First Report of Blueberry red ringspot virus Infecting Highbush Blueberry in Korea

Blueberry red ringspot virus (BRRSV) of the Soymovirus genus in the family Caulimovididae causes red ringspot diseases in highbush blueberry (Vaccinium corymbosum L.) on leaves, stems, and fruits. The virus has been identified in the United States, Japan, Czech Republic, Slovenia, and Poland (1). In July 2010, highbush blueberry with red ringspots on leaves and circular blotches on ripening fruits was found in one plant of cv. Duke in Pyeongtaek, Korea. The symptoms were similar to red ringspot disease caused by BRRSV (3), although stems did not show any characteristic symptoms. Red ringspots on the upper surface of leaves were the most visible symptom and became more prominent as leaves matured in August through October. Leaves of the symptomatic plant were collected and tested for BRRSV infection by PCR, and were also embedded for electron microscopy. DNA was extracted from leaves using DNeasy Plant Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Primer pairs BR1512F/BR2377R (5′-ACAGGACGATTAGAAGATGG-3′/5′-CCTTTAGGGCAATATTTCTG-3′, amplifying a fragment of the coat protein region with an expected size of 865 bp) and BR2961F/BR3726R (5′-ACCGATACATCACAGTTCAC-3′/5′-TGGTTGTGATAAGATGATTCC-3′, amplifying a fragment of the reverse transcriptase region with an expected size of 766 bp) were used to amplify the indicated region of BRRV in PCR. Primers were designed on the basis of the BRRSV isolate from New Jersey (GenBank Accession No. AF404509). DNA fragments of the expected sizes were obtained from the symptomatic plant, while no amplification products were obtained from highbush blueberry without symptoms. The PCR products were cloned into pGEM-T easy vector (Promega, Madison, WI) and sequenced. BLAST analyses of obtained fragments revealed 91 to 98% nucleotide sequence identity with the coat protein gene (GenBank Accession No. JQ706341) and 96 to 98% nucleotide sequence identity with the reverse transcriptase gene (GenBank Accession No. JQ706340) of known BRRV isolates. Electron microscopy of thin sections revealed particles approximately 50 nm diameter within electron-dense inclusion bodies, characteristic of BRRSV (2) To our knowledge, this is the first report of BRRSV infection of highbush blueberry in Korea. Highbush blueberries are usually propagated by cutting, so BRRSV suspicious plants should be tested with PCR before they are propagated. References: (1) E. Kalinowska et al. Virus Genes. DOI 10.1007/s11262-011-0679-4, 2011. (2) K. S. Kim et al. Phytopathology 71:673, 1981. (3) M. Isogai et al. J. Gen. Plant Pathol. 75:140, 2009.

Download Full-text

First Report of Kudzu mosaic virus on Pueraria montana (Kudzu) in China

Plant Disease ◽

10.1094/pdis-07-12-0671-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 148-148 ◽

Cited By ~ 2

Author(s):

J. Zhang ◽

Z. J. Wu

Keyword(s):

Sequence Analysis ◽

Nucleotide Sequence ◽

Mosaic Virus ◽

Nucleotide Sequence Identity ◽

Southern China ◽

Full Length ◽

Yellow Vein ◽

Mosaic Symptom ◽

First Report ◽

Sequence Identity

Kudzu (Pueraria montana), a weed widely distributed in southern China, is common in the Fuzhou region of Fujian Province, where many plants show yellow vein mosaic disease. In September 2008, four leaf samples from different plants exhibiting yellow vein mosaic symptom were collected in suburban district of Fuzhou (25°15′ N, 118°08′ E). Whitefly (Bemisia tabaci) infestation was also observed in this region. Total DNA was extracted from all samples using a CTAB method (4). Universal primers (PA/PB) were used to amplify part of the intergenic region and coat protein gene of DNA-A of begomoviruses (1). An amplicon of approximately 500 bp was obtained from all four samples and then sequenced. Comparison of 500-bp fragments (GenBank Accession Nos. FJ539016-18 and FJ539014) revealed the presence of the same virus (98.8 to 99.4%). A pair of back-to-back primers (Yg3FL-F: 5′-GGATCCTTTGTTGAACGCCTTTCC-3′/Yg3FL-R: 5′-GGATCCCACATGTTTAAAGTAAAGC-3′) were designed to amplify the full-length DNA-A from the Chinese isolate identified as Yg3. Sequence analysis showed that full-length DNA-A of Yg3 isolate comprised 2,729 nucleotides (GenBank Accession No. FJ539014) and shared the highest nucleotide sequence identity (91.9%) with Kudzu mosaic virus (KuMV, GenBank Accession No. DQ641690) from Vietnam. To further test the association of DNA-B fragments with the four samples from southern China, rolling circle amplification (RCA) was performed (3). When RCA products were digested with Sph I, approximately 2.7 kb was obtained from all samples. Yg3 isolate was chosen to be sequenced. Sequence analysis showed that full-length DNA-B of Yg3 isolate comprised 2,677 nucleotides (GenBank Accession No. FJ539015) and shared the highest nucleotide sequence identity (76.8%) with KuMV DNA-B (GenBank Accession No. DQ641691) from Vietnam. Based on the current convention of begomovirus species demarcation of <89% sequence identity cut-off criterion (2), Yg3 was identified as an isolate of KuMV. To our knowledge, this is the first report of association of KuMV with yellow vein mosaic symptom of kudzu in China. References: (1). D. Deng et al. Annals Appl. Biol. 125:327, 1994. (2). C. M. Fauquet et al. Arch. Virol. 148:405, 2003. (3). D. Haible et al. J. Virol. Methods 135:9, 2006. (4). Y. Xie et al. Chinese Sci. Bull. 47:197, 2002.

Download Full-text

Biological, Pathological, and Molecular Characteristics of a New Potyvirus, Dendrobium Chlorotic Mosaic Virus, Infecting Dendrobium Orchid

Plant Disease ◽

10.1094/pdis-10-18-1839-re ◽

2019 ◽

Vol 103 (7) ◽

pp. 1605-1612 ◽

Cited By ~ 1

Author(s):

Chih-Hung Huang ◽

Chia-Hsing Tai ◽

Ruey-Song Lin ◽

Chung-Jan Chang ◽

Fuh-Jyh Jan

Keyword(s):

Amino Acid ◽

Nucleotide Sequence ◽

Coat Protein ◽

Amino Acid Sequence ◽

Mosaic Virus ◽

Coat Protein Gene ◽

Nucleotide Sequence Identity ◽

Amino Acid Sequence Identity ◽

Protein Gene ◽

Sequence Identity

Dendrobium smillieae is one of the popular orchids in Taiwan. This report describes a new potyvirus tentatively named Dendrobium chlorotic mosaic virus (DeCMV) causing chlorotic and mosaic symptoms in D. smillieae. Enzyme-linked immunosorbent assay (ELISA) tests using six antisera against orchid-infecting viruses revealed that only a monoclonal antibody against the potyvirus group reacted positively with crude saps prepared from a symptomatic dendrobium orchid. Potyvirus-like, flexuous, filamentous particles were observed under an electron microscope, measuring approximately 700 to 800 nm in length and 11 to 12 nm in diameter. Sequence analyses revealed that DeCMV coat protein gene shared 59.6 to 66.0% nucleotide sequence identity and 57.6 to 66.0% amino acid sequence identity, whereas the DeCMV complete genome shared 54.1 to 57.3% nucleotide sequence identity and 43.7 to 49.5% amino acid sequence identity with those other known potyviruses. These similarity levels were much lower than the criteria set for species demarcation in potyviruses. Thus, DeCMV can be considered a new potyvirus. The whole DeCMV genome contains 10,041 nucleotides (GenBank accession no. MK241979) and encodes a polyprotein that is predicted to produce 10 proteins by proteolytic cleavage. In a pathogenicity test, results of inoculation assays demonstrated that DeCMV can be transmitted to dendrobium orchids by grafting and mechanical inoculation, as verified by ELISA and western blot analyses using the DeCMV polyclonal antiserum and by reverse transcription polymerase chain reaction using the coat protein gene-specific primers. The inoculated orchids developed similar chlorotic and mosaic symptoms. In conclusion, DeCMV is a novel orchid-infecting potyvirus, and this is the first report of a new potyvirus that infects dendrobium orchids in Taiwan.

Download Full-text

First Report of Blueberry red ringspot virus in Highbush Blueberry in the Czech Republic

Plant Disease ◽

10.1094/pdis-94-8-1071b ◽

2010 ◽

Vol 94 (8) ◽

pp. 1071-1071 ◽

Cited By ~ 6

Author(s):

J. Přibylová ◽

J. Špak ◽

D. Kubelková ◽

K. Petrzik

Keyword(s):

Czech Republic ◽

Reverse Transcriptase ◽

Vaccinium Corymbosum ◽

Ringspot Virus ◽

Tween 20 ◽

Highbush Blueberry ◽

Reverse Transcriptase Gene ◽

The Czech Republic ◽

First Report

A collection of highbush blueberry (Vaccinium corymbosum L.) cultivars planted in the field for propagation in South Bohemia was surveyed in May and July of 2009 for the occurrence of detrimental viruses. A total of 67 plants of 10 cultivars (Berkeley, Burlington, Blue Crop, Bluetta, Darrow, Duke, Gila, Jersey, Late Blue, and Northland), were observed for typical Blueberry red ringspot virus (BRRV) symptoms that appear as reddish ring spots and blotches on stems and fruits, exclusively on the upper surface of the older leaves but not the underside. Samples of leaves were collected and maintained at –20°C until used for DNA extraction, then assayed for BRRV infection using PCR. Controls originated from the same blueberry cultivars in vitro. DNA was extracted from leaf tissue with a NucleoSpin Plant II kit for isolating genomic DNA according to the manufacturer's instructions (Macherey-Nagel, Düren, Germany). Primer pair BRRV15/16, which amplified fragments of the reverse transcriptase gene (1), was used in PCR for BRRV detection. The program used for PCR amplification was 94°C for 2 min, followed by 35 cycles at 94°C for 30 s, 49°C for 30 s, and 70°C for 45 s, followed by a final extension at 70°C for 5 min. The total PCR volume of 25 μl contained 20 ng of DNA, 200 μmol liter–1 dNTPs, 0.5 μl of each primer BRRV15 and BRRV16 (20 pmol μl–1), 75 mM Tris-HCl pH 8.8, 20 mM (NH4)2SO4, 0.01% Tween 20, 2.5 mM MgCl2, 2.5 U of Taq Purple DNA polymerase, and stabilizers (Top-Bio Ltd., Prague, Czech Republic). Amplifications were conducted in an MJ Research (Waltham, MA) thermocycler. Aliquots (4 μl) of each PCR product were analyzed by electrophoresis in tris-acetate-EDTA buffer. No BRRV symptoms were observed on the plants in early spring, yet BRRV was detected in one symptom-free bush of cv. Darrow by PCR. In July, typical symptoms developed on that and another cv. Darrow bush that was also positive by PCR. DNA fragments of the expected sizes were amplified from total nucleic acid samples of both infected blueberry bushes using primers BRRV15/16, while no amplification products were detected in plants without symptoms. The amplicons obtained with primers BRRV15/BRRV16 were sequenced and revealed 97.5%-nt identity to the BRRV putative reverse transcriptase gene (GenBank Accession No. AF404509). The 845 nt of the amplicon has been deposited at GenBank under Accession No. HM107773. The disease was likely introduced in infected planting material, since no highbush blueberry plantations exist in the vicinity and V. corymbosum is not native to the Czech Republic. In conclusion, to our knowledge, this is the first report of Blueberry red ringspot virus (genus Soymovirus, family Caulimoviridae) in V. corymbosum L. in the Czech Republic. Symptom observation and PCR testing for BRRV should therefore, be incorporated into the certification scheme for highbush blueberry in the Czech Republic. Reference: (1) J. J. Polashock et al. Plant Dis. 93:727, 2009.

Download Full-text

First Report of Tomato yellow leaf curl virus in China

Plant Disease ◽

10.1094/pd-90-1359c ◽

2006 ◽

Vol 90 (10) ◽

pp. 1359-1359 ◽

Cited By ~ 39

Author(s):

J. B. Wu ◽

F. M. Dai ◽

X. P. Zhou

Keyword(s):

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Mosaic Disease ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Yellow Mosaic Disease ◽

Tomato Plants ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus

Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (2). In China, however, there has as yet been no report of this virus, although other begomoviruses have been reported infecting tomato (1,3). A yellow mosaic disease was observed on tomato with 90% disease incidence during March 2006 in fields of Sunqiao, Shanghai Province, China. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) tests indicated that tomato plants were not infected by Tomato mosaic virus or Cucumber mosaic virus. Tomato plants were found to be infested with Bemisia tabaci, suggesting a begomovirus etiology. The disease agent was transmitted to tomato by whiteflies and produced yellow mosaic and stunting symptoms that were identical to those observed in the field. Total DNA was isolated from eight collected leaf samples. Polymerase chain reaction (PCR) was performed with begomovirus degenerate primers PA and PB (3), and an amplicon of the expected size (~500 bp) was obtained in all eight samples but not from healthy leaf samples. The PCR products from two samples (SH1 and SH2) were cloned and sequenced. All residues in the sequences were confirmed by comparison of duplicate clones. Alignment of the sequences showed that they shared 97.4% nucleotide sequence identity (GenBank Accession No. AM282874–75), suggesting that they were infected by an identical virus. Overlapping primers Full/F (5′-AGCCCAATACATTGGGCC ACGA-3′) and Full/R (5′-CGTAAGTTTCCTCAACGGACTGC-3′) were then designed to amplify the full length DNA-A of SH2. The sequence was determined to be 2,781 nucleotides long (GenBank Accession No. AM282874). A comparison with other begomoviruses shows SH2 DNA-A has the highest nucleotide sequence identity (99.8%) with TYLCV isolate Tosa from Japan (GenBank Accession No. AB192966). The above results indicate that the virus associated with yellow mosaic disease of tomato in Shanghai is an isolate of TYLCV. To our knowledge, this is the first report of TYLCV in China and the first report of a begomovirus in Shanghai. References: (1) X. F. Cui et al. J. Virol. 78:13966, 2004. (2) E. Moriones and J. Navas-Castillo. Virus Res. 71:123, 2000. (3) Z. H. Li et al. Arch. Virol. 149:1721, 2004.

Download Full-text

First Report of Squash leaf curl Philippines virus Infecting Chayote (Sechium edule) in Taiwan

Plant Disease ◽

10.1094/pdis-04-11-0282 ◽

2011 ◽

Vol 95 (9) ◽

pp. 1197-1197 ◽

Cited By ~ 3

Author(s):

W. S. Tsai ◽

C. J. Hu ◽

D. P. Shung ◽

L. M. Lee ◽

J. T. Wang ◽

...

Keyword(s):

Nucleotide Sequence ◽

Mosaic Virus ◽

Nucleotide Sequence Identity ◽

Zucchini Yellow Mosaic Virus ◽

Yellow Mosaic Virus ◽

First Report ◽

Sequence Identity ◽

Sechium Edule ◽

Complementary Sense ◽

Leaf Curl

Young shoots and leaves of chayote (Sechium edule (Jacq.) Sw.) are commonly consumed as a vegetable in Taiwan. In Hualien County, the major chayote-production area of Taiwan, as much as 15% of chayote plants were not marketable between September and October 2010 because of mosaic symptoms on the leaves. Three symptomatic leaves were collected from each of three fields in Hualien. All nine samples tested positive for a begomovirus by PCR using general primer pair PAL1v1978B/PAR1c715H (3) and negative for Zucchini yellow mosaic virus, Cucumber mosaic virus, Cucumber green mottle mosaic virus, Melon yellow spot virus, Papaya ringspot virus - type W, Watermelon mosaic virus, and Watermelon silver mottle virus by ELISA (2). On the basis of the high nucleotide sequence identity (97.7 to 99.6%) of the 1.5-kb begomoviral DNA-A fragments, all nine samples were considered infected by the same begomovirus species. The 1.5-kb sequences had greatest nucleotide sequence identity (96.6 to 97.8%) with Squash leaf curl Philippines virus (SLCPHV) pumpkin isolate from Taiwan (1) (GenBank Accession No. DQ866135; SLCPHV-TW[TW:Pum:05]). One sample was selected to complete viral genomic DNA analysis. Abutting primer pairs PKA-V/C (PKA-V: 5′-AACGGATCCACTTATGCACGATTTCCCT-3′; PKA-C: 5′-TAAGGATCCCACATGTTGTGGAGCA-3′) and PKB-V/C (PKB-V: 5′-TGTCCATGGATTGATGCGTTATCGGA-3′; PKB-C: 5′-TGACCATGGCATTTCCGAGATCTCCCA-3′') were used to amplify the complete DNA-A and DNA-B, respectively. The sequences of DNA-A (GenBank Accession No. JF146795) and DNA-B (GenBank Accession No. JF146796) contain 2,734 and 2,715 nucleotides, respectively. The geminivirus conserved sequence TAATATTAC was found in both DNA-A and -B. The DNA-A has two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). The DNA-B also had one ORF each in the virus sense (BV1) and the complementary sense (BC1). When compared by BLASTn in GenBank and analyzed by MEGALIGN software (DNASTAR, Madison, WI), they were found to have greatest nucleotide identity (98.0 to 99.0% of DNA-A and 96.7% of DNA-B) with SLCPHV isolates from Taiwan. In addition, SLCPHV caused similar symptoms on leaves when transmitted to healthy chayote by viruliferous whitefly. In Taiwan, SLCPHV has been detected and sequenced from naturally infected melon (GenBank Accession No. EU479710), pumpkin (GenBank Accession No. DQ866135), and wax gourd (GenBank Accession No. EU310406). To our knowledge, this is the first report of SLCPHV infecting chayote plants in Taiwan. The prevalence of SLCPHV infection on different cucurbit crops should be taken into consideration for managing viral diseases in Taiwan. References: (1) W. S. Tsai et al. Plant Dis. 91:907, 2007. (2) W. S. Tsai et al. Plant Dis. 94:923, 2010. (3) W. S. Tsai et al. Online publication. doi: 10.1111/j.1365-3059.2011.02424.x. Plant Pathol., 2011.

Download Full-text

First Report of Iris yellow spot virus Infecting Onion in Kenya and Uganda

Plant Disease ◽

10.1094/pdis-01-11-0057 ◽

2011 ◽

Vol 95 (9) ◽

pp. 1195-1195 ◽

Cited By ~ 7

Author(s):

R. Birithia ◽

S. Subramanian ◽

H. R. Pappu ◽

P. Sseruwagi ◽

J. W. Muthomi ◽

...

Keyword(s):

Sri Lanka ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Spot Virus ◽

Viral Pathogen ◽

First Report ◽

Sequence Identity ◽

Small Holder

Onion (Allium cepa L.) is one of the key vegetables produced by small-holder farmers for the domestic markets in Sub-Saharan Africa. Biotic factors, including infestation by thrips pests such as Thrips tabaci Lindeman, can inflict as much as 60% yield loss. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by T. tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (2,4). In Africa, IYSV has been reported in Reunion (1) and South Africa (3). In September 2009, symptoms suspected to be caused by IYSV were observed on onions and leeks cultivated in Nairobi, Kenya. Symptoms consisted of spindle-shaped, straw-colored, irregular chlorotic lesions with occasional green islands on the leaves. The presence of the virus was confirmed with IYSV-specific Agdia Flash kits (Agdia Inc., Elkart, IN). Subsequently, surveys were undertaken in small-holder farms in onion production areas of Makueni (January 2010) and Mwea (August 2010) in Kenya and Kasese (January 2010) and Rwimi (January 2010) in Uganda. The incidence of disease in these locations ranged between 27 and 72%. Onion leaves showing symptoms of IYSV infection collected from both locations tested positive for the virus by double-antibody sandwich-ELISA with IYSV-specific antiserum (Agdia Inc). IYSV infection was confirmed by reverse transcription-PCR with primers IYSV-465c: 5′-AGCAAAGTGAGAGGACCACC-3′ and IYSV-239f: 5′-TGAGCCCCAATCAAGACG3′ (3) as forward and reverse primers, respectively. Amplicons of approximately 240 bp were obtained from all symptomatic test samples but not from healthy and water controls. The amplicons were cloned and sequenced from each of the sampled regions. Consensus sequence for each isolate was derived from at least three clones. The IYSV-Kenya isolate (GenBank Accession No. HQ711616) had the highest nucleotide sequence identity of 97% with the corresponding region of IYSV isolates from Sri Lanka (GenBank Accession No. GU901211), followed by the isolates from India (GenBank Accession Nos. EU310287 and EU310290). The IYSV-Uganda isolate (GenBank Accession No. HQ711615) showed the highest nucleotide sequence identity of 95% with the corresponding region of IYSV isolates from Sri Lanka (GenBank Accession No. GU901211) and India (95% with GenBank Accession Nos. EU310274 and EU310297). To our knowledge, this is the first report of IYSV infecting onion in Kenya and Uganda. Further surveys and monitoring of IYSV incidence and distribution in the region, along with its impact on the yield, are under investigation. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Plant Dis 92:588, 2008. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

Download Full-text

First Report of Pepino mosaic virus Infecting Tomato in Mexico

Plant Disease ◽

10.1094/pdis-04-11-0334 ◽

2011 ◽

Vol 95 (8) ◽

pp. 1035-1035 ◽

Cited By ~ 4

Author(s):

K.-S. Ling ◽

W. Zhang

Keyword(s):

Nucleotide Sequence ◽

Mosaic Virus ◽

Nucleotide Sequence Identity ◽

The United States ◽

Rt Pcr ◽

Pepino Mosaic Virus ◽

First Report ◽

Sequence Identity ◽

Pcr Product ◽

Greenhouse Tomatoes

Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5′CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5′TCTTTGTATATGGTCGCAGC) targeting the 5′ portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5′AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5′CAGAAATGTGTTCAGAGGGG) targeting the 3′ portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.

Download Full-text

First Report of Iris yellow spot virus Infecting Onion in Pennsylvania

Plant Disease ◽

10.1094/pdis-03-12-0254-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 1

Author(s):

C. A. Hoepting ◽

M. F. Fuchs

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

First Report ◽

Sequence Identity ◽

Das Elisa

Iris yellow spot virus (IYSV; genus Tospovirus; family Bunyaviridae) is an economically important pathogen of onion. It is vectored by onion thrips (Thrips tabaci Lindeman) and causes widespread disease of onion in all major onion growing states in the western United States (1). In the eastern United States, IYSV was first reported in Georgia in 2004 (4) and then in New York in 2006 (2). In mid-July of 2010, symptomatic onion (Allium cepa) plants (cv. Candy) were found in New Holland, Pennsylvania, in Lancaster County on a small, diversified commercial farm (40.06°N, 76.06°W). Bleached, elongated lesions with tapered ends occurred on middle-aged leaves on approximately 30% of the 13,760 plants in an area approximately one tenth of an acre. Leaf tissue from five symptomatic plants tested positive for IYSV in a double-antibody sandwich (DAS)-ELISA with IYSV-specific serological reagents from Agdia Inc. (Elkhart, IN). A reverse transcription (RT)-PCR assay was used to verify the presence of IYSV in a subset of symptomatic leaf samples that reacted to IYSV antibodies in DAS-ELISA. Primers specific to the nucleocapsid (N) gene of IYSV (5′-ACTCACCAATGTCTTCAAC-3′ and 5′-GGCTTCCTCTGGTAAGTGC-3′) were used to characterize a 402-bp fragment (3). The resulting amplicons were ligated in TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and two clones of each isolate were sequenced in both directions. Sequence analysis showed a consensus sequence for the partial N gene of the five IYSV isolates from Pennsylvania (GenBank Accession No. JQ952568) and an 87 to 100% nucleotide sequence identity with other IYSV N gene sequences that are available in GenBank. The highest nucleotide sequence identity (100%) was with an IYSV isolate from Texas (GenBank Accession No. DQ658242) and the lowest was with an isolate from India (GenBank Accession No. EU310291). To our knowledge, this is the first report of IYSV infection of onion in Pennsylvania. This finding confirms further spread of the virus within North America. Further study is warranted to determine the impact of IYSV on the Pennsylvania onion industry and to determine viable management strategies, if necessary. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004 (2) C. A. Hoepting et al. Plant Dis. 91:327, 2007 (3) C. L. Hsu et al. Plant Dis. 95:735-743. (4) S. W. Mullis et al. Plant Dis. 88: 1285, 2004.

Download Full-text

Sequence identity in an early chorion multigene family is the result of localized gene conversion.

Genetics ◽

10.1093/genetics/128.3.595 ◽

1991 ◽

Vol 128 (3) ◽

pp. 595-606

Author(s):

B L Hibner ◽

W D Burke ◽

T H Eickbush

Keyword(s):

Nucleotide Sequence ◽

Gene Conversion ◽

Nucleotide Sequence Identity ◽

Early Period ◽

Gene Families ◽

Multigene Families ◽

Coding Regions ◽

Sequence Identity ◽

Isolation And Characterization ◽

Sequence Exchange

Abstract The multigene families that encode the chorion (eggshell) of the silk moth, Bombyx mori, are closely linked on one chromosome. We report here the isolation and characterization of two segments, totaling 102 kb of genomic DNA, containing the genes expressed during the early period of choriogenesis. Most of these early genes can be divided into two multigene families, ErA and ErB, organized into five divergently transcribed ErA/ErB gene pairs. Nucleotide sequence identity in the major coding regions of the ErA genes was 96%, while nucleotide sequence identity for the ErB major coding regions was only 63%. Selection pressure on the encoded proteins cannot explain this difference in the level of sequence conservation between the ErA and ErB gene families, since when only fourfold redundant codon positions are considered, the divergence within the ErA genes is 8%, while the divergence within the ErB genes (corrected for multiple substitutions at the same site) is 110%. The high sequence identity of the ErA major exons can be explained by sequence exchange events similar to gene conversion localized to the major exon of the ErA genes. These gene conversions are correlated with the presence of clustered copies of the nucleotide sequence GGXGGX, encoding paired glycine residues. This sequence has previously been correlated with gradients of gene conversion that extend throughout the coding and noncoding regions of the High-cysteine (Hc) chorion genes of B. mori. We suggest that the difference in the extent of the conversion tracts in these gene families reflects a tendency for these recombination events to become localized over time to the protein encoding regions of the major exons.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Spain

Plant Disease ◽

10.1094/pdis.2004.88.8.907a ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 22

Author(s):

M. Juarez ◽

V. Truniger ◽

M. A. Aranda

Keyword(s):

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Rt Pcr ◽

Sequence Comparisons ◽

E Coli ◽

Sequence Identity ◽

Tissue Print ◽

Sigma Chemical ◽

Beet Pseudo Yellows Virus ◽

Cucumis Melo L

In late spring 2003, field-grown melon plants (Cucumis melo L.) showing bright yellowing of older leaves were observed near Valladolises in Campo de Cartagena, Murcia, Spain. Symptoms resembled those caused by viruses of the genus Crinivirus (family Closteroviridae), but absence or very low populations of whiteflies were observed. However, diseased foci showed clear indications of heavy aphid infestations. Later, during the fall of 2003, squash plants (Cucurbita pepo L.) grown in open fields in the same area showed similar symptoms. Tissue print hybridizations to detect Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo yellows virus (BPYV) in symptomatic samples were negative. CYSDV and BPYV are two yellowing-inducing criniviruses previously described in Spain. In contrast, standard double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with antiserum against Cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, family Luteoviridae) that was kindly provided by H. Lecoq (INRA-Montfavet Cedex, France) were consistently positive. Definitive confirmation of CABYV associated with symptomatic samples was obtained by performing reverse-transcription polymerase chain reaction (RT-PCR) analyses for the CABYV coat protein gene. Total RNA extracts (TRI reagent; Sigma Chemical, St. Louis, MO) were obtained from symptomatic and asymptomatic leaf samples and RT-PCR reactions were carried out using the primers 5′-GAATACGGTCGCGGCTAGAAATC-3′ (CE9) and 5′-CTATTTCGGGTTCTGGACCTGGC-3′ (CE10) based on the CABYV sequence published by Guilley et al. (2). A single DNA product of approximately 600 bp was obtained only from symptomatic samples. Amplified DNA fragments from two independent samples (samples 36-2 and 37-5) were cloned in E. coli and sequenced (GenBank Accession Nos. AY529653 and AY529654). Sequence comparisons showed a 95% nucleotide sequence identity between the two sequences. A 97% and 94% nucleotide sequence identity was found among 36-2 and 37-5, respectively and the CABYV sequence published by Guilley et al. (2). CABYV seems to be widespread throughout the Mediterranean Basin (1,3) but to our knowledge, it has not previously been described in Spain. Additionally, our data suggest that significant genetic variability might be present in the Spanish CABYV populations. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) H. Guilley et al. Virology 202:1012, 1994. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Download Full-text