scholarly journals First report of a secovirus associated with mountain celery chlorotic spot disease in Heilongjiang, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yameng Luan ◽  
Lili Zhang ◽  
Ting Sun ◽  
Xue Jiang ◽  
Xiaoyun Wu ◽  
...  
Keyword(s):  
Small Rna ◽  
Phylogenetic Trees ◽  
Plant Viruses ◽  
Tomato Mosaic Virus ◽  
Perennial Herb ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Spot ◽  
Separate Branch ◽  
Sequence Identities

Mountain celery (Heracleum moellendorffii Hance), an edible perennial herb of Northeast Asia, is sporadically cultivated as a vegetable crop or for medicinal purposes in Northeast China and Korea [1]. In July 2019, a small field of mountain celeries showing chlorotic spots was found in Wangkui, Heilongjiang, China. A small-RNA (sRNA) library was constructed with equal amounts of leaf tissues of a diseased mountain celery and a tomato sample showing mottling symptom from a nearby field using the TruSeq small RNA library preparation kit (Illumina). The library was sequenced by the HiSeq 4000 sequencer at Lianchuan Biotechnology Co., Ltd (Hangzhou, China). After trimming adaptor sequences and discarding low quality reads by Cutadapt [2], the remaining 6,949,946 reads of 17 to 27 nucleotides (nt) were de novo assembled as described [3]. The resulting 395 contigs were searched against the GenBank viral sequence database using the BLASTn and BLASTx algorithms. Twenty-three contigs showed high nt sequence similarities (89-100%) to the genomic sequence of tomato mosaic virus (ToMV). The deduced amino acid (aa) sequences of thirty contigs had 22-96% aa sequence identities to viruses in the family Secoviridae, e.g., surrounding non-legume associated secovirus (snLaSV) and lettuce secovirus 1 (LSV-1). No contig homologous to the genomic sequences of other plant viruses was identified. Total RNAs were extracted from the mountain celery and tomato separately and reverse transcribed into cDNAs by random hexamer plus Oligo-dT(18) using the Super® IV Reverse Transcriptase (Invitrogen, Shanghai, China). Polymerase chain reactions (PCR) showed that the secovirus was derived from the mountain celery, whereas the tomato was infected by ToMV. The genome of this secovirus was determined by reverse transcription (RT)-PCR and rapid amplification of cDNA ends (RACE). Amplicons were cloned and Sanger sequenced with at least three independent clones per amplicon. Sequences were assembled by the SeqMan Pro 7.1.0 in the Lasergene (DNASTAR, Madison, WI). The genome of this virus is composed of two RNAs of 6,616 and 5,356 nt (excluding the polyadenylic acid tails) (GenBank accession nos. MW143070 and MW143071, respectively). The thirty contigs assembled from sRNAs could be mapped to the genome. Pairwise sequence analyses showed that RNA1 and RNA2 and their encoded polyproteins shared the highest nt (82.7% and 82.2%) and aa (93.4% and 91.8%) sequence identities with the respective RNAs (GenBank accession nos. MN412739 and MN412740) and their encoded polyproteins of snLaSV [4]. In the phylogenetic trees, this virus sequence clustered with snLaSV and LSV-1 in a separate branch neighboring viruses of the subgenus Stramovirus or Satsumavirus in the genus Sadwavirus. These results suggest that this virus is an isolate of the unclassified snLaSV and was referred as snLaSV-CHN. RT-PCR with primers SecoR1-3700F and SecoR1-5100R confirmed the presence of snLaSV-CHN in other mountain celeries (11 of 23 tested) showing chlorotic spots symptoms but not in healthy ones from the same field. To the best of our knowledge, this is the first report of snLaSV infecting mountain celery in China and a more orthodox name, mountain celery chlorotic spot virus (MCCSV), is tentatively proposed. Our findings provide a better insight of the distribution and host range of this virus and further surveys are necessary to determine its incidence and damage in mountain celery. Funding: This study is financial supported by the Program for the Scientific Activities of Selected Returned Overseas Professionals in Heilongjiang Province (Grant No. 2018QD0002) and the China National Funds for Excellent Young Scientists (Grant No. 32022071). References Son, H. J. 2020. Food Sci Nutr. 9:514. Martin, M. 2011. EMBnet J. 17:10. Che, X., et al. 2020. Plant Dis. 104: 3085. Gaafar, Y. Z. A., et al. 2020. Front Microbiol. 11: 583242.

scholarly journals First report of bean common mosaic virus infecting heavenly bamboo (Nandina domestica) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiu Su ◽  
Xiang Zhou ◽  
Yuan Li ◽  
Liangjin Ma ◽  
Xiaofei Cheng ◽  
...  
Keyword(s):  
New England ◽  
Mosaic Virus ◽  
Small Rna ◽  
Phylogenetic Trees ◽  
Genomic Sequence ◽  
Bean Common Mosaic Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Plantago Asiatica

Heavenly bamboo (Nandina domestica) is an evergreen ornamental plant with worldwide distribution. In May 2018, seven out of twenty N. domestica plants showing virus-like symptoms, such as yellow mosaic and curling, were observed in Lin’an, Zhejiang province. To determine the causal agent, a small RNA library was constructed using the Small RNA v1.5 Sample Prep Kit (Illumina, San Diego, USA) with total RNA extracted from leaves of a symptomatic plant. The library was sequenced by the Solexa platform at BGI Genomics (Shenzhen, China). A total number of 21,071,675 high-quality reads of 17-28 nucleotides (nt) in length remained after trimming adapter sequences and quality control. Reads were assembled using Velvet 0.7.31 and Oases 0.2.07 with the k-mer value of 17 (Schulz et al. 2012). BlastN and BlastX search against the GenBank viral nonredundant sequence databases revealed fifty-six contigs homologous to bean common mosaic virus (BCMV; genus Potyvirus; family Potyviridae). No contig homologous to the genomic sequence of other plant-infecting viruses was identified. These contigs were further assembled into a 9,315-nt fragment by SeqMan Pro 7.1.0 in Lasergene package (DNASTAR, Madison, WI), which covered 92.68% of the genome of BCMV strain CT (BCMV-CT; GenBank accession no. KM076650). The genome of this BCMV isolate (BCMV-NTZ1) was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using primers designed based on assembled contigs with the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Beijing, China) and the FirstChoice® RLM-RACE Kit (Invitrogen, Carlsbad, USA), respectively. Amplicons were cloned and Sanger sequenced with three independent clones per amplicon. The genome is 10,052 nt in length excluding the poly-A tail (Genbank accession no. MZ670770) and shared the highest nt sequence identities with BCMV-CT (88.46%). The putative polyprotein shared 93.36% amino acid (aa) sequence identity with that of BCMV-CT. BCMV-NTZ1 also clustered with BCMV-CT in phylogenetic trees based on BCMV full genomes and aa sequences of coat protein. Five-leaf-stage seedlings of Nicotiana tabacum, N. benthamiana, Glycine max (Linn.) Merr., and Capsicum frutescens were mechanically inoculated with sap of BCMV-infected N. domestica leaves at fifteen plants per species. Seedlings of G. max developed virus-like (mosaic and leaf deformity) symptoms (7/15) at 15 days post-inoculation, while other plants remained symptomless throughout the experiment. Subsequent RT-PCR on all the plants using primers 27F1/14Rter and sequencing confirmed the presence and absence of BCMV-NTZ1 in all symptomatic G. max seedlings and other asymptomatic indicator plants, respectively. Subsequent RT-PCR survey further confirmed the association of BCMV with symptomatic heavenly bamboo samples but not asymptomatic plants (7/20). To the best of our knowledge, this is the first report of BCMV naturally infecting heavenly bamboo in China. N. domestica is susceptible to many viruses, e.g., cucumber mosaic virus, plantago asiatica mosaic virus, nandina stem pitting virus, apple stem grooving virus, and alternanthera mosaic virus (Barnett et al. 1973; Ahmed et al. 1983; Hughes et al. 2002, 2005; Tang et al. 2010; Wei et al. 2015). Our results indicate that N. domestica can also serve as an overwinter reservoir for BCMV and special attention should be paid to the damage it may cause.

scholarly journals First Report of Lettuce big-vein associated virus (Varicosavirus) Infecting Lettuce in Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 573-573 ◽  
Author(s):  
D. L. Ochoa-Martínez ◽  
J. Alfonsina-Hernández ◽  
J. Sánchez-Escudero ◽  
D. Rodríguez-Martínez ◽  
J. Vera-Graziano
Keyword(s):  
Mosaic Virus ◽  
Consensus Sequence ◽  
Leaf Tissue ◽  
Plant Viruses ◽  
Australian Isolate ◽  
Healthy Plant ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Spot ◽  
Spanish Isolate

Lettuce (Lactuca sativa) is a common consumed vegetable and a major source of income and nutrition for small farmers in Mexico. This crop is infected with at least nine viruses: Mirafiori lettuce big-vein virus (MiLBVV), Lettuce big-vein associated virus (LBVaV), both transmitted by the soil-borne fungus Olpidium brassicae; Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), Groundnut ringspot virus (GRSV), Lettuce mottle virus (LMoV), Cucumber mosaic virus (CMV), Bidens mosaic virus (BiMV), and Lettuce mosaic virus (LMV) (1). From March to May 2012, a disease on lettuce was observed in the south region of Mexico City displaying mild to severe mosaic, leaf deformation, reduced growth, slight thickening of the main vein, and plant death. At the beginning of the epidemic there were just a few plants with visible symptoms and 7 days later the entire crop was affected, causing a loss of 93% of the plants. It was estimated by counting the number of severely affected or dead plants in three plots. No thrips, aphids, or whiteflies were observed in the crop during this time. Twenty plants with similar symptoms were collected and tested by RT-PCR using the primers LBVaVF 5′-AACACTATGGGCATCCACAT-3′ and LBVaVR 5′-GCATGTCAGCAATCAGAGGA-3′ specific for the coat protein gene of LBVaV, amplifying a 322-bp fragment. Primers CP829F 5′-CCWACTTCATCAGTTGAGCGCTG-3′ and CP1418R 5′-TATCAGCTCCCTACACTATCCTCGC-3′ were used to detect MiLBVV (2). No amplification was obtained for MiLBVaV in any plants tested. PCR products of approximately 300 bp were obtained from four out of 20 symptomatic lettuce samples tested for LBVaV, but not from healthy plant and water controls. These results suggest the presence of another virus in symptomatic lettuce plants. Amplicons were gel-purified and sequenced using LBVaVF and LBVaVR primers. A consensus sequence was generated using the Bioedit v. 5 program. Both sequences of these Mexican lettuce isolates were 100% identical (Accession Nos. KC776266.1 and KC776267.1) and had identities between 94 and 99% to all sequences of LBVaV available in GenBank. Additionally, when alignments were made using ClustalW, these sequences showed identities of 99.7% to Almeria-Spanish isolate (Accession No. AY581686.1); 99.4% to Granada-Spanish isolate (AY581689.1); 99.1% to Dutch isolate (JN710441.1), Iranian isolate (JN400921.1), Australian isolate (GU220725.1), Brazilian isolate (DQ530354.1), England isolate (AY581690.1), and American isolate (AY496053.1); 96.2% to Australian isolate (GU220722.1); 96.3% to Japanese isolate (AB190527.1); and 92.8% to Murcia-Spanish isolate (AY581691.1). Twenty lettuce plants were mechanically inoculated with leaf tissue taken from the four plants collected in the field and tested positive for LBVaV by RT-PCR; 12 days after inoculation, mosaic symptoms were observed in all inoculated plants and six of them were analyzed individually by RT-PCR obtaining a fragment of the expected size. To our knowledge, this is the first report of LBVaV infecting lettuce in Mexico. Further surveys and monitoring of LBVaV incidence and distribution in the region, vector competence of olpidium species, and impact on the crop quality are in progress. References: (1) P. M. Agenor et al. Plant Viruses 2:35, 2008. (2) R. J. Hayes et al. Plant Dis. 90:233, 2006.

scholarly journals First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 761-761 ◽  
Author(s):  
M. I. Font ◽  
M. C. Córdoba-Sellés ◽  
M. C. Cebrián ◽  
J. A. Herrera-Vásquez ◽  
A. Alfaro-Fernández ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Capsicum Annuum ◽  
Polyclonal Antibodies ◽  
Plant Viruses ◽  
Mottle Virus ◽  
Tomato Mosaic Virus ◽  
Rt Pcr ◽  
Tomato Plants ◽  
First Report ◽  
Pepper Plants

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

scholarly journals First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama

Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 198-198 ◽  
Author(s):  
J. A. Herrera-Vásquez ◽  
A. Alfaro-Fernández ◽  
M. C. Córdoba-Sellés ◽  
M. C. Cebrián ◽  
M. I. Font ◽  
...  
Keyword(s):  
Coat Protein ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Potato Virus ◽  
Plant Viruses ◽  
Tomato Mosaic Virus ◽  
Rt Pcr ◽  
Tomato Production ◽  
Related Sequence ◽  
First Report

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5′-CCTCCGCGGATGCTAACTT-3′ and CMV-R 5′-CGGAATCAGACTGGGAGCA-3′) and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

scholarly journals First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Ahmed Sabra ◽  
Mohammed Ali Al Saleh ◽  
I. M. Alshahwan ◽  
Mahmoud A. Amer
Keyword(s):  
Saudi Arabia ◽  
Mosaic Virus ◽  
Solanum Lycopersicum ◽  
Tomato Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Products ◽  
Dark Green ◽  
Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

scholarly journals First Report on the Natural Occurrence of Cherry virus A in Mirabelle Plum (Prunus domestica var. insititia)

Plant Disease ◽  
2005 ◽  
Vol 89 (4) ◽  
pp. 433-433 ◽  
Author(s):  
L. Svanella-Dumas ◽  
A. Marais ◽  
P. Gentit ◽  
J. Lamorte ◽  
T. Candresse
Keyword(s):  
Natural Infection ◽  
Plant Viruses ◽  
Natural Occurrence ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Pcr Assay ◽  
First Report ◽  
Specific Pcr ◽  
Specific Pcr Assay ◽  
Prunus Spp

Cherry virus A (CVA) is a member of the Capillovirus genus (2). It was discovered serendipitously during cloning of the little cherry agent (2) and has since been shown to be relatively widespread in sweet and sour cherry (Prunus cerasus and P. avium) (2,3). It is currently unclear whether CVA is associated with any specific symptoms in these hosts. Although it can be transmitted by grafting and thus propagated in peach, it has not been reported to naturally infect any host other than cherry. Using a degenerate reverse transcription-polymerase chain reaction (RT-PCR) technique targeting a conserved region of the RNA-dependent RNA polymerase (RdRp) and allowing the amplification of members of the Trichovirus, Capillovirus, and Foveavirus genera of filamentous plant viruses (1), a number of symptomatic Prunus spp. germplasm were evaluated. Among these, a cv. Mirabelle dorée accession (Prunus domestica var. insititia P332) of French origin exhibited severe symptoms of rosetting, severe leaf and fruit deformation, and yellow mosaic occasionally turning necrotic. RT-PCR conducted on symptomatic samples produced an amplification product of the expected size (362 bp) in several independent experiments. Sequencing of these products yielded a single sequence (GenBank Accession No. AY792509) with 88.1% nucleotide identity and 93.2% amino acid identity with the type strain of CVA (2). Presence of a CVA isolate was independently confirmed using a CVA-specific PCR assay directly on the original plum material or following experimental transmission by grafting on several new hosts including apricot (P. armeniaca cv. Priana) and plum (P. domestica cv. Prune d'Ente). To our knowledge, this is the first report of natural infection of CVA in plum. The symptoms observed in the infected plum are reminiscent of those caused by severe Prune dwarf virus (PDV) strains. Infection by PDV was confirmed using a PDV-specific PCR assay. The contribution, if any, of CVA to the symptoms observed remains to be evaluated. These findings suggest that the possible presence of CVA in noncherry Prunus spp. hosts should be taken into consideration by quarantine and certification programs. References: (1) X. Foissac et al. Acta Hortic. 550:3743, 2001. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995. (3) M. J. Kirby et al. Plant Pathol. 50:6, 2001.

scholarly journals First Report of Tobacco mild green mosaic virus in Capsicum chinense in Venezuela

Plant Disease ◽  
2006 ◽  
Vol 90 (8) ◽  
pp. 1108-1108 ◽  
Author(s):  
C. Córdoba ◽  
A. García-Rández ◽  
N. Montaño ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Seed Transmission ◽  
Tomato Mosaic Virus ◽  
Capsicum Chinense ◽  
Rt Pcr ◽  
Plant Host ◽  
First Report ◽  
Coat Protein Region ◽  
Pcr Product ◽  
First Time

In July 2003, noticeable deformations of leaves were observed on a local variety of Capsicum chinense, also called ‘Aji dulce’, from a pepper plantation located in Venezuela, (Monagas State). ‘Aji dulce’ is a basic ingredient of the Venezuelan gastronomy with an estimated cultivated area of 2,000 ha. The seeds of this local pepper are obtained by the growers who reproduce and multiply their own seeds every year. Seeds of affected plants were sent to our laboratory, and a group of approximately 100 seeds was sown in a controlled greenhouse that belongs to the Polytechnic University of Valencia, Spain. Three months later, obvious curling and bubbling developed on the leaves of the plants. Extracts of symptomatic plants tested negative for Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Pepper mild mottle virus (PMMV), and Tobacco etch virus (TEV) by double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with policlonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany; Phyto-Diagnostics, INRA, France). Total RNA was isolated from 0.5 g of original seed sent from Venezuela and from 25 samples of leaves of plants grown in the greenhouse with an RNeasy Plant Mini Kit (Qiagen Sciences, Germantown, Maryland). The RNA isolated was used in reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for Tobacco mild green mosaic virus (TMGMV) (1) predicted to amplify a 530 bp of the coat protein region. From all samples, a RT-PCR product of the expected size was obtained and then sequenced. BLAST analysis of one sequence (GenBank Accession No. DQ460731) showed high levels of identity with TMGMV isolates, with more than 99% nucleotide identity with the DSMZ PV-112 isolate (GenBank Accession No. AJ429096). The symptomatology observed on pepper plants, the TMGMV RT-PCR assay, and the consensus of sequenced regions with TMGMV lead us to conclude that TMGMV was the causal agent of the diseased C. chinense plants. Although TMGMV has a wide plant host range occurring worldwide (1), to our knowledge, this is not only the first time TMGMV has been detected in Venezuela, but also the first report of TMGMV in C. chinense in Venezuela and the first reliable probe of the TMGMV seed transmission. Reference: (1) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

scholarly journals First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
T. Tornos ◽  
M. C. Cebrián ◽  
M. I. Font
Keyword(s):  
Plant Viruses ◽  
Dwarf Virus ◽  
Eastern Coast ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Specific Primers ◽  
First Report ◽  
Type Isolate ◽  
The Mean ◽  
Pittosporum Tobira

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

scholarly journals First Report of Alfalfa mosaic virus Infecting Basil (Ocimum basilicum) in California

Plant Disease ◽  
2012 ◽  
Vol 96 (2) ◽  
pp. 295-295 ◽  
Author(s):  
W. M. Wintermantel ◽  
E. T. Natwick
Keyword(s):  
Nucleic Acid ◽  
Mosaic Virus ◽  
Alfalfa Mosaic Virus ◽  
Plant Viruses ◽  
Ocimum Basilicum ◽  
Mechanical Transmission ◽  
Rt Pcr ◽  
Imperial Valley ◽  
First Report ◽  
Production Region

Basil (Ocimum basilicum L.) plants collected from three fields in Imperial County, CA in May, 2011 were found to be exhibiting yellowing, chlorotic sectors and spots on leaves, resulting in unmarketable plants. Dodder (Cuscuta spp.) was present in one of the fields, but was not visibly associated with symptomatic plants. Total nucleic acid was extracted from four symptomatic and three asymptomatic basil plants, as well as from the dodder plant with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Nucleic acid extracts were tested by reverse transcription (RT)-PCR for the presence of Alfalfa mosaic virus (AMV) using primers designed to amplify a 350-nt region of the AMV coat protein gene (3). RT-PCR produced bands of the expected size in extracts from all symptomatic plants and the dodder sample. No amplification was obtained from symptomless plants. A 350-nt band amplified from one plant was gel-extracted, sequenced (TACGen, Richmond, CA), and confirmed to be AMV by comparison to sequences available in GenBank (Accession No. K02703). Although serological tests on an initial basil sample were negative for AMV by ELISA using antiserum produced against AMV by R. Larsen, USDA-ARS, Prosser, WA (unpublished), AMV was confirmed by ELISA and RT-PCR in symptomatic Nicotiana benthamiana, N. clevelandii, and Malva parviflora plants following mechanical transmission from basil source plants. The fields with AMV infections were located at opposite ends of the production region from one another, indicating widespread dispersal of AMV in the region. All AMV positive plants were adjacent to alfalfa. Two additional basil plantings in shade houses open to the outside environment did not have AMV symptomatic plants and were also confirmed negative by RT-PCR, but these plantings were at the extreme north end of Imperial Valley agriculture and well away from any alfalfa fields. At the time the basil plantations were sampled for AMV, no aphids were found in any plantations, but during the several weeks prior to finding the AMV-positive plants, cowpea aphid, Aphis craccivora Koch; pea aphid, Acyrthosiphon pisum Harris; blue alfalfa aphid, Acyrthosiphon kondoi Shinji; and spotted alfalfa aphid, Therioaphis maculata Buckton were colonizing Imperial Valley alfalfa fields, producing winged adults. AMV is transmitted by at least 14 aphid species (1), and most aphid populations increase during the late spring in this important desert agricultural region. The acquisition of AMV by dodder suggests the parasitic plant may serve as a vector of AMV within basil fields, although further study will be necessary for clarification. Significant acreage of basil is grown in the Imperial Valley. This acreage is surrounded by extensive and increasing alfalfa production totaling 55,442 ha (137,000 acres) in Imperial County and representing a 21% increase in acreage over 2009 for the same region (2). To our knowledge, this is the first report of basil infected by AMV in California. The proximity of basil production to such a large alfalfa production region warrants the need for enhanced efforts at aphid management in basil production to reduce vector populations and reduce transmission to basil crops. References: (1) E. M. Jaspars and L. Bos. Alfalfa mosaic virus. No. 229 in: Descriptions of Plant Viruses. Commonw. Mycol. Inst./Assoc. Appl. Biol., Kew, England, 1980. (2) C. Valenzuela. Imperial County California Crop and Livestock Report, 2010. (3) H. Xu and J. Nie. Phytopathology 96:1237, 2006.

scholarly journals First Report of Tomato mosaic virus on Common Sow Thistle in Iran

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1164-1164 ◽  
Author(s):  
S. S. Hashemi ◽  
F. Rakhshandehroo ◽  
N. Shahraeen
Keyword(s):  
Mosaic Virus ◽  
Polyclonal Antibodies ◽  
Tomato Mosaic Virus ◽  
Vegetable Crops ◽  
Rt Pcr ◽  
Weed Species ◽  
First Report ◽  
Sonchus Oleraceus ◽  
Plant Pathol

The natural incidence of Tomato mosaic virus (ToMV) in common sow thistle (Sonchus oleraceus) from vegetable fields was assessed to determine the role of this weed species as a virus inoculum source. Twenty sow thistle plants with virus-like foliar symptoms including mosaic and malformations were collected from five vegetable fields in Tehran province, Iran, and analyzed by double antibody sandwich (DAS)-ELISA for the presence of ToMV, Tobacco mosaic virus (TMV), and Cucumber mosaic virus (CMV) using specific polyclonal antibodies (Agdia, Elkhart, IN). Six out of the 20 sow thistle plants tested by ELISA were infected with ToMV. This virus was detected in three of five vegetable fields surveyed, while CMV and TMV were not detected. Mosaic symptoms were associated with the ToMV infection, similar to those caused by TMV in common sow thistle in Iran (2). Viral infection was confirmed by RT-PCR using previously described specific primers to amplify a region in the coat protein gene of ToMV (3). The RT-PCR resulted in the amplification of an expected fragment of ~480 bp from ToMV-infected but not from healthy plants. The nucleotide sequence of the amplified DNA fragment was purified (GeneJET Gel Extraction Kit, Fermentas, Germany), directly sequenced, and deposited in GenBank as Accession No. KF527464. BLAST analysis showed 95 to 97% and 98 to 100% identity at the nucleotide and amino acid levels, respectively, with comparable sequences of other ToMV isolates (GenBank AF062519, FN985165, GQ280794, and JX857634). Mechanical inoculation of sow thistle plants with sap of symptomatic sow thistles reproduced symptoms of field-infected sow thistles. The presence of ToMV in the inoculated plants was confirmed by ELISA and RT-PCR. This suggested that ToMV could be the causal agent of the disease on sow thistle. In our earlier studies, the distribution and genetic diversity of ToMV isolates infecting vegetable crops and weed plants were studied (1); however, to our knowledge, this is the first report of ToMV infecting common sow thistle in Iran. References: (1) V. Aghamohammadi et al. J. Plant Pathol. 95:339, 2013. (2) A. Alishiri et al. Plant Pathol. J. 29:260, 2013. (3) B. Letschert et al. J. Virol. Methods 106:10, 2002.

Sign in / Sign up

Export Citation Format

Share Document