First report of papaya ring spot virus (PRSV) infecting jute (Corchorus olitorius) in India

Jute is the most important bast fibre crop of the world, which is mainly cultivated in India, Nepal, Bangladesh, China, Indonesia and South American countries. The fibre is utilized for making apparels, ropes, bags, carpets etc (Biswas et al. 2014). This bio-fibre is gaining importance due to growing environmental consciousness worldwide. In June 2019, we noticed jute plants (less than 2%) showing virus like symptoms viz., downward curling, puckering, angular brownish to yellowish spots etc in a farmer’s field at Amdanga Block, North 24 Paraganas, West Bengal, India. To identify the virus, five symptomatic leaves from five different plants were used for high throughput sequencing (HTS). We extracted total RNA from each leaf which was subjected to construction of cDNA libraries. Sequencing was done on Illumina Hiseq 4000 (CytoScan, Thermo Fisher). Approximately 46 million 105 nt paired end reads were generated. Raw reads were trimmed and filtered to perform de novo assembly as described previously by (Grabherr et al. 2013). The obtained contig was 10,326 bp nucleotides (nt) long and in BLASTn against GenBank showed highest identity with papaya ring spot virus (PRSV) with the contig covering 99.6% of the viral genome. The obtained contig shared 99.33% sequence similarity with PRSV strain P (Accession No. MT470188). The selected leaf samples were also tested by double-antibody sandwich (DAS)- enzyme linked immunosorbent assay (ELISA) for papaya ring spot virus (PRSV) along with some common viruses, viz., Potato leaf roll virus (PLRV), Watermelon mosaic virus, Cowpea mosaic virus and Cucumber mosaic virus with the help of commercial diagnostic kits (Agdia). However, only the test with PRSV gave positive reaction for the symptomatic samples. The major symptoms of PRSV on papaya are severe mosaic, chlorosis, reduced lamina with curling and puckering (Gonsalves et al. 2010). To confirm PRSV infection, five symptomatic leaf samples (used for HTS) were collected and whole RNA was extracted from the samples using RNeasy plant minikit (Qiagen, USA). Reverse transcriptase polymerase chain reaction (RT-PCR) was conducted by using isolated RNA. One pair of PRSV specific primer (PSRV1F: 5' TTAAATCTGATTCGTC 3' PRSV 1R: 5'GAAATTCACGCAAAGTCGA3') was developed by using primer BLAST software and was used in RT-PCR assays. Amplified fragments were cloned and sequenced and all the fragments shared 98% sequence identity with PRSV. One of the amplicons was deposited in NCBI (Accession No. MN615832). Crude sap was prepared by homogenizing PRSV-infected jute leaf tissues in 0.1 M sodium phosphate buffer and 2% carborundum dust was added as abrasive (Holkar et al. 2018). The sap was then gently rubbed on to the healthy papaya leaves for inoculation. Typical PRSV like symptoms appeared in inoculated leaves 10 days post inoculation which confirmed the presence of PRSV-P. PRSV was detected by RT-PCR as well as (DAS)-ELISA from all inoculated infected papaya leaf tissues, but could not be detected from uninoculated healthy papaya tissues. To the best of our knowledge, this is the first report of PRSV-P infecting jute in India. References: Biswas, C. et al. 2014. Plant Dis. 98(4): 565. https:// doi.org/10.1094/PDIS-08-13-0826-PDN. Gonsalves, D. et al. 2010. The Plant Health Instructor. https:// doi.org/10.1094/PHI-I-2010-1004-01 Holkar, S. K. et al. 2018. Crop Protection. 108:110-119. https://doi.org/10.1016/j.cropro.2017.12.013 Grabherr, M. et al. 2011. Nat Biotechnol. 29(7): 644-652.

Download Full-text

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽

10.1094/pdis-01-13-0092-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 5

Author(s):

B. E. González-Pacheco ◽

L. Silva-Rosales

Keyword(s):

Mosaic Virus ◽

Ringspot Virus ◽

Impatiens Necrotic Spot Virus ◽

Post Inoculation ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

True Leaf ◽

Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

Download Full-text

Identification, Characterization, and Molecular Detection of Alfalfa mosaic virus in Potato

Phytopathology ◽

10.1094/phyto-96-1237 ◽

2006 ◽

Vol 96 (11) ◽

pp. 1237-1242 ◽

Cited By ~ 34

Author(s):

H. Xu ◽

J. Nie

Keyword(s):

Mosaic Virus ◽

Gene Sequence ◽

Alfalfa Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Polymorphism Analysis ◽

Rt Pcr ◽

Potato Leaf ◽

Simple Method ◽

Cp Gene ◽

Nucleotide Sequence Alignment

Alfalfa mosaic virus (AMV) was detected in potato fields in several provinces in Canada and characterized by bioassay, enzyme-linked immunosorbent assay, and reverse-transcription polymerase chain reaction (RT-PCR). The identity of eight Canadian potato AMV isolates was confirmed by sequence analysis of their coat protein (CP) gene. Sequence and phylogenetic analysis indicated that these eight AMV potato isolates fell into one strain group, whereas a slight difference between Ca175 and the other Canadian AMV isolates was revealed. The Canadian AMV isolates, except Ca175, clustered together among other strains based on alignment of the CP gene sequence. To detect the virus, a pair of primers, AMV-F and AMV-R, specific to the AMV CP gene, was designed based on the nucleotide sequence alignment of known AMV strains. Evaluations showed that RT-PCR using this primer set was specific and sensitive for detecting AMV in potato leaf and tuber samples. AMV RNAs were easily detected in composite samples of 400 to 800 potato leaves or 200 to 400 tubers. Restriction analysis of PCR amplicons with SacI was a simple method for the confirmation of PCR tests. Thus, RT-PCR followed by restriction fragment length polymorphism analysis may be a useful approach for screening potato samples on a large scale for the presence of AMV.

Download Full-text

First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽

10.1094/pdis-93-7-0762a ◽

2009 ◽

Vol 93 (7) ◽

pp. 762-762 ◽

Cited By ~ 1

Author(s):

R. K. Sampangi ◽

C. Almeyda ◽

K. L. Druffel ◽

S. Krishna Mohan ◽

C. C. Shock ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Great Basin ◽

Natural Infection ◽

The United States ◽

Native Plant ◽

Rt Pcr ◽

Cmv Infection ◽

Spot Virus ◽

First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

Plant Diseases Detection Using Nanowire as Biosensor Transducer

Advanced Materials Research ◽

10.4028/www.scientific.net/amr.832.113 ◽

2013 ◽

Vol 832 ◽

pp. 113-117 ◽

Cited By ~ 21

Author(s):

Shahrul A.B. Ariffin ◽

Tijjani Adam ◽

U. Hashim ◽

S. Faridah Sfaridah ◽

Ishak Zamri ◽

...

Keyword(s):

Mosaic Virus ◽

Plant Disease ◽

Plant Diseases ◽

Working Environment ◽

Spot Virus ◽

Biosensor Application ◽

Papaya Ring Spot Virus ◽

Ring Spot

The plant disease such as Cucumber Mosaic Virus (CMV) and Papaya Ring Spot Virus (PRSV) is a most dangerous disease that can decrease productivity and quality of the vegetable and fruit. Besides that, its also can destroy and kill those plant in long term when infected and to tackle this problem at early stages, the nanowire based biosensor application is a most reliable sensor nowadays because of advantages towards detecting biological molecule especially plant diseases.In order to dealing with tiny form of molecules such as virus is very difficult and due to the nanostructure uniqueness such as nanowire, it can be done by undergo formation of nanowire process.Result will be elaborated about how nanowire working environment in order to detecting those virus.

Download Full-text

First Report of Cucumber mosaic virus Associated with Capsicum chinense var. Scotch Bonnet in Florida

Plant Disease ◽

10.1094/pdis-12-13-1276-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1016-1016 ◽

Cited By ~ 1

Author(s):

B. Babu ◽

H. Dankers ◽

M. L. Paret

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Yellow Mosaic Virus ◽

Hot Pepper ◽

Crystalline Inclusion ◽

Post Inoculation ◽

Capsicum Chinense ◽

Rt Pcr ◽

First Report ◽

Pcr Assays

Scotch bonnet (Capsicum chinense) is a tropical hot pepper variety that is grown in South America, the Caribbean Islands, and in Florida, and is an important cash crop. In Florida, scotch bonnet is grown on ~100 acres annually. Virus-like leaf symptoms including mosaic and yellow mottling were observed on scotch bonnet plants in a field at Quincy, FL, with a disease incidence of ~5%. Two symptomatic and one non-symptomatic plant sample were collected from this field for identification of the causal agent associated with the symptoms. Viral inclusion assays (2) of the epidermal tissues of the symptomatic scotch bonnet samples using Azure A stain indicated the presence of spherical aggregates of crystalline inclusion bodies. Testing of the symptomatic samples using lateral flow immunoassays (Immunostrips, Agdia, Elkhart, IN) specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Pepper mild mottle virus (PMMoV), Tobacco mosaic virus (TMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV), showed a positive reaction only to CMV. The sap from an infected leaf sample ground in 0.01 M Sorensons phosphate buffer (pH 7.0) was used to mechanically inoculate one healthy scotch bonnet plant (tested negative for CMV with Immunostrip) at the 2- to 3-leaf stage. The inoculated plant developed mild mosaic and mottling symptoms 12 to 14 days post inoculation. The presence of CMV in the mechanically inoculated plant was further verified using CMV Immunostrips. Total RNA was extracted (RNeasy Plant Mini Kit, Qiagen, Valencia, CA) from the previously collected two symptomatic and one non-symptomatic scotch bonnet samples. The samples were subjected to reverse-transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, Grand Island, NY), and using multiplex RT-PCR primer sets (1). The primers were designed to differentiate the CMV subgroup I and II, targeting the partial coat protein gene and the 3′UTR. The RT-PCR assays using the multiplex primers produced an amplicon of 590 bp, with the CMV subgroup I primers. The RT-PCR product was only amplified from the symptomatic leaf samples. The obtained amplicons were gel eluted, and directly sequenced bi-directionally (GenBank Accession Nos. KF805389 and KF805390). BLAST analysis of these sequences showed 97 to 98% nucleotide identities with the CMV isolates in the NCBI database. The isolates collected in Florida exhibited highest identity (98%) with the CMV isolate from tomato (DQ302718). These results revealed the association of CMV subgroup I with symptomatic scotch bonnet leaf samples. Although CMV has been reported from scotch bonnet, this is the first report of its occurrence in Florida. References: (1) S. Chen et al. Acta Biochim Biophys Sin. 43:465, 2011. (2) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986.

Download Full-text

First report of bean common mosaic virus infecting heavenly bamboo (Nandina domestica) in China

Plant Disease ◽

10.1094/pdis-07-21-1591-pdn ◽

2021 ◽

Author(s):

Xiu Su ◽

Xiang Zhou ◽

Yuan Li ◽

Liangjin Ma ◽

Xiaofei Cheng ◽

...

Keyword(s):

New England ◽

Mosaic Virus ◽

Small Rna ◽

Phylogenetic Trees ◽

Genomic Sequence ◽

Bean Common Mosaic Virus ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Plantago Asiatica

Heavenly bamboo (Nandina domestica) is an evergreen ornamental plant with worldwide distribution. In May 2018, seven out of twenty N. domestica plants showing virus-like symptoms, such as yellow mosaic and curling, were observed in Lin’an, Zhejiang province. To determine the causal agent, a small RNA library was constructed using the Small RNA v1.5 Sample Prep Kit (Illumina, San Diego, USA) with total RNA extracted from leaves of a symptomatic plant. The library was sequenced by the Solexa platform at BGI Genomics (Shenzhen, China). A total number of 21,071,675 high-quality reads of 17-28 nucleotides (nt) in length remained after trimming adapter sequences and quality control. Reads were assembled using Velvet 0.7.31 and Oases 0.2.07 with the k-mer value of 17 (Schulz et al. 2012). BlastN and BlastX search against the GenBank viral nonredundant sequence databases revealed fifty-six contigs homologous to bean common mosaic virus (BCMV; genus Potyvirus; family Potyviridae). No contig homologous to the genomic sequence of other plant-infecting viruses was identified. These contigs were further assembled into a 9,315-nt fragment by SeqMan Pro 7.1.0 in Lasergene package (DNASTAR, Madison, WI), which covered 92.68% of the genome of BCMV strain CT (BCMV-CT; GenBank accession no. KM076650). The genome of this BCMV isolate (BCMV-NTZ1) was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using primers designed based on assembled contigs with the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Beijing, China) and the FirstChoice® RLM-RACE Kit (Invitrogen, Carlsbad, USA), respectively. Amplicons were cloned and Sanger sequenced with three independent clones per amplicon. The genome is 10,052 nt in length excluding the poly-A tail (Genbank accession no. MZ670770) and shared the highest nt sequence identities with BCMV-CT (88.46%). The putative polyprotein shared 93.36% amino acid (aa) sequence identity with that of BCMV-CT. BCMV-NTZ1 also clustered with BCMV-CT in phylogenetic trees based on BCMV full genomes and aa sequences of coat protein. Five-leaf-stage seedlings of Nicotiana tabacum, N. benthamiana, Glycine max (Linn.) Merr., and Capsicum frutescens were mechanically inoculated with sap of BCMV-infected N. domestica leaves at fifteen plants per species. Seedlings of G. max developed virus-like (mosaic and leaf deformity) symptoms (7/15) at 15 days post-inoculation, while other plants remained symptomless throughout the experiment. Subsequent RT-PCR on all the plants using primers 27F1/14Rter and sequencing confirmed the presence and absence of BCMV-NTZ1 in all symptomatic G. max seedlings and other asymptomatic indicator plants, respectively. Subsequent RT-PCR survey further confirmed the association of BCMV with symptomatic heavenly bamboo samples but not asymptomatic plants (7/20). To the best of our knowledge, this is the first report of BCMV naturally infecting heavenly bamboo in China. N. domestica is susceptible to many viruses, e.g., cucumber mosaic virus, plantago asiatica mosaic virus, nandina stem pitting virus, apple stem grooving virus, and alternanthera mosaic virus (Barnett et al. 1973; Ahmed et al. 1983; Hughes et al. 2002, 2005; Tang et al. 2010; Wei et al. 2015). Our results indicate that N. domestica can also serve as an overwinter reservoir for BCMV and special attention should be paid to the damage it may cause.

Download Full-text

First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽

10.1094/pdis-04-14-0356-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1285-1285 ◽

Cited By ~ 5

Author(s):

S. Lim ◽

Y.-H. Lee ◽

D. Igori ◽

F. Zhao ◽

R. H. Yoo ◽

...

Keyword(s):

Nucleotide Sequence ◽

South Korea ◽

Mosaic Virus ◽

Soybean Mosaic Virus ◽

Nucleotide Sequences ◽

Mottle Virus ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Tunisia Causing Yellows on Five Cucurbitacious Species

Plant Disease ◽

10.1094/pd-89-0776b ◽

2005 ◽

Vol 89 (7) ◽

pp. 776-776 ◽

Cited By ~ 18

Author(s):

M. Mnari Hattab ◽

J. Kummert ◽

S. Roussel ◽

K. Ezzaier ◽

A. Zouba ◽

...

Keyword(s):

Citrullus Lanatus ◽

Aphis Gossypii ◽

Pcr Amplification ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Fresh Leaf ◽

First Report ◽

Reference Isolate ◽

Leaf Tissues ◽

Beet Pseudo Yellows Virus

Viruses, distributed worldwide on cucurbits, cause severe damage to crops. Virus surveys in 2003 and 2004 were made in all the major cucurbit-growing areas in Tunisia. Large populations of aphids (Aphis gossypii Glover) and severe yellowing symptoms of older leaves of cucurbits were observed in outdoor and under plastic-tunnel cultivation, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae). Leaf samples collected from symptomatic and asymptomatic plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita pepo L.), watermelon (Citrullus lanatus L.), and ware cucurbit (Ecballium elaterium L. T. Richard) were screened for the presence of CABYV using enzyme-linked immunosorbent assay (ELISA) and reverse transcription-polymerase chain reaction (RT-PCR). Reference isolate, CABYV-N (GenBank Accession No. X76931) was provided by H. Lecoq (INRA-Monfavet Cedex, France). Sample extracts from fresh leaf tissues were tested using ELISA with an antiserum prepared against this isolate. In addition, total RNA was extracted from fresh leaf tissues according to the technique of Celix et al. (2) using the Titan RT-PCR kit from Roche Diagnostics (Penzberg, Germany). Forward primer (5′-GAGGCGAAGGCGAAGAAATC-3′) and reverse primer (5′-TCTGGACCTGGCACTTGATG-3′) were designed with the available sequence of the reference isolate. ELISA tests demonstrated that 91 plants were positive among 160 plants tested with severe yellowing symptoms. All asymptomatic plants were negative. RT-PCR results yielded an expected 550-bp product that was amplified from the reference isolate. Of the 160 plants tested using ELISA, 106 plants were screened with RT-PCR including the 91 plants that were positive in ELISA. These 91 plants also were positive after RT-PCR amplification as were 12 more plants. This demonstrated that the RT-PCR test is more sensitive. No amplicons were produced from extracts of asymptomatic plants, RNA preparations of Cucurbit yellow stunting disorder virus (CYSDV), or Beet pseudo yellows virus (BPYV) positive controls provided by B. Falk (University of California, Davis). CYSDV and BPYV can induce similar yellowing symptoms in cucurbits. The results of the ELISA and RT-PCR tests showed that CABYV is widely distributed on five cucurbit species in the major growing areas of Tunisia including the northern, Sahel, central, and southern regions where it was detected, respectively, in 10 of 25, 11 of 21, 24 of 37, and 58 of 77 samples tested. CABYV was detected at the rates of 63 of 72 on melon, 10 of 21 on cucumber, 17 of 24 on squash, 10 of 25 on watermelon, and 3 of 18 on ware cucurbit. CABYV also seems to be widespread throughout the Mediterranean Basin (1,3,4), but to our knowledge, this is the first report of the occurrence of CABYV in Tunisia on different species of cucurbit and ware cucurbit. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) A. Celix et al. Phytopathology 86:1370, 1996. (3) M. Juarez et al. Plant Dis. 88:907, 2004. (4) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Download Full-text

First Report of Occurrence of Papaya ring spot virus Infecting Papaya in Bangladesh

Plant Disease ◽

10.1094/pdis.2004.88.2.221c ◽

2004 ◽

Vol 88 (2) ◽

pp. 221-221 ◽

Cited By ~ 7

Author(s):

R. K. Jain ◽

K. M. Nasiruddin ◽

Jyoti Sharma ◽

R. P. Pant ◽

A. Varma

Keyword(s):

Polyclonal Antibodies ◽

Electron Microscopic Examination ◽

Aphid Transmission ◽

Electron Microscopic ◽

Spot Virus ◽

First Report ◽

Virus Particles ◽

Cp Gene ◽

Papaya Ring Spot Virus ◽

Ring Spot

Papaya (Carica papaya L.) is an important fruit crop in Bangladesh. During surveys conducted in Dhaka and Mymensingh regions from April to June 2003, >50% of papaya plants were observed to have leaf mottling, mosaic and mild distortion, and water-soaked streaks on petioles and stem, which are typical symptoms of Papaya ring spot virus (PRSV) infection. Electron-microscopic examination of negatively stained leaf-dip preparations from 10 symptomatic samples revealed the association of flexuous virus particles that were decorated with polyclonal antibodies raised to an isolate from India (PRSV-D). The identity of PRSV associated with the papaya disease in Bangladesh was further confirmed by reverse transcription polymerase chain reaction and sequence analysis (2). By using PRSV specific primers (2), the 3′-terminal region comprising a part of the nuclear inclusion b gene, the coat protein (CP) gene, and the untranslated region were amplified and sequenced (GenBank Accession No. AY423557). The CP gene consisted of 286 amino acids and the conserved regions common to the genus Potyvirus, such as WCIEN and QMKAA, were present. Like all known PRSV sequences (1), a stretch of glutamic acid and lysine repeats (EK region) after the aphid transmission motif (DAG) also was present. Comparative CP amino acid sequence analyses revealed that the virus infecting papaya in Bangladesh, designated as PRSV-Bd, shared 89 to 92% identity with PRSV isolates from India and 88 to 93% identity with isolates from other parts of the world. To our knowledge, this is the first report of occurrence of PRSV infecting papaya in Bangladesh. References: (1) M. F. Bateson et al. J. Gen. Virol. 83:2575, 2002. (2) R. K. Jain et al. Ann Appl. Biol. 132:413, 1998.

Download Full-text