collection ◽

Deciduous Tree ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Natural Forests ◽

White Oak ◽

First Report

Oriental white oak, Quercus aliena Blume, is native to East Asia including Korea. It is one of the major deciduous tree species in natural forests in Korea. In May 2012, several hundred trees were found to be heavily damaged by a previously unknown leaf disease in a forest near Songjiho Lake in Goseong County of central Korea. Leaf symptoms began as small, water-soaked, pale greenish to grayish lesions, which enlarged to follow the veins or midribs and to be bounded by them, often killing part of the leaf. Leaf distortion and blight resulted in the later stage of disease development. A number of grayish brown to nearly black acervuli were formed on the lesions, especially on the midribs and veins. Acervuli were mostly hypophyllous, intraepidermal, erumpent, circular to ellipsoid in outline, cushion-like, and 70 to 220 μm in diameter. Conidia (n = 30) were elliptical to fusiform-elliptical, occasionally obclavate, aguttulate or guttulate, hyaline, aseptate, and 7.5 to 20 × 5 to 7.5 μm (mean 14.6 × 6.1 μm). These morphological characteristics of the fungus were consistent with the description of conidial state of Apiognomonia errabunda (Roberge ex Desm.) Höhn. (3,4). Voucher specimens were deposited in the Korea University Herbarium (KUS). An isolate obtained from KUS-F26690 was deposited in the Korean Agricultural Culture Collection (Accession No. KACC46842). Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting 549-bp sequence was deposited in GenBank (KC426947). This showed >99% similarity with sequences of A. errabunda (AJ888475 to 888477). For pathogenicity test, inoculum was prepared by harvesting conidia from 4-week-old cultures on potato dextrose agar. A conidial suspension (1 × 106 conidia/ml) was sprayed onto young leaves of three potted seedlings. Three seedlings treated with sterile distilled water served as controls. Plants were covered with plastic bags to maintain 100% relative humidity for 24 h and then kept in a greenhouse (20 to 26°C and 60 to 80% RH). After 26 days, typical leaf spot symptoms, identical to the ones observed in the field, developed on the inoculated leaves. No symptoms were observed on controls. A. errabunda was reisolated from the lesions of inoculated plants, fulfilling Koch's postulates. Oak anthracnose associated with A. errabunda (including A. quercina) has been recorded in Europe and North America (1,4). Oak anthracnose of evergreen Quercus glauca Thunb. (syn. Cyclobalanopsis glauca (Thunb.) Oerst.) associated with A. supraseptata in Japan is not related to this disease (2). To our knowledge, this is the first report of oak anthracnose of Q. aliena globally and also the first finding of A. errabunda in Asia as well as in Korea. This pathogen is known as one of the major forest pathogens in oak stand in Europe and North America (3). Pending further studies, including a risk assessment, A. errabunda may be considered as a potentially new and serious threat in native and planted ranges of Q. aliena in Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, retrieved February 18, 2013. (2) S. Kaneko and T. Kobayashi. Trans. Mycol. Soc. Japan 25:11, 1984. (3) A. Ragazzi et al. Phytopathol. Mediterr. 46:295, 2007. (4) M. V. Sogonov et al. Mycol. Res. 111:693, 2007.

Download Full-text

First Report of Shoot Blight and Canker Caused by Diplodia coryli in Hazelnut Trees in Chile

Plant Disease ◽

10.1094/pdis-07-12-0667-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 144-144 ◽

Cited By ~ 3

Author(s):

J. A. Guerrero ◽

S. M. Pérez

Keyword(s):

Sodium Hypochlorite ◽

Control Plant ◽

Width Ratio ◽

Pathogenicity Test ◽

Distilled Water ◽

Dark Light ◽

First Report ◽

Agar Plug ◽

Rdna Sequencing ◽

Shoot Blight

Shoot blight, twig and branch cankers with grayish discoloration, roughened tissue, and dieback were observed in 5-year-old European hazelnut trees (Corylus avellana L.) cv. Barcelona at two commercial plantations in the Allipén locality, Region de La Araucanía (38° 59′ 24.76″ S, 72° 29′ 35.58″ W), Chile, during the 2011 to 2012 growing season. In addition, discoloration of the wood was observed in cross-sections. In order to isolate the causal agent, entire twigs and shoot fragments with cankers were sterilized in 0.5% sodium hypochlorite for 2 minutes, followed by two rinses with sterile distilled water. The tissues were then stored in a humid chamber. Sub-epidermal black pycnidia with sporulation were detected on the symptomatic tissue. Conidia were transferred to potato dextrose agar (PDA) (Difco, Lawrence, KS) and incubated at 25°C in the dark. The mycelia were black, creeping, and compact in appearance. The mature conidia were dark brown with a single septum, slightly constricted at the septum, and ovoid with a broadly rounded apex; some had a truncated base. Conidia had the following measurements: (20.0-) 23.1 ± 1.9 (-28.0) × (10-) 11.9 ± 1.2 (-15) μm with an average length/width ratio of 1.95 ± 0.17 (n = 50). These morphometric characteristics correspond to those of Diplodia coryli Fuckel (1870), teleomorph: Botryosphaeria sensu lato. The identity of the fungus was confirmed using internal transcribed spacer (ITS) rDNA sequencing completed at CABI, United Kingdom. The sequencing report indicated that the isolate (IMI-501235a) had 100% homology with a reference strain (CBS 242.51) in the CBS collection. The obtained sequence was deposited in GenBank (Accession No. JX163116). The anamorphs of Botryosphaeria have been divided into up to 18 genera (1), many of which are not clearly defined. Diplodia (3), including D. coryli (CBS 242.51) and D. juglandis (CBS 188.87), have been included within the genus Dothiorella (2), but the taxon names have not been formally changed. A pathogenicity test was conducted with one isolate (IMI-501235a) and four 1-year-old plants of hazelnut cultivar Barcelona. Plants were maintained in individual bags in greenhouse conditions (14/10 hours dark/light, 20°C; 70% RH). Prior to inoculation, plant tissues were externally disinfected with sodium hypochlorite (2%) and rinsed with sterile distilled water. Each plant was inoculated at fresh wound sites on two shoots and three twigs around each vegetative bud. The inoculum consisted of an agar plug with mycelia (5 mm) from the margin of an actively growing colony cultured on PDA media for 7 days. Each wound was covered with moistened cotton and sealed with Parafilm; a control plant was inoculated in the same way with agar only. After 3 months, fragments of necrotic and discolored vascular system tissues from inoculated shoots were removed and incubated on PDA. D. coryli was consistently recovered from these tissues, satisfying Koch's postulates. The control plant showed no symptoms of the disease. D. coryli has been reported to cause symptoms of dieback (dead branches) in Italy and Spain. To our knowledge, this is the first report of D. coryli on C. avellana cv. Barcelona in Chile. European hazelnut is an emerging crop in Chile, grown mainly for export, and management strategies for this disease will need to be developed. References: (1) S. Denman et al. Stud. Mycol. 45:129, 2000. (2) A. J. L. Phillips et al. Persoonia 21:29, 2008. (3) A. J. L. Phillips et al. Mycologia 97:513, 2005.

Download Full-text