scholarly journals First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California

Plant Disease ◽  
2021 ◽  
Author(s):  
Shaonpius Mondal ◽  
Laura L. Jenkins Hladky ◽  
Patricia L. Fashing ◽  
James Donald McCreight ◽  
Thomas A Turini ◽  
...  
Keyword(s):  
Sonoran Desert ◽  
Central Valley ◽  
Fresno County ◽  
Total Rna ◽  
First Report ◽  
Production Region ◽  
Primer Sets ◽  
Biotype B ◽  
Rna And Dna ◽  
Cucurbit Chlorotic Yellows Virus

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F – 5’ AAGAGCGGCAGCTACAATAC 3’, CABYV RdRp-R – 5’ TGCCACATTCCGGTTCATAG 3’), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

scholarly journals First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hae-Ryun Kwak ◽  
Hui-Seong Byun ◽  
Hong-Soo Choi ◽  
Jong-Woo Han ◽  
Chang-Seok Kim ◽  
...  
Keyword(s):  
Coat Protein ◽  
South Korea ◽  
East Asia ◽  
Rna Extraction ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

scholarly journals First Report of Cucurbit chlorotic yellows virus Infecting Cucurbits in Taiwan

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168 ◽  
Author(s):  
L.-H. Huang ◽  
H.-H. Tseng ◽  
J.-T. Li ◽  
T.-C. Chen
Keyword(s):  
Citrullus Lanatus ◽  
Bottle Gourd ◽  
Insect Vector ◽  
Silverleaf Whitefly ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Dna Fragment ◽  
Cucurbit Chlorotic Yellows Virus

In April 2009, chlorosis, yellows, and bleaching accompanied with green veins and brittleness on the lower leaves of cantaloupe (Cucumis melo L.) were observed in Lunbei Township, Yunlin County, Taiwan. The same symptoms were also found on cucumber (Cucumis sativus L.), pumpkin (Cucurbita moschata Duchesne), watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), bottle gourd (Lagenaria siceraria (Molina) Standl.), and oriental pickling melon planted in other areas of Yunlin and Changhua counties in central Taiwan. Large populations of whiteflies were observed in association with the diseased cucurbit crops, and they were further identified as silverleaf whitefly (Bemisia argentifolii Bellows & Perring) by PCR with specific primers BaBF (5′-CCACTATAATTATTGCTGTTCCCACA-3′) and l2-N-3014R (5′-TCCAATGCACTAATCTGCCATATTA-3′) (3). In June 2009, samples from symptomatic cantaloupe were collected for virus diagnosis. Flexuous filamentous virions of 700 to 900 nm were observed in crude sap of the symptomatic cantaloupe tissues with transmission electron microscopy. On the basis of the suspected insect vector, symptomology, and virus morphology, a Crinivirus species was suspected as the causal agent. A nested reverse transcription (RT)-PCR assay with degenerate deoxyinosine-containing primers developed for detection of Closterovirus and Crinivirus (1) was conducted. Total RNAs extracted from 16 symptomatic cantaloupe samples with a Plant Total RNA Miniprep Purification Kit (Hopegen, Taichung, Taiwan) were analyzed, and a 0.5-kb DNA fragment was amplified from eight of them. The PCR products were sequenced and the sequences were identical among samples. A comparison of the submitted sequence (Accession No. HM120250) with those in GenBank showed that the sequence was identical to the Hsp70h sequences of Cucurbit chlorotic yellows virus (CCYV) isolates from Japan (Accession No. AB523789) (4) and China (Accession Nos. GU721105, GU721108, and GU721110). To identify CCYV infection in the field, the specific primers, Crini-hsp70-f (5′-GCCATAACCATTACGGGAGA-3′) and Crini-hsp70-r (5′-CGCAGTGAAAAACCCAAACT-3′), that amplify a 389-bp DNA fragment corresponding to the nucleotide 1,324 to 1,712 of RNA2 of the original CCYV Japan isolate (Accession No. AB523789) were designed for detection of CCYV. In RT-PCR analyses, CCYV was identified in cantaloupe (305 of 599 samples), watermelon (27 of 93 samples), cucumber (all 15 samples), melon (82 of 92 samples), pumpkin (8 of 10 samples), and bottle gourd (10 of 17 samples) showing chlorosis and yellowing. The 389-bp DNA fragment was also amplified by RT-PCR with the primer pair Crini-hsp70-f/Crini-hsp70-r from total RNA extracts of 29 of 116 silverleaf whitefly individuals collected from the diseased cantaloupe fields in Lunbei Township from August to October, 2009. CCYV is a newly characterized Crinivirus species, first discovered in Japan in 2004 (2) and also found in China in 2009. To our knowledge, this is the first report that CCYV is emerging as a threat to cucurbit productions in Taiwan. References: (1) C. I. Dovas and N. I. Katis. J. Virol. Methods 109:217, 2003. (2) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (3) C. C. Ko et al. J. Appl. Entomol. 131:542, 2007. (4) M. Okuda et al. Phytopathology 100:560, 2010.

scholarly journals First Report of Tomato chlorosis virus in Potato in Brazil

Plant Disease ◽  
2012 ◽  
Vol 96 (4) ◽  
pp. 593-593 ◽  
Author(s):  
D. M. S. Freitas ◽  
I. Nardin ◽  
N. Shimoyama ◽  
J. A. C. Souza-Dias ◽  
J. A. M. Rezende
Keyword(s):  
Leaf Roll ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Interveinal Chlorosis ◽  
Potato Plants ◽  
The World ◽  
Tomato Chlorosis Virus ◽  
Biotype B

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

scholarly journals First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
In Sook Cho ◽  
Tae-Bok Kim ◽  
Ju-Yeon Yoon ◽  
Bong Nam Chung ◽  
John Hammond ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Cucumis Melo ◽  
Korean Isolate ◽  
Rt Pcr ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Oriental Melon ◽  
Cucumis Melo L ◽  
Cucurbit Chlorotic Yellows Virus

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5’-ACCGAACACTTGGCTATCCAA-3’/5’-CTTAATGCCGCGTATGAACTCA-3’) span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5’-TGAACGACACTGAGTTCATTCCTA-3’/5’-CGCCAAGATCGTACATGAGGAA-3’), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5ʹ-ATCTCGCATTTGGCATTACTC-3ʹ/5ʹ-ATTTGTAGAGATGCCAACGTA-3ʹ), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5ʹ-CGGTCTATTGTCTGCAGTACCA-3ʹ/5ʹ- GTAGAGGATCTTGAATTGGTCCTCA-3ʹ) were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

scholarly journals First Report of Soybean yellow mottle mosaic virus in Soybean in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (11) ◽  
pp. 1214-1214 ◽  
Author(s):  
S. Li ◽  
J. S. Moon ◽  
S. H. Lee ◽  
L. L. Domier
Keyword(s):  
North America ◽  
Reverse Transcriptase ◽  
Mosaic Virus ◽  
The United States ◽  
Nucleotide Sequence Analysis ◽  
Dna Fragments ◽  
Total Rna ◽  
First Report ◽  
Yellow Mottle ◽  
Primer Sets

Soybean yellow mottle mosaic virus (SYMMV) is a soybean-infecting virus recently discovered in Korea that initially induces bright yellow mosaic on leaves followed by stunting and reduced growth of older leaves (1). Nucleotide sequence analysis of genomic RNA of the Korean SYMMV isolate suggested that the virus is a new member of the genus Carmovirus in the family Tombusviridae. To determine whether SYMMV is present in the United States, single leaflets were collected without regard for symptoms from 7 to 10 plants in each of 136 plots in August 2008 from a research field in Stoneville, MS that contained 16 plant introductions (including five from Korea) and ‘Williams 82’. Samples were grouped into 10 pools of 100 leaves from which total RNA was extracted with the Qiagen RNeasy Plant Mini Kit (Germantown, MD), reverse transcribed, and amplified with SuperScript III Platinum SYBR Green One-Step Quantitative Real-time Reverse Transcriptase-PCR Kit (Invitrogen, Carlsbad, CA) and two pairs of oligonucleotide primers (5′-CGTCTGCCAGGGTTTAATACTA-3′, and 5′-GATTAGCATGTCAGGGTGGTCG-3′; and 5′-ACTGAGTCCCCTGCTTAT-3′ and 5′-CATCACTAGCGTCYGGATCA-3′) that were designed from regions conserved between SYMMV and Cowpea mottle virus (CPMoV; a related and seed-transmitted carmovirus). Six 100-leaflet pools were positive with both primer sets and four pools were negative with both primer sets. Total RNA extracted from one positive pool was reverse transcribed using SuperScript II reverse transcriptase and a primer complementary to nt 4,000 to 4,009 of the SYMMV genome and amplified using iProof DNA polymerase (Bio-Rad, Hercules, CA) as two overlapping DNA fragments using primers corresponding to nt 1 to 21 and complementary to nt 3,483 to 3,508 and corresponding to nt 3,366 to 3,391 and complementary to nt 4,000 to 4,009. DNA fragments were sequenced using a BigDye Terminator Cycle Sequencing Kit and ABI 3730XL capillary sequencers (Applied Biosystems, Foster City, CA). The 4,009-nt sequence of the Mississippi SYMMV isolate (GenBank Accession No. FJ707484) was 96% identical to the Korean SYMMV isolate and 65% identical to CPMoV. Because of the sampling techniques used, it was not possible to associate SYMMV-positive plants with disease symptoms in Mississippi. To our knowledge, this is the first report of SYMMV in North America. Reference: (1) M. Nam et al. Online publication. doi:10.1077/s00705-009-0480. Arch. Virol., 2009.

scholarly journals First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in cucurbit crops in Alabama

Plant Disease ◽  
2021 ◽  
Author(s):  
Shaonpius Mondal ◽  
Laura L. Jenkins Hladky ◽  
Rebecca A Melanson ◽  
Raghuwinder Singh ◽  
Edward Sikora ◽  
...  
Keyword(s):  
Gulf Coast ◽  
Infected Plant ◽  
Fall Season ◽  
First Report ◽  
Foliar Symptoms ◽  
Polymerase Chain ◽  
Primer Sets ◽  
Gulf Coast Region ◽  
Whitefly Vector ◽  
Cucurbit Chlorotic Yellows Virus

During the summer and fall of 2020, foliar yellowing symptoms, including leaf mottle and interveinal yellowing with green veins were observed on several melon, squash, and cucumber plants in commercial fields in Alabama, USA. These foliar symptoms were similar to those caused by the whitefly-transmitted yellowing viruses, cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) (both genus Crinivirus, Closteroviridae). A total of 231 leaf samples showing yellowing, interveinal chlorosis, and mottling (e-Xtra 1, 2) were collected from individual plants from 25 commercial fields in Alabama (70 watermelon, 52 melon, 34 pumpkin, 50 squash, and 25 cucumber) during two sampling periods, June (spring/summer season) and October (fall season) 2020. Total RNA, extracted as described in Tamang et al. (2021), was used in reverse transcription polymerase chain reaction (RT-PCR) with primer sets designed to amplify portions of the CCYV and CYSDV RNA-dependent RNA polymerase (RdRp) genes encoded on RNA1 of these viruses (Mondal et al. 2021, submitted; Kavalappara et al., 2021). Single infections of either CYSDV or CCYV were found in 53 of 57 infected cucurbit samples (of 231 total plants), whereas both viruses were detected in four samples, all squash. In June 2020 near the end of the spring season, CYSDV was identified from 20 of 114 total cucurbit plants tested (17.5%), but CCYV was not identified from any plants. During the fall season, 37 of 117 plants (32%) tested positive for the presence of one or both criniviruses. Of the 37 virus-positive samples from the fall season, 26 were singly infected with CCYV (70%), seven were singly infected with CYSDV (19%), and four were infected with both CYSDV and CCYV (11%). The RdRp amplicon was sequenced from three CCYV-infected plants (2 squash; GenBank Accession No. MZ073347, MZ073348; 1 cucumber, MZ073349) and one CYSDV-infected plant (melon, MZ073350); the 857 nt sequenced portion of the CCYV RdRp gene was found to share 99% identity with the same sequence of CCYV RNA1 isolates from Israel (MH477611.1) and California (MW680157), whereas the 494 nt CYSDV amplicon shared 100% sequence identity with the comparable sequence from RNA1 of a CYSDV isolate from Arizona (EF547827.1). In addition, all of the CYSDV and CCYV infections were confirmed using a second set of primers that amplified 394 and 372 nt sections of the coat protein gene of each virus, respectively (Wintermantel et al., 2009; 2019), encoded on RNA2 of each viral genome. Furthermore, a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted) was used to confirm four representative CYSDV and CCYV infections each. This is the first report of CYSDV and CCYV in cucurbit crops from Alabama. Surprisingly, CYSDV was only found in melon plants (20 of 52, 38%), whereas CCYV was only found in squash, pumpkin, and cucumber (26 of 109, 24%); no watermelon plants were infected with either virus, even though watermelon is a known host of both viruses. The identification of CCYV and CYSDV in Alabama, along with a recent report of both criniviruses from nearby Georgia (Kavalappara et al., 2021) illustrates the need for a more thorough sampling of cucurbit crops, further monitoring of the whitefly vector, Bemisia tabaci, and the identification of alternate hosts of these viruses to better understand the epidemiology of these viruses in Alabama and throughout the Gulf Coast region.

scholarly journals First report of Melon aphid-borne yellows virus infecting watermelon in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hee-Seong Byun ◽  
Hong-Soo Choi ◽  
Hyun Ran Kim ◽  
Hae-Ryun Kwak ◽  
Eui-Joon Kil ◽  
...  
Keyword(s):  
De Novo ◽  
Citrullus Lanatus ◽  
Plant Viruses ◽  
Rt Pcr ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Two Samples ◽  
Primer Sets ◽  
Melon Aphid

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in watermelon farms is also increasing. In July 2020, some watermelons cultivated on farms in Uiryeong showed typical viral symptoms, such as yellowing and necrosis. In previous studies, two plant viruses, cucurbit aphid-borne yellows virus (CABYV) and cucurbit chlorotic yellows virus (CCYV), have been reported as causal agents of yellowing disease in the cucurbitaceae plant in Korea. To identify the virus(es) associated with the symptomatic watermelon plants, 11 samples were collected. Total RNA was extracted from each sample using the Plant RNA Prep kit (Biocube System, Gwacheon, Korea). RT-PCR was performed using primer sets specific to CABYV and CCYV to detect each virus (Kwak et al. 2018, Wintermantel et al. 2019). CABYV was detected in one sample, and CCYV was detected in 8 samples. Every sample presented similar yellowing symptoms; however, neither virus was detected in the remaining two samples. To investigate unknown viruses, a transcriptome library was constructed using total RNA of the watermelons and sequenced using a NovaSeq 6000 sequencer (Illumina, San Diego, CA). The reads were de novo assembled and annotated using the KEGG virus genome database with the NCBI BLAST utility. All procedures of next generation sequencing were performed by Macrogen (Seoul, Korea). Three large viral contigs were identified, and additional BLAST analyses for nucleotides (nt) and proteins indicated that they were CABYV, CCYV, and melon aphid-borne yellows virus (MAYBV). A total of 247,198 reads were mapped to reference MABYV sequence (GenBank Accession Number NC_010809), and the sequencing depth was 6,575X. The contig (MW505927) had a size of 5,677 nt and showed 100% coverage and 96% identity with known complete MABYV sequences (JQ700307 and EU000534). To confirm the presence of MABYV, RT-PCR was performed using specific primer sets targeting MABYV (MABYV-262-F, 5ʹ-GAACCGTCGACGCACTTCAAAGAGTA-3ʹ and Polero-uni-R, 5ʹ-GATYTTATAYTCATGGTAGGCCTTGAG-3ʹ; Knierim et al. 2010). The expected size of 262 bp was obtained from 5 out of 11 samples, including the two samples mentioned above. MABYV belongs to the genus Polerovirus and has been reported in cucurbit crops in China, Taiwan, and Thailand (Xiang et al. 2008, Knierim et al. 2010, Cheewachaiwit et al. 2017). According to the farmer, outbreak of aphids had previously occurred and were controlled with pesticides. Since aphids are known to be vectors of poleroviruses, we surmise that the watermelons were infected with MABYV by the aphids at that time. To monitor the outbreak of MABYV, watermelon farms in Uiryeong will be continuously investigated. To our knowledge, this is the first report of MABYV in Korea.

scholarly journals First Report of Cucurbit Chlorotic Yellows Virus Infecting Melon in the New World

Plant Disease ◽  
2019 ◽  
Vol 103 (4) ◽  
pp. 778-778 ◽  
Author(s):  
W. M. Wintermantel ◽  
L. L. Jenkins Hladky ◽  
P. Fashing ◽  
K. Ando ◽  
J. D. McCreight
Keyword(s):  
New World ◽  
First Report ◽  
Cucurbit Chlorotic Yellows Virus

scholarly journals First report of Colletotrichum siamense Causing Blossom Blight on Thai basil (Ocimum basilicum L.) in Malaysia

Plant Disease ◽  
2020 ◽  
Author(s):  
Siti Izera Ismail ◽  
Nur Adlina Rahim ◽  
Dzarifah Zulperi
Keyword(s):  
Disease Incidence ◽  
Its Region ◽  
Ocimum Basilicum ◽  
Distilled Water ◽  
Single Spore ◽  
First Report ◽  
Plastic Bags ◽  
Colletotrichum Siamense ◽  
Primer Sets ◽  
Acca Sellowiana

Thai basil (Ocimum basilicum L.) is widely cultivated in Malaysia and commonly used for culinary purposes. In March 2019, necrotic lesions were observed on the inflorescences of Thai basil plants with a disease incidence of 60% in Organic Edible Garden Unit, Faculty of Agriculture in the Serdang district (2°59'05.5"N 101°43'59.5"E) of Selangor province, Malaysia. Symptoms appeared as sudden, extensive brown spotting on the inflorescences of Thai basil that coalesced and rapidly expanded to cover the entire inflorescences. Diseased tissues (4×4 mm) were cut from the infected lesions, surface disinfected with 0.5% NaOCl for 1 min, rinsed three times with sterile distilled water, placed onto potato dextrose agar (PDA) plates and incubated at 25°C under 12-h photoperiod for 5 days. A total of 8 single-spore isolates were obtained from all sampled inflorescence tissues. The fungal colonies appeared white, turned grayish black with age and pale yellow on the reverse side. Conidia were one-celled, hyaline, subcylindrical with rounded end and 3 to 4 μm (width) and 13 to 15 μm (length) in size. For fungal identification to species level, genomic DNA of representative isolate (isolate C) was extracted using DNeasy Plant Mini Kit (Qiagen, USA). Internal transcribed spacer (ITS) region, calmodulin (CAL), actin (ACT), and chitin synthase-1 (CHS-1) were amplified using ITS5/ITS4 (White et al. 1990), CL1C/CL2C (Weir et al. 2012), ACT-512F/783R, and CHS-79F/CHS-345R primer sets (Carbone and Kohn 1999), respectively. A BLAST nucleotide search of ITS, CHS-1, CAL and ACT sequences showed 100% similarity to Colletotrichum siamense ex-type cultures strain C1315.2 (GenBank accession nos. ITS: JX010171 and CHS-1: JX009865) and isolate BPDI2 (CAL: FJ917505, ACT: FJ907423). The ITS, CHS-1, CAL and ACT sequences were deposited in GenBank as accession numbers MT571330, MW192791, MW192792 and MW140016. Pathogenicity was confirmed by spraying a spore suspension (1×106 spores/ml) of 7-day-old culture of isolate C onto 10 healthy inflorescences on five healthy Thai basil plants. Ten infloresences from an additional five control plants were only sprayed with sterile distilled water and the inoculated plants were covered with plastic bags for 2 days and maintained in a greenhouse at 28 ± 1°C, 98% relative humidity with a photoperiod of 12-h. Blossom blight symptoms resembling those observed in the field developed after 7 days on all inoculated inflorescences, while inflorescences on control plants remained asymptomatic. The experiment was repeated twice. C. siamense was successfully re-isolated from the infected inflorescences fulfilling Koch’s postulates. C. siamense has been reported causing blossom blight of Uraria in India (Srivastava et al. 2017), anthracnose on dragon fruit in India and fruits of Acca sellowiana in Brazil (Abirami et al. 2019; Fantinel et al. 2017). This pathogen can cause a serious threat to cultivation of Thai basil and there is currently no effective disease management strategy to control this disease. To our knowledge, this is the first report of blossom blight caused by C. siamense on Thai basil in Malaysia.

Sign in / Sign up

Export Citation Format

Share Document