First Report of Capsicum chlorosis virus Infecting Chromolaena odorata L. in Yunnan, China

Capsicum chlorosis virus (CaCV) is a negative sense ssRNA virus belonging to the genus Orthotospovirus in the family Tospoviridae. It was first discovered in Australia, and then reported in other places including Thailand, China, India, Greece, and United States (Zheng et al.2011; Melzer et al.2014; Chrysoula et al. 2018; Abudurexiti et al. 2019). CaCV infects plants of the families Amaranthaceae, Apocynaceae, Chenopodiaceae, Cucurbitaceae, Amaryllidaceae, Fabaceae and Solanaceae (Basavaraj et al. 2017; Basavaraj et al. 2020). Chromolaena odorata L. (commonly known as Feiji cao in China) is an invasive weedy herb that belongs to the genus Eupatorium (family Asteraceae), and is native to Central America. In May 2020, serrated chlorotic ring and chlorotic ringspots resembling symptoms of orthotospovirus infection (Supplementary Figure 1) was observed on the leaves of C. odorata plants in Honghe County, Yunnan. Three symptomatic leaf samples were collected and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using antisera targeting Tomato spotted wilt virus (TSWV), Calla lily chlorotic spot virus (CCSV), Capsicum chlorosis virus (CaCV), and Tomato zonate spot virus (TZSV) (Proteintech Group, Inc., China). Buffer solution and healthy leaves were used as a blank and negative controls, respectively. All three symptomatic samples showed positive reactions with only CaCV antiserum (OD450 of 0.315-0.345 relative to 0.078 and 0.076 for healthy plants and the blank control, respectively. The total RNA extracted from the positive samples were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using generic primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435c (CATDGCRCAAGARTGRTARACAGA) which were designed to amplify partial L segment encoding the RNA-dependent RNA polymerase (RdRP) of orthotospoviruses (Chu, et al. 2001). The expected ~800 bp DNA fragment was amplified from all three positive samples by RT-PCR. The amplified DNA was cloned and sequenced. BLAST search of the partial L RNA sequence (GenBank acc. nos. MW964378 to MW964380) revealed that they shared 86.2-97.4% nucleotide (nt) and 97.2-100% amino acid (aa) sequence identities with different isolates of CaCV available in GenBank with CaCV chili isolates (KU941834 to KU941836) from India sharing the highest aa identity of 100%. This confirmed the presence of CaCV in the symptomatic C. odorata plants. The 825 bp complete nucleocapsid protein (NP) of CaCV was also amplified from the samples using primers CaCV-F: ATGTCTAMCGTYAGGCAAC and CaCV-R: TYACACYTCWATAGAWGTACTAG) (Basavaraj et al. 2020), cloned, and sequenced to obtain complete S fragment-nucleocapsid protein (NP) with a size of 825 bp (MW964381 to MW964383). The pairwise comparisons of three fragments showed 85.1-98.3% nt and 87.6-99.6% aa sequence identities with different isolates of CaCV. Maximum-Likelihood phylogenetic trees inferred from the partial RdRP and complete NP aa sequences showed that the C. odorata isolates (CaCV-YN) clustered closely with CaCV tomato isolate from Taiwan and tomato (Yuxi-2013) isolate from China, respectively (Supplementary Figure 1). To our knowledge, this is the first time CaCV has been detected in C. odorata. This study will serve as an important reference for the study of host range of CaCV. Further studies will be required to determine whether thrips could transmit CaCV between C. odorata and other hosts of the virus.

Download Full-text

Iris yellow spot virus: A New Onion Disease in Spain

Plant Disease ◽

10.1094/pd-89-1243a ◽

2005 ◽

Vol 89 (11) ◽

pp. 1243-1243 ◽

Cited By ~ 14

Author(s):

C. Córdoba-Sellés ◽

L. Martínez-Priego ◽

R. Muńoz-Gómez ◽

C. Jordá-Gutiérrez

Keyword(s):

Plant Protection ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Pcr Assay ◽

Spot Virus ◽

Nucleocapsid Gene ◽

Pcr Product ◽

Mediterranean Plant

So far, only three viral diseases have been identified in onion crops grown in Spain. These are Tomato spotted wilt virus (TSWV), Onion yellow dwarf virus (OYDV), and Leek yellow stripe virus (LYSV). In September 2003, unusual virus-like symptoms including straw-colored, dry, tan, diamond-shaped lesions on the leaves and stalks, sometimes with necrotic lesions, curled leaves, and bulbs of reduced size, were observed on several onion plants (Allium cepa L.) in commercial fields in Albacete, Spain. Severely affected plants eventually died. To verify the identity of the disease found in the Spanish onions, double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed on leaf extracts of symptomatic onions using specific polyclonal antibodies against OYDV, LYSV, Cucumber mosaic virus (CMV) (Biorad Phyto-Diagnostics, Marnes-La Coquette, France), Iris yellow spot virus (IYSV), and TSWV (Loewe Biochemica, Sauerlach, Germany). All samples of infected onion tissue were positive for IYSV and negative for the other viruses tested. To confirm the ELISA results, viral RNA was extracted from five of the ELISA-positive onion samples, a healthy onion plant, and a positive control for IYSV (DSMZ, Braunschweig. Germany). The extracted RNA was used in a One-Step reverse transcription-polymerase chain reaction (RT-PCR) assay using SuperScript Platinum Taq (Invitrogen Life Technologies, Barcelona, Spain) in the presence of the IYSV1S and IYSV1A primers for the nucleocapsid gene of IYSV (1). The RT-PCR assay produced an amplicon of the expected size of 790 bp. No amplification products were observed when healthy plants or a water control were used as templates in the RT-PCR reaction. To establish the authenticity of the virus from onion, the PCR products were purified (High Pure PCR Product Purification Kit, Roche Diagnostics, Mannheim, Germany), sequenced, and the nucleotide sequences obtained were analyzed and compared with the published sequences in GenBank. The PCR product was 97% identical to the sequence of the IYSV nucleocapsid gene (Genbank Accession No. AB121026). IYSV, an emerging tospovirus that is potentially a devastating pathogen of onion, has been reported in many locations in Brazil, Japan, the Netherlands, Israel, Australia, the western United States, Slovenia, and Iran (2). IYSV is included in the European and Mediterranean Plant Protection Organization alert list of viruses (2), and to our knowledge, this is the first report of IYSV in Spain. This tospovirus is transmitted in a propagative manner by Thrips tabaci. Although the vector is present in large populations in the onion-growing areas in Spain, the efficiency of the Mediterranean ecotype in transmitting IYSV is not known. References: (1) B. A. Coutts et al. Australas. Plant Pathol. 32:555, 2003. (2) European and Mediterranean Plant Protection Organization. EPPO on-line publication at www.eppo.org/QUARANTINE/Alert_List/Viruses/irysxx.html .

Download Full-text

Serological and Molecular Assays for Rapid and Sensitive Detection of Iris yellow spot virus Infection of Bulb and Seed Onion Crops

Plant Disease ◽

10.1094/pdis-92-4-0588 ◽

2008 ◽

Vol 92 (4) ◽

pp. 588-594 ◽

Cited By ~ 24

Author(s):

H. R. Pappu ◽

I. M. Rosales ◽

K. L. Druffel

Keyword(s):

Real Time ◽

Rapid Detection ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Sensitive Detection ◽

Detection Methods ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Spot Virus

Iris yellow spot virus (IYSV) has spread rapidly in the United States and has become an important economic constraint to the production of both bulb and seed onion crops. Symptoms caused by IYSV may be confused with those caused by other fungal and bacterial pathogens and virus-specific, reliable, sensitive, and rapid detection methods would improve the diagnosis. Antiserum was produced to Escherichia coli-expressed nucleocapsid protein of IYSV and an indirect format of the enzyme-linked immunosorbent assay (ELISA) was developed. IYSV could be detected in onion tissue at dilutions of up to 1:1,000. An IYSV-specific primer pair was designed and used in a real-time reverse-transcription polymerase chain reaction (RT-PCR) assay for the rapid detection of IYSV. Compared with standard RT-PCR, real-time RT-PCR was more rapid and sensitive. A commercially available RNA extraction kit and a total nucleic acid extraction method were compared for the quality of the templates obtained for use in real-time RT-PCR and there was no difference in limits of detection. Availability of ELISA- and PCR-based rapid and sensitive detection methods would facilitate accurate virus diagnosis and aid in better understanding of the epidemiology of the disease and in development of management strategies.

Download Full-text

First Report of Vidalia Onion (Allium cepa) Naturally Infected with Tomato spotted wilt virus and Iris yellow spot virus (Family Bunyaviridae, Genus Tospovirus) in Georgia

Plant Disease ◽

10.1094/pdis.2004.88.11.1285b ◽

2004 ◽

Vol 88 (11) ◽

pp. 1285-1285 ◽

Cited By ~ 19

Author(s):

S. W. Mullis ◽

D. B. Langston ◽

R. D. Gitaitis ◽

J. L. Sherwood ◽

A. C. Csinos ◽

...

Keyword(s):

Tomato Spotted Wilt Virus ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Unknown Etiology ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Spot Virus ◽

Tomato Spotted Wilt ◽

Wilt Virus

Vidalia onion is an important crop in Georgia's agriculture with worldwide recognition as a specialty vegetable. Vidalia onions are shortday, Granex-type sweet onions grown within a specific area of southeastern Georgia. Tomato spotted wilt virus (TSWV) has been endemic to Georgia crops for the past decade, but has gone undetected in Vidalia onions. Tobacco thrips (Frankliniella fusca) and Western flower thrips (Frankliniella occidentalis) are the primary vectors for TSWV in this region, and a number of plant species serve as reproductive reservoirs for the vector or virus. Iris yellow spot virus (IYSV), an emerging tospovirus that is potentially a devastating pathogen of onion, has been reported in many locations in the western United States (2,4). Thrips tabaci is the known vector for IYSV, but it is unknown if noncrop plants play a role in its epidemiology in Georgia. During October 2003, a small (n = 12) sampling of onions with chlorosis and dieback of unknown etiology from the Vidalia region was screened for a variety of viruses, and TSWV and IYSV infections were serologically detected. Since that time, leaf and bulb tissues from 4,424 onion samples were screened for TSWV and IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) with commercial kits (Agdia Inc., Elkhart, IN). Samples were collected from 53 locations in the Vidalia region during the growing season between November 2003 and March 2004. Plants exhibiting stress, such as tip dieback, necrotic lesions, chlorosis or environmental damage were selected. Of these, 306 were positive for TSWV and 396 were positive for IYSV using positive threshold absorbance of three times the average plus two standard deviations of healthy negative onion controls. Positive serological findings of the onion tissues were verified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) for TSWV (3) and RT-PCR for IYSV (1). In both instances, a region of the viral nucleocapsid (N) gene was amplified. The PCR products were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose. Eighty-six percent (n = 263) of the TSWV ELISA-positive samples exhibited the expected 774-bp product and 55 percent (n = 217) of the IYSV ELISA-positive samples exhibited the expected 962-bp product. The reduced success of the IYSV verification could be attributed to the age and deteriorated condition of the samples at the time of amplification. Thrips tabaci were obtained from onion seedbeds and cull piles within the early sampling (n = 84) and screened for TSWV by the use of an indirect-ELISA to the nonstructural (NSs) protein of TSWV. Of the thrips sampled, 25 were positive in ELISA. While the incidence of IYSV and TSWV in the Vidalia onion crop has been documented, more research is needed to illuminate their potential danger to Vidalia onions. References: (1) I. Cortês et al. Phytopathology 88:1276, 1998. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) R. K. Jain et al. Plant Dis. 82:900, 1998. (4) J. W. Moyer et al. (Abstr.) Phytopathology 93(suppl.):S115, 2003.

Download Full-text

Lisianthus Leaf Necrosis: A New Disease of Lisianthus Caused by Iris yellow spot virus

Plant Disease ◽

10.1094/pdis.2000.84.11.1185 ◽

2000 ◽

Vol 84 (11) ◽

pp. 1185-1189 ◽

Cited By ~ 31

Author(s):

A. Kritzman ◽

H. Beckelman ◽

S. Alexandrov ◽

J. Cohen ◽

M. Lampel ◽

...

Keyword(s):

Polyclonal Antibodies ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Spot Virus ◽

Systemic Necrosis ◽

Nucleocapsid Gene ◽

Pcr Product ◽

Wilt Virus

Unusual viral symptoms were seen on lisianthus (Eustoma russellianum) grown in the Besor area in Israel. Symptoms included necrotic spots and rings on leaves and systemic necrosis. Preliminary analyses suggested that the disease was caused by a tospovirus. Virus particles typical of a tospovirus were observed with electron microscopy in samples taken only from symptomatic leaves. Double-antibody sandwich enzyme-linked immunosorbent assay tests of leaf sap, extracted from lisianthus and mechanically inoculated indicator plants, gave a strong positive reaction to Iris yellow spot virus (IYSV). Polyclonal antibodies prepared against IYSV enabled specific detection of the virus in crude sap from infected plants. Western blot analysis showed that IYSV was serologically distinct from Tomato spotted wilt virus (TSWV). Primers specific to the nucleocapsid gene of IYSV were used in a reverse transcription-polymerase chain reaction assay (RT-PCR) to verify the presence of IYSV. RT-PCR gave an expected PCR product of approximately 850 bp. The sequence of the cloned nucleocapsid gene confirmed the identity of IYSV, thus confirming IYSV infection of lisianthus. This is the first report of IYSV infection in dicotyledons.

Download Full-text

Development of a Real-Time RT-PCR SYBR Green Assay for Tomato ring spot virus in Grape

Plant Disease ◽

10.1094/pdis-91-9-1083 ◽

2007 ◽

Vol 91 (9) ◽

pp. 1083-1088 ◽

Cited By ~ 8

Author(s):

Elwin L. Stewart ◽

Xinshun Qu ◽

Barrie E. Overton ◽

Fred E. Gildow ◽

Nancy G. Wenner ◽

...

Keyword(s):

Real Time ◽

Gene Sequence ◽

Sybr Green ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Spot Virus ◽

Sybr Green Assay ◽

One Step ◽

Polymerase Chain ◽

Ring Spot

Grapevines infected with Tomato ring spot virus (ToRSV) pose an economic risk for growers in the northeastern United States. This study describes a one-step real-time reverse-transcription polymerase chain reaction (RT-PCR) SYBR Green assay for detecting ToRSV in grapevines. Two newly designed primer pairs based on the ToRSV coat protein gene sequence were evaluated for specificity and optimized for a SYBR Green assay. The primer pair ToRSV1f/1r yielded a 130-bp product with strong primer-dimer products, whereas the primer pair ToRSV2f/2r yielded a 330-bp product with weak primer dimer products. Real-time RT-PCR detected ToRSV in more naturally infected grapevines maintained in the greenhouse than did enzyme-linked immunosorbent assay. The nucleotide sequences of the fragments amplified from grapevine growing in Pennsylvania using real-time PCR were divergent from previously published sequences.

Download Full-text

Wild Allium spp. as Natural Hosts of Iris yellow spot virus

Plant Disease ◽

10.1094/pd-90-0378a ◽

2006 ◽

Vol 90 (3) ◽

pp. 378-378 ◽

Cited By ~ 7

Author(s):

H. R. Pappu ◽

B. C. Hellier ◽

F. M. Dugan

Keyword(s):

Natural Infection ◽

The State ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Spot Virus ◽

Sequence Comparisons

The incidence of Iris yellow spot virus (IYSV) of genus Tospovirus, family Bunyaviridae in a commercial onion crop was first confirmed in Washington state during 2003 (1). First found in Adams County, IYSV has rapidly spread to all onion-producing counties in the state, affecting seed and bulb crops. The USDA-ARS Western Regional Plant Introduction Station (WRPIS) collects, maintains, and distributes various Allium (garlic and onion) accessions. As part of the regeneration process, accessions are grown under field conditions at the WRPIS farms in two locations: Pullman and Central Ferry, WA. Symptoms indicative of viral infection, now known to be caused by IYSV, first appeared in field-grown accessions in 1999. In June 2005, leaf and scape tissues were collected from WRPIS accessions of wild onions (Allium pskemense, A. vavilovii, and A. altaicum) in Central Ferry that had symptoms indicative of IYSV infection (2). IYSV infection was confirmed using enzyme-linked immunosorbent assay with a commercially available kit (Agdia Inc., Elkhart, IN). Virus infection was further verified using reverse transcription-polymerase chain reaction (RT-PCR) with primers derived from the small (S) RNA of IYSV. The primers flanked the IYSV N gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′). RT-PCR gave a PCR product of expected size (≈1.2 kb). The DNA amplicon was cloned and sequenced. Nucleotide sequence comparisons with known IYSV N gene sequences showed 95 to 98% sequence identity. The prevalence of the vector, onion thrips (Thrips tabaci), combined with the widespread incidence of IYSV in seed and bulb production areas of the state may have resulted in natural infection of wild relatives of cultivated onion. The potential role of wild Allium spp. in IYSV epidemiology remains to be determined. Information on the extent of IYSV infection of onion germplasm would be useful in identifying potential sources of host plant resistance to IYSV. References: (1) L. J. du Toit et al. Plant Dis. 88:222, 2004. (2) B. Hellier et al. APSnet Image of the Week. Online publication, iw000049.asp, 2004.

Download Full-text

Capsicum chlorosis virus (Genus Tospovirus) Infecting Chili Pepper (Capsicum annuum) in India

Plant Disease ◽

10.1094/pdis-92-10-1469b ◽

2008 ◽

Vol 92 (10) ◽

pp. 1469-1469 ◽

Cited By ~ 25

Author(s):

M. Krishnareddy ◽

R. Usha Rani ◽

K. S. Anil Kumar ◽

K. Madhavi Reddy ◽

H. R. Pappu

Keyword(s):

Capsicum Annuum ◽

Direct Sequencing ◽

Disease Incidence ◽

Sandwich Elisa ◽

Chili Pepper ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Capsicum Chlorosis Virus

Chili pepper (Capsicum annuum L.) is one of the most important spice crops in India. In October of 2006, symptoms indicative of tospovirus infection were noticed in several commercial fields of chili pepper near Bangalore in Karnataka State. Chlorotic and necrotic spots and rings on leaves, apical necrosis, and leaf distortion were observed. Disease incidence was more than 20%. Mechanical inoculation with sap extracts from these symptomatic plants showed that the host range and symptomatology of the virus was similar to those described for Capsicum chlorosis virus (CaCV) (1,3). The virus reacted with antisera specific to Groundnut bud necrosis virus (GBNV) and Watermelon silver mottle virus of serogroup IV tospoviruses in antigen-coated plate ELISA. It did not react with antisera specific to Tomato spotted wilt virus, Impatiens necrotic spot virus, or Iris yellow spot virus in double-antibody sandwich-ELISA. Immunosorbent electron microscopy of infected sap using GBNV antiserum revealed the presence of strongly decorated quasi-spherical virus particles. Reverse transcription (RT)-PCR was conducted to further identify the virus. No amplification was observed from extracts of symptomatic plants (n = 10) by RT-PCR using GBNV-specific primers (4), indicating that the diseased chili was not infected with GBNV. However, a DNA fragment of approximately 850 bp was amplified by using primers specific to the nucleocapsid (N) gene of CaCV (CaCF 5′-CTATAGAWGTACTAGGCTTTGAGC-3′ and CaCR 5′-CATGTCTAACGTCAGGCAACTTAC-3′). Direct sequencing of the amplicon (GenBank Accession No. EF625227) revealed a nucleotide sequence identity ranging from 85.5% with isolates from Thailand (GenBank Accession Nos. AY846366, AY647437, and AF134400) and China (GenBank Accession No. DQ355974) to 98.1% with isolates from Australia (GenBank Accession Nos. AY036057 and AY036058). Phylogenetic analysis of the N protein sequences showed that the chili pepper isolate from India formed a cluster with those from Australia. This cluster was distinct from the one formed by the peanut isolates from Thailand and a tomato isolate from India (2). To our knowledge, this is the first report of CaCV infection of chili pepper in India. The potential impact of CaCV on tomato and chili pepper production in India remains to be seen. References: (1) D. Knierim et al. Arch. Virol. 90:377, 2006. (2) S. Kunkalikar et al. Online publication. doi:10.1094/PHP-2007-1204-01-BR. Plant Health Progress, 2007. (3) L. A. Mc Michael et al. Aust. Plant Pathol. 31:231, 2002. (4) K. Umamaheswaran et al. Indian Phytopathol. 56:168, 2003.

Download Full-text

First report of papaya ring spot virus (PRSV) infecting jute (Corchorus olitorius) in India

Plant Disease ◽

10.1094/pdis-03-21-0652-pdn ◽

2021 ◽

Author(s):

C. Biswas ◽

P. Dey ◽

Veegala Ramesh Babu ◽

N. M. Alam ◽

Gouranga Kar

Keyword(s):

Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Post Inoculation ◽

Rt Pcr ◽

Potato Leaf ◽

Spot Virus ◽

First Report ◽

Leaf Tissues ◽

Papaya Ring Spot Virus ◽

Ring Spot

Jute is the most important bast fibre crop of the world, which is mainly cultivated in India, Nepal, Bangladesh, China, Indonesia and South American countries. The fibre is utilized for making apparels, ropes, bags, carpets etc (Biswas et al. 2014). This bio-fibre is gaining importance due to growing environmental consciousness worldwide. In June 2019, we noticed jute plants (less than 2%) showing virus like symptoms viz., downward curling, puckering, angular brownish to yellowish spots etc in a farmer’s field at Amdanga Block, North 24 Paraganas, West Bengal, India. To identify the virus, five symptomatic leaves from five different plants were used for high throughput sequencing (HTS). We extracted total RNA from each leaf which was subjected to construction of cDNA libraries. Sequencing was done on Illumina Hiseq 4000 (CytoScan, Thermo Fisher). Approximately 46 million 105 nt paired end reads were generated. Raw reads were trimmed and filtered to perform de novo assembly as described previously by (Grabherr et al. 2013). The obtained contig was 10,326 bp nucleotides (nt) long and in BLASTn against GenBank showed highest identity with papaya ring spot virus (PRSV) with the contig covering 99.6% of the viral genome. The obtained contig shared 99.33% sequence similarity with PRSV strain P (Accession No. MT470188). The selected leaf samples were also tested by double-antibody sandwich (DAS)- enzyme linked immunosorbent assay (ELISA) for papaya ring spot virus (PRSV) along with some common viruses, viz., Potato leaf roll virus (PLRV), Watermelon mosaic virus, Cowpea mosaic virus and Cucumber mosaic virus with the help of commercial diagnostic kits (Agdia). However, only the test with PRSV gave positive reaction for the symptomatic samples. The major symptoms of PRSV on papaya are severe mosaic, chlorosis, reduced lamina with curling and puckering (Gonsalves et al. 2010). To confirm PRSV infection, five symptomatic leaf samples (used for HTS) were collected and whole RNA was extracted from the samples using RNeasy plant minikit (Qiagen, USA). Reverse transcriptase polymerase chain reaction (RT-PCR) was conducted by using isolated RNA. One pair of PRSV specific primer (PSRV1F: 5' TTAAATCTGATTCGTC 3' PRSV 1R: 5'GAAATTCACGCAAAGTCGA3') was developed by using primer BLAST software and was used in RT-PCR assays. Amplified fragments were cloned and sequenced and all the fragments shared 98% sequence identity with PRSV. One of the amplicons was deposited in NCBI (Accession No. MN615832). Crude sap was prepared by homogenizing PRSV-infected jute leaf tissues in 0.1 M sodium phosphate buffer and 2% carborundum dust was added as abrasive (Holkar et al. 2018). The sap was then gently rubbed on to the healthy papaya leaves for inoculation. Typical PRSV like symptoms appeared in inoculated leaves 10 days post inoculation which confirmed the presence of PRSV-P. PRSV was detected by RT-PCR as well as (DAS)-ELISA from all inoculated infected papaya leaf tissues, but could not be detected from uninoculated healthy papaya tissues. To the best of our knowledge, this is the first report of PRSV-P infecting jute in India. References: Biswas, C. et al. 2014. Plant Dis. 98(4): 565. https:// doi.org/10.1094/PDIS-08-13-0826-PDN. Gonsalves, D. et al. 2010. The Plant Health Instructor. https:// doi.org/10.1094/PHI-I-2010-1004-01 Holkar, S. K. et al. 2018. Crop Protection. 108:110-119. https://doi.org/10.1016/j.cropro.2017.12.013 Grabherr, M. et al. 2011. Nat Biotechnol. 29(7): 644-652.

Download Full-text

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio

Plant Disease ◽

10.1094/pdis-06-14-0639-pdn ◽

2015 ◽

Vol 99 (1) ◽

pp. 163-163 ◽

Cited By ~ 17

Author(s):

F. Baysal-Gurel ◽

R. Li ◽

K.-S. Ling ◽

S. A. Miller

Keyword(s):

Nucleocapsid Protein ◽

Protein Gene ◽

Rt Pcr ◽

Spot Virus ◽

High Tunnel ◽

Chlorotic Spot ◽

Tomato Seedlings ◽

Pcr Product ◽

Nucleocapsid Protein Gene ◽

Das Elisa

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

Download Full-text

First report of a secovirus associated with mountain celery chlorotic spot disease in Heilongjiang, China

Plant Disease ◽

10.1094/pdis-07-21-1418-pdn ◽

2021 ◽

Author(s):

Yameng Luan ◽

Lili Zhang ◽

Ting Sun ◽

Xue Jiang ◽

Xiaoyun Wu ◽

...

Keyword(s):

Small Rna ◽

Phylogenetic Trees ◽

Plant Viruses ◽

Tomato Mosaic Virus ◽

Perennial Herb ◽

Rt Pcr ◽

First Report ◽

Chlorotic Spot ◽

Separate Branch ◽

Sequence Identities

Mountain celery (Heracleum moellendorffii Hance), an edible perennial herb of Northeast Asia, is sporadically cultivated as a vegetable crop or for medicinal purposes in Northeast China and Korea [1]. In July 2019, a small field of mountain celeries showing chlorotic spots was found in Wangkui, Heilongjiang, China. A small-RNA (sRNA) library was constructed with equal amounts of leaf tissues of a diseased mountain celery and a tomato sample showing mottling symptom from a nearby field using the TruSeq small RNA library preparation kit (Illumina). The library was sequenced by the HiSeq 4000 sequencer at Lianchuan Biotechnology Co., Ltd (Hangzhou, China). After trimming adaptor sequences and discarding low quality reads by Cutadapt [2], the remaining 6,949,946 reads of 17 to 27 nucleotides (nt) were de novo assembled as described [3]. The resulting 395 contigs were searched against the GenBank viral sequence database using the BLASTn and BLASTx algorithms. Twenty-three contigs showed high nt sequence similarities (89-100%) to the genomic sequence of tomato mosaic virus (ToMV). The deduced amino acid (aa) sequences of thirty contigs had 22-96% aa sequence identities to viruses in the family Secoviridae, e.g., surrounding non-legume associated secovirus (snLaSV) and lettuce secovirus 1 (LSV-1). No contig homologous to the genomic sequences of other plant viruses was identified. Total RNAs were extracted from the mountain celery and tomato separately and reverse transcribed into cDNAs by random hexamer plus Oligo-dT(18) using the Super® IV Reverse Transcriptase (Invitrogen, Shanghai, China). Polymerase chain reactions (PCR) showed that the secovirus was derived from the mountain celery, whereas the tomato was infected by ToMV. The genome of this secovirus was determined by reverse transcription (RT)-PCR and rapid amplification of cDNA ends (RACE). Amplicons were cloned and Sanger sequenced with at least three independent clones per amplicon. Sequences were assembled by the SeqMan Pro 7.1.0 in the Lasergene (DNASTAR, Madison, WI). The genome of this virus is composed of two RNAs of 6,616 and 5,356 nt (excluding the polyadenylic acid tails) (GenBank accession nos. MW143070 and MW143071, respectively). The thirty contigs assembled from sRNAs could be mapped to the genome. Pairwise sequence analyses showed that RNA1 and RNA2 and their encoded polyproteins shared the highest nt (82.7% and 82.2%) and aa (93.4% and 91.8%) sequence identities with the respective RNAs (GenBank accession nos. MN412739 and MN412740) and their encoded polyproteins of snLaSV [4]. In the phylogenetic trees, this virus sequence clustered with snLaSV and LSV-1 in a separate branch neighboring viruses of the subgenus Stramovirus or Satsumavirus in the genus Sadwavirus. These results suggest that this virus is an isolate of the unclassified snLaSV and was referred as snLaSV-CHN. RT-PCR with primers SecoR1-3700F and SecoR1-5100R confirmed the presence of snLaSV-CHN in other mountain celeries (11 of 23 tested) showing chlorotic spots symptoms but not in healthy ones from the same field. To the best of our knowledge, this is the first report of snLaSV infecting mountain celery in China and a more orthodox name, mountain celery chlorotic spot virus (MCCSV), is tentatively proposed. Our findings provide a better insight of the distribution and host range of this virus and further surveys are necessary to determine its incidence and damage in mountain celery. Funding: This study is financial supported by the Program for the Scientific Activities of Selected Returned Overseas Professionals in Heilongjiang Province (Grant No. 2018QD0002) and the China National Funds for Excellent Young Scientists (Grant No. 32022071). References Son, H. J. 2020. Food Sci Nutr. 9:514. Martin, M. 2011. EMBnet J. 17:10. Che, X., et al. 2020. Plant Dis. 104: 3085. Gaafar, Y. Z. A., et al. 2020. Front Microbiol. 11: 583242.

Download Full-text