First report of wild tomato mosaic virus infecting chilli pepper in China

Chilli pepper is an important economic crop and virus diseases are constraints on its production. In 2018, disease surveys were conducted at a 15-ha chilli pepper plantation in Dehong, southwest of Yunnan Province, China. Throughout the chilli pepper growing season from March to September, pepper plants developed three different virus-like symptoms on leaves, including mosaic, yellow mottle and shrinkage (Fig. S1). Based on observation of virus-like symptomatic phenotypes, the field surveys indicated that the disease incidence ranged from 30% in March to a peak 100% in July, resulting in a significant loss of pepper fruit from 30 to 100% depending on plot of the field. Potyvirus-like filamentous particles, around 11*760 nm, were observed under electron microscopy in the sap of symptomatic leaves (Fig. S1). To further determine the viral species in these samples, total RNA was extracted from three symptomatic samples using a Trans ZolUp Plus RNA Kit (Trans Gene, Beijing, China). Complementary DNA (cDNA) was synthesized using oligo (dT) and M-MLV reverse transcriptase (Promega, Madison, Wisconsin, USA) according to the manufacturer’s instructions, and the polymerase chain reaction (PCR) was performed using degenerate primers specific to genus Potyvirus targeting HC-Pro region (HPFor: 5-TGYGAYAAYCARYTIGAYIIIAAYG-3; HPRev: 5-GAICCRWAIGARTCIAIIACRTG-3) (Ha et al. 2008) under the following conditions: an initial denaturation at 94°C for 4min, 30 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30s, and a 10min final extension at 72°C. An expected 683-bp DNA fragment was amplified and cloned into the pMD 18-T Vector (Takara, Japan) for sequencing. Sequence analysis using BLAST revealed that the amplicons of phenotype I (Fig. S1a) shared highest nucleotide identity (85.6%) with wild tomato mosaic virus (WTMV) isolate from Vietnam (GenBank no. DQ851495) while the amplicons of phenotype III (Fig. S1c) showed the highest nucleotide identity (93%) with chilli veinal mottle virus (ChiVMV) isolate from Sichuan, China. (GenBank no. MK405594). Amplicons of phenotype II included both sequence of above WTMV and ChiVMV, indicating co-infection of phenotype II (Fig. S1b). Phenotype I sample was used for mechanical inoculation on chilli pepper as described previously (Yang et al.2013). After ten days, virus-like symptoms similar to phenotype I were observed on leaves, and WTMV infection, but not ChiVMV infection, was confirmed by RT-PCR tests on inoculated pepper plants (Fig. S1 e, f). To further ascertain the incidence of these two viruses in the field, primers WT-F: 5'-GTTGTTGAATGTGGTTTAGTT-3' and WT-R: 5'-AGATGTGCTTTGGAAGCGACC-3' were designed based on the WTMV sequence (GenBank no. DQ851495) to amplify a 476 bp product, and primers Ch-F/Ch-R (Ch-F: 5'-AAAGAAGAACAAGCGACAGAA-3', Ch-R: 5'-CATCACGCAAATATTCAAAGC-3') were designed based on ChiVMV sequence (GenBank no. MK405594.1) to amplify a 332 bp product. RT-PCR was conducted on 31 field-collected samples, and amplicons of expected sizes, 476bp and 332bp, corresponding to WTMV and ChiVMV, respectively, were obtained and sequenced to verify their identity. The results (Fig. S2) showed that 71% (22/31) of the samples tested positive for WTMV, 90% (28/31) tested positive for ChiVMV, and 65% (20/31) were co-infected with the two viruses. The WTMV was first reported infecting wild tomatoes in Vietnam in 2008 (Ha et al. 2008), and later reported in China in Nicotiana tabacum (Sun et al. 2015), Solanum nigrum (Zhang et al. 2019), and wild eggplant (Zhang et al. 2014). To our knowledge, this is the first report of WTMV infection on chilli pepper under natural conditions. Our study revealed that the chilli pepper disease in Dehong was caused by single or co-infection of WTMV and ChiVMV. It is necessary to find effective methods to control these two viruses.

Download Full-text

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia

Plant Disease ◽

10.1094/pdis-93-7-0761b ◽

2009 ◽

Vol 93 (7) ◽

pp. 761-761 ◽

Cited By ~ 5

Author(s):

M. I. Font ◽

M. C. Córdoba-Sellés ◽

M. C. Cebrián ◽

J. A. Herrera-Vásquez ◽

A. Alfaro-Fernández ◽

...

Keyword(s):

Mosaic Virus ◽

Capsicum Annuum ◽

Polyclonal Antibodies ◽

Plant Viruses ◽

Mottle Virus ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Tomato Plants ◽

First Report ◽

Pepper Plants

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

Download Full-text

First Report of Tomato mottle mosaic virus Infection of Pepper in China

Plant Disease ◽

10.1094/pdis-03-14-0317-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1447-1447 ◽

Cited By ~ 16

Author(s):

Y. Y. Li ◽

C. L. Wang ◽

D. Xiang ◽

R. H. Li ◽

Y. Liu ◽

...

Keyword(s):

Mosaic Virus ◽

Broad Bean ◽

Bell Pepper ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Degenerate Primers ◽

Autonomous Region ◽

First Report ◽

Tibet Autonomous Region ◽

Wilt Virus

Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) R. Li et al. Genome Announc. 1(5):e00794-13, 2013. (3) Y. Xie et al. Virol. J. 10:142, 2013.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

Tropical soda apple mosaic virus Identified in Solanum capsicoides in Florida

Plant Disease ◽

10.1094/pdis-91-9-1204a ◽

2007 ◽

Vol 91 (9) ◽

pp. 1204-1204 ◽

Cited By ~ 2

Author(s):

S. Adkins ◽

G. McAvoy ◽

E. N. Rosskopf

Keyword(s):

Sequence Analysis ◽

Mosaic Virus ◽

Sandwich Elisa ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Degenerate Primers ◽

Lee County ◽

Cp Gene ◽

Local Lesions ◽

Tropical Soda Apple

Red soda apple (Solanum capsicoides All.), a member of the Solanaceae, is a weed originally from Brazil (3). It is a perennial in southern Florida and is characterized by abundant prickles on stems, petioles, and leaves. Prickles on stems are more dense than those on its larger, noxious weed relative, tropical soda apple (Solanum viarum Dunal), and the mature red soda apple fruits are bright red in contrast to the yellow fruits of tropical soda apple (2). Virus-like foliar symptoms of light and dark green mosaic were observed on the leaves of a red soda apple in a Lee County cow pasture during a tropical soda apple survey during the fall of 2004. The appearance of necrotic local lesions following inoculation of Nicotiana tabacum cv. Xanthi nc with sap from the symptomatic red soda apple leaves suggested the presence of a tobamovirus. Tropical soda apple mosaic virus (TSAMV), a recently described tobamovirus isolated from tropical soda apple in Florida, was specifically identified by a double-antibody sandwich-ELISA (1). An additional six similarly symptomatic red soda apple plants were later collected in the Devils Garden area of Hendry County. Inoculation of N. tabacum cv. Xanthi nc with sap from each of these symptomatic plants also resulted in necrotic local lesions. Sequence analysis of the TSAMV coat protein (CP) gene amplified from total RNA by reverse transcription (RT)-PCR with a mixture of upstream (SolA5′CPv = 5′-GAACTTWCAGAAGMAGTYGTTGATGAGTT-3′; SolB5′CPv = 5′-GAACTCACTGARRMRGTTGTTGAKGAGTT-3′) and downstream (SolA3′CPvc = 5′-CCCTTCGATTTAAGTGGAGGGAAAAAC-3′; SolB3′CPvc = 5′-CGTTTMKATTYAAGTGGASGRAHAAMCACT-3′) degenerate primers flanking the CP gene of Solanaceae-infecting tobamoviruses confirmed the presence of TSAMV in all plants from both locations. Nucleotide and deduced amino acid sequences of the 483-bp CP gene were both 98 to 99% identical to the original TSAMV CP gene sequences in GenBank (Accession No. AY956381). TSAMV was previously identified in tropical soda apple in these two locations in Lee and Hendry counties and three other areas in Florida (1). Sequence analysis of the RT-PCR products also revealed the presence of Tomato mosaic virus in the plant from Lee County. To our knowledge, this represents the first report of natural TSAMV infection of any host other than tropical soda apple and suggests that TSAMV may be more widely distributed in solanaceous weeds than initially reported. References: (1) S. Adkins et al. Plant Dis. 91:287, 2007. (2) N. Coile. Fla. Dep. Agric. Consum. Serv. Div. Plant Ind. Bot. Circ. 27, 1993. (3) U.S. Dep. Agric., NRCS. The PLANTS Database. National Plant Data Center. Baton Rouge, LA. Published online, 2006.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

First Report of Tobacco mild green mosaic virus in Capsicum chinense in Venezuela

Plant Disease ◽

10.1094/pd-90-1108a ◽

2006 ◽

Vol 90 (8) ◽

pp. 1108-1108 ◽

Cited By ~ 3

Author(s):

C. Córdoba ◽

A. García-Rández ◽

N. Montaño ◽

C. Jordá

Keyword(s):

Mosaic Virus ◽

Seed Transmission ◽

Tomato Mosaic Virus ◽

Capsicum Chinense ◽

Rt Pcr ◽

Plant Host ◽

First Report ◽

Coat Protein Region ◽

Pcr Product ◽

First Time

In July 2003, noticeable deformations of leaves were observed on a local variety of Capsicum chinense, also called ‘Aji dulce’, from a pepper plantation located in Venezuela, (Monagas State). ‘Aji dulce’ is a basic ingredient of the Venezuelan gastronomy with an estimated cultivated area of 2,000 ha. The seeds of this local pepper are obtained by the growers who reproduce and multiply their own seeds every year. Seeds of affected plants were sent to our laboratory, and a group of approximately 100 seeds was sown in a controlled greenhouse that belongs to the Polytechnic University of Valencia, Spain. Three months later, obvious curling and bubbling developed on the leaves of the plants. Extracts of symptomatic plants tested negative for Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Pepper mild mottle virus (PMMV), and Tobacco etch virus (TEV) by double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with policlonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany; Phyto-Diagnostics, INRA, France). Total RNA was isolated from 0.5 g of original seed sent from Venezuela and from 25 samples of leaves of plants grown in the greenhouse with an RNeasy Plant Mini Kit (Qiagen Sciences, Germantown, Maryland). The RNA isolated was used in reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for Tobacco mild green mosaic virus (TMGMV) (1) predicted to amplify a 530 bp of the coat protein region. From all samples, a RT-PCR product of the expected size was obtained and then sequenced. BLAST analysis of one sequence (GenBank Accession No. DQ460731) showed high levels of identity with TMGMV isolates, with more than 99% nucleotide identity with the DSMZ PV-112 isolate (GenBank Accession No. AJ429096). The symptomatology observed on pepper plants, the TMGMV RT-PCR assay, and the consensus of sequenced regions with TMGMV lead us to conclude that TMGMV was the causal agent of the diseased C. chinense plants. Although TMGMV has a wide plant host range occurring worldwide (1), to our knowledge, this is not only the first time TMGMV has been detected in Venezuela, but also the first report of TMGMV in C. chinense in Venezuela and the first reliable probe of the TMGMV seed transmission. Reference: (1) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

Download Full-text

Molecular Characterization of Two Isolates of Wild Tomato Mosaic Virus and Chilli Veinal Mottle Virus Co-infecting Chilli Pepper in China

10.21203/rs.3.rs-442269/v1 ◽

2021 ◽

Author(s):

Yongliang Hu ◽

Yuqin Chen ◽

Xiaoxia Su ◽

Jiawei Huang ◽

Hongxing Yin ◽

...

Keyword(s):

Mosaic Virus ◽

The Other ◽

Mottle Virus ◽

Tomato Mosaic Virus ◽

Chilli Pepper ◽

Wild Tomato ◽

Critical Regions ◽

New Evidence ◽

Chilli Veinal Mottle Virus

Abstract The present study reports observation of a field chilli pepper disease consisting of a co-infection with two potyviruses: Wild tomato mosaic virus Dehong isolate (WTMV-Dh) and Chili veinal mottle virus Dehong isolate (ChiVMV-Dh). We obtained the complete genome sequences of these two viruses by NGS sequencing. The WTMV-Dh is 9,598 nucleotides (nt) in length and encodes a complete polyprotein of 3,075 amino acids (aa). The polyprotein of WTMV-Dh shares 76.1–82.6% nt and 85.3–89.5% aa identities with the other three WTMV isolates reported previously. The ChiVMV-Dh is 9688 nt in length and encodes a complete polyprotein with 3, 089 aa. The polyprotein of ChiVMV-Dh shares 80.8–92.2% nt and 85.3–95.6% aa identities with the other ChiVMV isolates reported previously. Following phylogenetic analysis based on the polyprotein sequences of other potyviruses, WTMV-Dh clustered with the Vietnam strain WTMV-Laichau while ChiVMV-Dh clustered with several ChiVMV Sichuan isolates. Evaluation of the recombination events within the WTMV and ChiVMV subgroups indicated that some putative recombination events occurred in critical regions. These regions include the N-terminal of HC-Pro and P1 region of WTMV-Dh, CP and the P3 to CI region of ChiVMV-Dh, which may be new evidence of adaptive evolution of potyviruses.

Download Full-text

First Report of Tomato mosaic virus on Common Sow Thistle in Iran

Plant Disease ◽

10.1094/pdis-03-14-0220-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1164-1164 ◽

Cited By ~ 2

Author(s):

S. S. Hashemi ◽

F. Rakhshandehroo ◽

N. Shahraeen

Keyword(s):

Mosaic Virus ◽

Polyclonal Antibodies ◽

Tomato Mosaic Virus ◽

Vegetable Crops ◽

Rt Pcr ◽

Weed Species ◽

First Report ◽

Sonchus Oleraceus ◽

Plant Pathol

The natural incidence of Tomato mosaic virus (ToMV) in common sow thistle (Sonchus oleraceus) from vegetable fields was assessed to determine the role of this weed species as a virus inoculum source. Twenty sow thistle plants with virus-like foliar symptoms including mosaic and malformations were collected from five vegetable fields in Tehran province, Iran, and analyzed by double antibody sandwich (DAS)-ELISA for the presence of ToMV, Tobacco mosaic virus (TMV), and Cucumber mosaic virus (CMV) using specific polyclonal antibodies (Agdia, Elkhart, IN). Six out of the 20 sow thistle plants tested by ELISA were infected with ToMV. This virus was detected in three of five vegetable fields surveyed, while CMV and TMV were not detected. Mosaic symptoms were associated with the ToMV infection, similar to those caused by TMV in common sow thistle in Iran (2). Viral infection was confirmed by RT-PCR using previously described specific primers to amplify a region in the coat protein gene of ToMV (3). The RT-PCR resulted in the amplification of an expected fragment of ~480 bp from ToMV-infected but not from healthy plants. The nucleotide sequence of the amplified DNA fragment was purified (GeneJET Gel Extraction Kit, Fermentas, Germany), directly sequenced, and deposited in GenBank as Accession No. KF527464. BLAST analysis showed 95 to 97% and 98 to 100% identity at the nucleotide and amino acid levels, respectively, with comparable sequences of other ToMV isolates (GenBank AF062519, FN985165, GQ280794, and JX857634). Mechanical inoculation of sow thistle plants with sap of symptomatic sow thistles reproduced symptoms of field-infected sow thistles. The presence of ToMV in the inoculated plants was confirmed by ELISA and RT-PCR. This suggested that ToMV could be the causal agent of the disease on sow thistle. In our earlier studies, the distribution and genetic diversity of ToMV isolates infecting vegetable crops and weed plants were studied (1); however, to our knowledge, this is the first report of ToMV infecting common sow thistle in Iran. References: (1) V. Aghamohammadi et al. J. Plant Pathol. 95:339, 2013. (2) A. Alishiri et al. Plant Pathol. J. 29:260, 2013. (3) B. Letschert et al. J. Virol. Methods 106:10, 2002.

Download Full-text

First Report of Cucumber mosaic virus Infecting Peperomia tuisana in Serbia

Plant Disease ◽

10.1094/pdis-01-13-0089-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1004-1004 ◽

Cited By ~ 2

Author(s):

K. Milojević ◽

I. Stanković ◽

A. Vučurović ◽

D. Ristić ◽

D. Milošević ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Disease Incidence ◽

Impatiens Necrotic Spot Virus ◽

Rt Pcr ◽

Test Species ◽

First Report ◽

Cp Gene ◽

Negative Controls ◽

Das Elisa

Peperomia tuisana C.DC. ex Pittier (family Piperaceae) is an attractive succulent grown as an ornamental. Despite its tropical origins, it can be successfully grown indoors in any climate. In March 2012, three samples of P. tuisana showing virus-like symptoms were collected from a commercial greenhouse in Zemun (District of Belgrade, Serbia) in which estimated disease incidence was 80%. Infected plants showed symptoms including necrotic ringspots and line patterns that enlarged and caused necrosis of leaves. A serious leaf drop led to growth reduction and even death of the plant. Leaves from three symptomatic P. tuisana plants were sampled and analyzed by double-antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba AG, Reinach, Switzerland) against the most common viral pathogens of ornamentals: Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), and Impatiens necrotic spot virus (INSV) (1,2). Commercial positive and negative controls were included in each ELISA. Serological analyses showed that all plants were positive for CMV and negative for TSWV and INSV. The ELISA-positive sample (isolate 1-12) was mechanically inoculated onto five plants each of three test species as well as of healthy young P. tuisana using 0.01 M phosphate buffer (pH 7). Chlorotic local lesions on Chenopodium quinoa and severe mosaic and leaf malformations were observed on all inoculated Nicotiana tabacum ‘Samsun’ and N. glutinosa. Also, the virus was successfully mechanically transmitted to P. tuisana that reacted with symptoms identical to those observed on the original host plants. All mechanically inoculated plants were positive for CMV in DAS-ELISA. For further confirmation of CMV infection, reverse transcription (RT)-PCR was performed on extracts made from symptomatic P. tuisana, N. tabacum ‘Samsun,’ and N. glutinosa leaf materials. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was carried out using One-Step RT-PCR Kit (Qiagen). A CMV-specific primer pair, CMVCPfwd and CMVCPrev (3), which amplifies an 871-bp fragment of the entire coat protein (CP) gene and part of 3′- and 5′-UTRs, were used for both amplification and sequencing. Total RNAs obtained from the Serbian CMV isolate (HM065510) and healthy P. tuisana were used as positive and negative controls, respectively. A product of the correct predicted size was obtained in all naturally and mechanically infected plants, as well as positive control. No amplicon was recorded in the healthy control. The amplified product derived from isolate 1-12 was purified (QIAquick PCR Purification Kit, Qiagen), directly sequenced in both directions, deposited in GenBank (KC505441), and analyzed by MEGA5 software (4). Sequence comparison of the complete CP gene (657 nt) revealed that the Serbian isolate 1-12 shared the highest nucleotide identity of 99.1% (99.5% amino acid identity) with the Japanese isolate (AB006813). To our knowledge, this is the first report on the occurrence of CMV in P. tuisana in Serbia. This is also an important discovery since P. tuisana is commonly grown together with other ornamental hosts of CMV, and thus could represent a serious threat for future expansion of CMV in the greenhouse floriculture industry in Serbia. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. Flasinski et al. Plant Dis. 79:843, 1995. (3) K. Milojevic et al. Plant Dis. 96:1706, 2012. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

Download Full-text

First Report of Ranunculus mild mosaic virus on Ranunculus asiaticus in Yunnan Province, China

Plant Disease ◽

10.1094/pdis-92-11-1585a ◽

2008 ◽

Vol 92 (11) ◽

pp. 1585-1585 ◽

Cited By ~ 1

Author(s):

J. H. Wang ◽

S. Zhao ◽

X. M. Yang

Keyword(s):

Mosaic Virus ◽

Yunnan Province ◽

Disease Incidence ◽

Viral Disease ◽

Mild Mosaic ◽

Rt Pcr ◽

Potential Threat ◽

First Report ◽

Ranunculus Asiaticus ◽

Mild Mosaic Virus

In June 2007, a new viral disease occurred in commercial fields of Ranunculus asiaticus in the Yunnan Province of China. Infected plants exhibited mosaic symptoms and growth abnormalities. Viral disease incidence for this ornamental crop host in the Yunnan Province was estimated to range from 10 to 20%. Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic plants identified long, flexuous linear particles (approximately 800 nm). The samples were tested using indirect antigen-coated plate (ACP)-ELISA. ACP-ELISA results showed that the leaf samples from symptomatic plants reacted positively to the potyvirus group antibody (Agdia Inc., Eklhart, IN). Total nucleic acid extracted from symptomatic plants was tested using reverse transcription (RT)-PCR with primers (S 5′-GGNAAAAYAGYGGNCARCC-3′; M4: 5′-GTTTTCCCAGTCACGAC-3′ [N = A, G, C, or T; Y = C or T; and R = A or G]) designed to amplify the 3′ terminal region of genomic RNA of the genus Potyvirus (1). RT-PCR produced a 1,650-bp amplification product that was cloned and sequenced (GenBank Accession No. EU684747). The sequenced portion showed 90 and 99% identity with the Ranunculus mild mosaic virus (RMMV) isolates (GenBank Accession Nos. DQ152191 and EF445546) from Italy and Israel, respectively (2). To our knowledge, this is the first report of RMMV in China. Infection from this virus may cause losses for cut-flower production of Ranunculus asiaticu and it is also a potential threat for international trade of Ranunculus germplasm. References: (1) J. Chen and J. P. Chen. Chin. J. Virol. 18:371, 2002. (2) M. Turina et al. Phytopathology 96:560, 2006.

Download Full-text