First Report of Colletotrichum boninense Causing Anthracnose on Pepper in China

Anthracnose, caused by Colletotrichum spp., is a severe disease and results in large losses in pepper (Capsicum frutescens) production in China (4). Colletotrichum boninense is one of the Colletotrichum species in pepper in China. In August 2011, anthracnose symptoms (circular, sunken lesions with orange to black spore masses) were observed on pepper fruits in De-Yang, Sichuan Province, China. Three single-spore isolates (SC-6-1, SC-6-2, SC-6-3) were obtained from the infected fruits. A 5-mm diameter plug was transferred to potato dextrose agar (PDA); the isolates formed colonies with white margins and circular, dull orange centers. The conidia were cylindrical, obtuse at both ends, and 10.5 to 12.6 × 4.1 to 5.0 μm. The colonies grew rapidly at 25 to 28°C, and the average colony diameter was 51 to 52 mm after 5 days on PDA at 25°C. Based upon these characters, the causal agent was identified as C. boninense. To confirm the identity of the isolates, the internal transcribed spacer (ITS) regions were amplified with the ITS1/ITS4 universal primers (1). The internal transcribed spacer (ITS) sequences (Accession No. JQ926743) of the causal fungus shared 99 to 100% homology with ITS sequences of C. boninense in GenBank (Accession Nos. FN566865 and EU822801). The identity of the causal agent as C. boninense was also confirmed by species-specific primers (Col1/ITS4) (2). In a pathogenicity test, five detached ripe pepper fruits were inoculated with 1 μl of a conidial suspension (106 conidia/mL) or five fruits with 1 μl of sterile water were kept as control. After 7 days in a moist chamber at 25°C, typical anthracnose symptoms had developed on the five inoculated fruits but not on control fruits. C. boninense was reisolated from the lesions, and which was confirmed by morphology and molecular methods as before. There have reports of C. boninense infecting many species of plants, including pepper (3). To our knowledge, this is the first report of C. boninense causing anthracnose on pepper in China. References: (1) A. K. Lucia et al. Phytopathology 93:581, 2002. (2) S. A. Pileggi et al. Can. J. Microbiol. 55:1081, 2009. (3) H. J. Tozze et al. Plant Dis. 93:106, 2009. (4) M. L. Zhang. J. Anhui Agri. Sci. 2:21, 2000.

Download Full-text

First Report of Cercospora Leaf Spot Caused by Cercospora apii (= C. molucellae) on Bells-of-Ireland (Molucella laevis) in Mexico

Plant Disease ◽

10.1094/pdis-93-2-0197a ◽

2009 ◽

Vol 93 (2) ◽

pp. 197-197 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

U. Braun ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Cercospora Leaf Spot ◽

Single Spore ◽

First Report ◽

Cornell University ◽

Specific Fragment ◽

Species Specific

In late 2007, a new disease was found in commercial cutflower fields of bells-of-Ireland (Molucella laevis L.) in Texcoco, Mexico. Four plantings surveyed during this time had 100% incidence. A few spots on cutflowers make them unmarketable. Symptoms consisted of gray-green spots on leaves, calyxes, and stems, which turned brown with age. Spots were initially circular to oval, delimited by major leaf veins, and were visible on both adaxial and abaxial sides of the leaves. A Cercospora species was consistently associated with the spots. The fungus was isolated on V8 agar medium. Three single-spore cultures were obtained from isolation cultures. Cultures were incubated at 24°C under near-UV light for 7 days. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 condia/ml) on leaves of 16 potted M. laevis plants, incubating the plants in a dew chamber for 48 h, and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed in the field appeared on all inoculated plants after 2 weeks. No symptoms developed on control plants treated with autoclaved distilled water. The pathogenicity test was repeated twice with similar results. The fungus produced erumpent stromata, which were dark brown, spherical to irregular, 10 to 26 μm diameter, and giving rise to fascicles of five to nine divergent conidiophores, which were clear brown, paler near the subtruncate apex, straight to curved, not branched, rarely geniculate with two to four septa, and 57 × 3.4 μm. The conidia were formed singly, hyaline, acicular, base truncate, tip acute, straight to curved with 11 to 19 septa, and 172 × 3.5 μm. Fungal DNA from single-spore cultures was obtained with a commercial extraction kit (Qiagen, Hilden, Germany), amplified with ITS5 and ITS4 primers, and sequenced. The sequence, deposited at the National Center for Biotechnology Information Database (GenBank Accession No. EU564808), aligned almost perfectly (99% identity) to the bells-of-Ireland isolates from California (GenBank Accession Nos. AY156918 and AY156919) and New Zealand (Accession No. DQ233321). A 176-bp species-specific fragment was amplified with CercoCal-apii primers but not with CercoCal-beta or CercoCal-sp primers. These results, coupled with the morphological characteristics (1) and pathogenicity test, confirm the identity of the fungus as Cercospora apii sensu lato (including C. molucellae) (2,3,4). Although C. apii sensu lato has been reported on other hosts in Mexico (1,2), to our knowledge, this is the first report of this disease on M. laevis plants in this country. References: (1) C. Chupp. A Monograph of the Fungus Cercospora. Cornell University Press, Ithaca, NY, 1954. (2) P. W. Crous and U. Braun. CBS Biodiversity Series 1:1, 2003. (3) M. Groenewald et al. Phytopathology 95:951, 2005. (4) S. T Koike et al. Plant Dis. 87:203, 2003.

Download Full-text

First Report of Colletotrichum cereale Causing Anthracnose on Avena nuda in China

Plant Disease ◽

10.1094/pdis-10-20-2109-pdn ◽

2020 ◽

Author(s):

Na Zhao ◽

Junyu Yang ◽

Xiaoli Fang ◽

lingrui Li ◽

Hongfei Yan ◽

...

Keyword(s):

Morphological Characteristics ◽

Causal Agent ◽

Post Inoculation ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Fungal Isolates ◽

Colletotrichum Cereale ◽

Avena Nuda

Naked oats (Avena nuda L.) is rich in protein, fat, vitamin, mineral elements and so on, and is one of the world's recognized cereal crops with the highest nutritional and healthcare value. In July 2019, leaf spot was detected on A. nuda in Zhangbei experimental station of Hebei Agricultural University. The incidence of disease is 10% to 20%. The symptoms were similar to anthracnose disease, the infected leaves had fusiform or nearly fusiform yellowish-brown spots, yellow halo around the spots. Numerous acervuli with black setae diagnostic of fungi in the genus Colletotrichum were present on necrotic lesions. To identify the pathogen, ten symptomatic leaves were collected, and only one disease spot was isolated from each leaf. Small square leaf pieces (3 to 5 mm) were excised from the junction of diseased and healthy tissues with a sterile scalpel and surface disinfested with 75% alcohol for 30s, 0.1% corrosive sublimate for 1 min, rinsed three times in sterile water. Plant tissues were then transferred on potato dextrose agar (PDA), and incubated at 25°C for 7 days. Two fungal isolates were obtained and purified by single-spore isolation method. All fungi have the same morphology and no other fungi were isolated. The aerial mycelium was gray black. The conidia were colorless and transparent, falcate, slightly curved, tapered toward the tips, and produced in acervuli with brown setae. The length and width of 100 conidia were measured and size ranged from 1.86 to 3.84 × 8.62 to 29.81 μm. These morphological characteristics were consistent with the description of Colletotrichum cereale (Crouch et al. 2006). To further assess the identity of the species, the genomic DNA of two fungal isolates (LYM19-4 and LYM19-10) was extracted by a CTAB protocol. The ribosomal DNA internal transcribed spacer (ITS) region as well as, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), and the beta-tubulin 2 (Tub2) partial genes were amplified and sequenced with primers ITS4/5, GDF/GDR, ACT-512F/ACT-783R, and T1/Bt2b, respectively (Carbone et al. 1999; Templeton et al. 1992; O'Donnell et al. 1997; Glass et al. 1995). The sequences of the ITS-rDNA region (MW040121, MW040122), the GAPDH sequences (MW052554, MW052555), the ACT sequences (MW052556, MW052551) and the Tub2 sequences (MW052552, MW052553) of the two single-spore isolates were more than 99% identical to C. cereale isolate CGMCC3.15110 (JX625159, KC843517, KC843534 and JX625186). Maximum likelihood tree based on concatenated sequences of the four genes were constructed using MEGA7. The results showed the strains isolated from A. nuda were closely related to C. cereale, as supported by high bootstrap values. A pathogenicity test of the C. cereale isolates was performed on first unfolding leaves of A. nuda. Koch's postulates were carried out with isolates by spraying a conidial suspension of 106 conidia/mL on leaves of healthy A. nuda. Four replicated pots were inoculated at a time, 10 leaves each pot, while sterile distilled water was used as the control. All treated plants were placed in a moist chamber (25°C, 16-h light and 8-h dark period). Anthracnose symptoms developed on the inoculated plants 7 days post inoculation while all control plants remained healthy. Microscopic examination showed the surface of infected leaves had the same acervuli, setae, and conidia as the original isolate. The pathogenicity test was repeated three times. C. cereale was previously reported as the causal agent of anthracnose on feather reed grass in US (Crouch et al. 2009). To our knowledge, this is the first report of C. cereale as the causal agent of A. nuda anthracnose in China.

Download Full-text

First Report of Ramularia coleosporii causing Leaf Spot on Perilla frutescens in Korea

Plant Disease ◽

10.1094/pdis-01-21-0223-pdn ◽

2021 ◽

Author(s):

Md Aktaruzzaman ◽

Tania Afroz ◽

Hyo-Won Choi ◽

Byung Sup Kim

Keyword(s):

Leaf Spot ◽

Ipomoea Batatas ◽

Rust Fungus ◽

Morphological Characteristics ◽

Perilla Frutescens ◽

Herbaceous Plant ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Perilla (Perilla frutescens var. japonica), a member of the family Labiatae, is an annual herbaceous plant native to Asia. Its fresh leaves are directly consumed and its seeds are used for cooking oil. In July 2018, leaf spots symptoms were observed in an experimental field at Gangneung-Wonju National University, Gangneung, Gangwon province, Korea. Approximately 30% of the perilla plants growing in an area of about 0.1 ha were affected. Small, circular to oval, necrotic spots with yellow borders were scattered across upper leaves. Masses of white spores were observed on the leaf underside. Ten small pieces of tissue were removed from the lesion margins of the lesions, surface disinfected with NaOCl (1% v/v) for 30 s, and then rinsed three times with distilled water for 60 s. The tissue pieces were then placed on potato dextrose agar (PDA) and incubated at 25°C for 7 days. Five single spore isolates were obtained and cultured on PDA. The fungus was slow-growing and produced 30-50 mm diameter, whitish colonies on PDA when incubated at 25ºC for 15 days. Conidia (n= 50) ranged from 5.5 to 21.3 × 3.5 to 5.8 μm, were catenate, in simple or branched chains, ellipsoid-ovoid, fusiform, and old conidia sometimes had 1 to 3 conspicuous hila. Conidiophores (n= 10) were 21.3 to 125.8 × 1.3 to 3.6 μm in size, unbranched, straight or flexuous, and hyaline. The morphological characteristics of five isolates were similar. Morphological characteristics were consistent with those described for Ramularia coleosporii (Braun, 1998). Two representative isolates (PLS 001 & PLS003) were deposited in the Korean Agricultural Culture Collection (KACC48670 & KACC 48671). For molecular identification, a multi-locus sequence analysis was conducted. The internal transcribed spacer (ITS) regions of the rDNA, partial actin (ACT) gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified using primer sets ITS1/4, ACT-512F/ACT-783R and gpd1/gpd2, respectively (Videira et al. 2016). Sequences obtained from each of the three loci for isolate PLS001 and PLS003 were deposited in GenBank with accession numbers MH974744, MW470869 (ITS); MW470867, MW470870 (ACT); and MW470868, MW470871 (GAPDH), respectively. Sequences for all three genes exhibited 100% identity with R. coleosporii, GenBank accession nos. GU214692 (ITS), KX287643 (ACT), and 288200 (GAPDH) for both isolates. A multi-locus phylogenetic tree, constructed by the neighbor-joining method with closely related reference sequences downloaded from the GenBank database and these two isolates demonstrated alignment with R. coleosporii. To confirm pathogenicity, 150 mL of a conidial suspension (2 × 105 spores per mL) was sprayed on five, 45 days old perilla plants. An additional five plants, to serve as controls, were sprayed with sterile water. All plants were placed in a humidity chamber (>90% relative humidity) at 25°C for 48 h after inoculation and then placed in a greenhouse at 22/28°C (night/day). After 15 days leaf spot symptoms, similar to the original symptoms, developed on the leaves of the inoculated plants, whereas the control plants remained symptomless. The pathogenicity test was repeated twice with similar results. A fungus was re-isolated from the leaf lesions on the inoculated plants which exhibited the same morphological characteristics as the original isolates, fulfilling Koch’s postulates. R. coleosporii has been reported as a hyperparasite on the rust fungus Coleosporium plumeriae in India & Thailand and also as a pathogen infecting leaves of Campanula rapunculoides in Armenia, Clematis gouriana in Taiwan, Ipomoea batatas in Puerto Rico, and Perilla frutescens var. acuta in China (Baiswar et al. 2015; Farr and Rossman 2021). To the best of our knowledge, this is the first report of R. coleosporii causing leaf spot on P. frutescens var. japonica in Korea. This disease poses a threat to production and management strategies to minimize leaf spot should be developed.

Download Full-text

First Report of Anthracnose Caused by Colletotrichum gloeosporioides in Pumpkin in Trinidad

Plant Disease ◽

10.1094/pdis-94-8-1062a ◽

2010 ◽

Vol 94 (8) ◽

pp. 1062-1062

Author(s):

S. N. Rampersad

Keyword(s):

Colletotrichum Gloeosporioides ◽

Phylogenetic Analyses ◽

Pcr Amplification ◽

Positive Control ◽

Universal Primers ◽

Conidial Suspension ◽

Specific Primers ◽

First Report ◽

Main Production ◽

Species Specific

In Trinidad, pumpkin (Cucurbita pepo L. and C. moschata L.) is extensively grown for local and international export markets. In November 2008, symptoms of foliar chlorosis and necrosis were observed in 15 commercial pumpkin fields located in the main production areas of St. George East, Caroni, Victoria, and St. Patrick counties. Severely infected plants were unable to support fruit maturation, which resulted in yield loss. The pathogen was isolated from surface-sterilized tissues of symptomatic plants. Colonies on potato dextrose agar (PDA) were white to cream with gray spore masses in the center. Conidia were hyaline, cylindrical with rounded ends, aseptate, and measured 12.5 to 16.5 μm × 3.5 to 5.0 μm. PCR amplification was carried out with ITS4/5 universal primers (4) and species-specific primers, CgInt/ITS4 (1), using a positive control of Colletotrichum gloeosporioides (courtesy of D. Perez-Brito). Species-specific primers generated a single amplicon, ~450 bp long, which corresponded with the positive control. The ITS1 region (1) of pumpkin isolates (GenBank No. GU320190) was 100% identical to cognate sequences of C. gloeosporioides isolates (GenBank Nos. AY841136 and FJ624257). Phylogenetic analyses (MEGA 4 – Molecular Evolutionary Genetic Analysis Software version 4 for Windows) using the neighbor-joining (NJ) algorithm placed the pumpkin isolates in a well-supported cluster (>90% bootstrap value based on 1,000 replicates) with other C. gloeosporioides isolates. The tree was rooted with C. crassipes (GenBank No. AJ536230). The pathogen was similar to C. gloeosporioides (Penz.) Penz. & Sacc. (3). In pathogenicity tests, six plants (cv. Jamaican squash) for each of five isolates were spray inoculated to runoff with a conidial suspension (1.0 × 106 conidia/ml). Negative controls were sprayed with sterile distilled water. In repeated tests, plants were symptomatic of infection 7 days postinoculation. There were no symptoms on control plants. Koch's postulates were fulfilled with the reisolation of the pathogen from symptomatic leaf tissues. Anthracnose is a serious threat to cucurbit production; however, infection is not common in pumpkin and squash (2). To my knowledge, this is the first report of C. gloeosporioides causing widespread anthracnose infection in pumpkin in Trinidad. References: (1) A. E. Brown et al. Phytopathology 86:523, 1996. (2) G. Kelly. Acta Hortic. (ISHS) 731:479, 2007. (3) B. C. Sutton. Page 1 in: Colletotrichum: Biology, Pathology and Control. CAB International. Wallingford, UK, 1992. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Passalora Leaf Spot Caused by Passalora bougainvilleae on Bougainvillea in Mexico

Plant Disease ◽

10.1094/pdis-11-10-0787 ◽

2011 ◽

Vol 95 (6) ◽

pp. 775-775 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

V. Santiago-Santiago ◽

A. Madariaga-Navarrete ◽

A. Castañeda-Vildozola ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Disease Incidence ◽

Morphological Characteristics ◽

The United States ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Bougainvillea Spectabilis

Bougainvillea (Bougainvillea spectabilis Willd) growing in 28 gardens during 2009 showed 100% disease incidence and 3 to 7% disease severity. Bougainvilleas with white flowers were the most affected. Symptoms consisted of light brown spots with dark brown margins visible on adaxial and abaxial sides of the leaves. Spots were circular, 2 to 7 mm in diameter, often surrounded by a chlorotic halo, and delimited by major leaf veins. Single-spore cultures were incubated at 24°C under near UV light for 7 days to obtain conidia. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 spores/ml) on leaves of potted bougainvillea plants (white, red, yellow, and purple flowers), incubating the plants in a dew chamber for 48 h and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed at the residential gardens appeared on inoculated plants after 45 to 60 days. The fungus was reisolated from inoculated plants that showed typical symptoms. No symptoms developed on control plants treated with sterile distilled water. The fungus produced distinct stromata that were dark brown, spherical to irregular, and 20 to 24 μm in diameter. Conidiophores were simple, born from the stromata, loose to dense fascicles, brown, straight to curved, not branched, zero to two septate, 14 × 2 μm, with two to four conspicuous and darkened scars. The conidia formed singly, were brown, broad, ellipsoid, obclavate, straight to curved with three to four septa, 40 × 4 μm, and finely verrucous with thick hilum at the end. Fungal DNA from the single-spore cultures was obtained using a commercial DNA Extraction Kit (Qiagen, Valencia, CA); ribosomal DNA was amplified with ITS5 and ITS4 primers and sequenced. The sequence was deposited at the National Center for Biotechnology Information Database (GenBank Accession Nos. HQ231216 and HQ231217). The symptoms (4), morphological characteristics (1,2,4), and pathogenicity test confirm the identity of the fungus as Passalora bougainvilleae (Muntañola) Castañeda & Braun (= Cercosporidium bougainvilleae Muntañola). This pathogen has been reported from Argentina, Brazil, Brunei, China, Cuba, El Salvador, India, Indonesia, Jamaica, Japan, Thailand, the United States, and Venezuela (3). To our knowledge, this is the first report of this disease on B. spectabilis Willd in Mexico. P. bougainvilleae may become an important disease of bougainvillea plants in tropical and subtropical areas of Mexico. References: (1) U. Braun and R. R. Castañeda. Cryptogam. Bot. 2/3:289, 1991. (2) M. B. Ellis. More Dematiaceous Hypomycetes. Commonwealth Mycological Institute, Kew, Surrey, UK, 1976. (3) C. Nakashima et al. Fungal Divers. 26:257, 2007. (4) K. L. Nechet and B. A. Halfeld-Vieira. Acta Amazonica 38:585, 2008.

Download Full-text

First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida

Plant Disease ◽

10.1094/pdis-91-7-0905b ◽

2007 ◽

Vol 91 (7) ◽

pp. 905-905 ◽

Cited By ~ 7

Author(s):

H. K. Yun ◽

C. Louime ◽

J. Lu

Keyword(s):

United States ◽

Pcr Primers ◽

The United States ◽

Causal Agent ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Elsinoe Ampelina ◽

Muscadine Grapes

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing root rot on chickpea in Mexico

Plant Disease ◽

10.1094/pdis-05-21-1123-pdn ◽

2021 ◽

Author(s):

Sixto Velarde Felix ◽

Victor Valenzuela ◽

Pedro Ortega ◽

Gustavo Fierros ◽

Pedro Rojas ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Species Complex ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Chickpea (Cicer aretinium L.) is a legume crop of great importance worldwide. In January 2019, wilting symptoms on chickpea (stunted grow, withered leaves, root rot and wilted plants) were observed in three fields of Culiacan Sinaloa Mexico, with an incidence of 3 to 5%. To identify the cause, eighty symptomatic chickpea plants were sampled. Tissue from roots was plated on potato dextrose agar (PDA) medium. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Ff01 to Ff10). On PDA the colonies were abundant with white aerial mycelium, hyphae were branched and septae and light purple pigmentation was observed in the center of old cultures (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidias were falciform, hyaline, with slightly curved apexes, three to five septate, with well-developed foot cells and blunt apical cells, and measured 26.6 to 45.8 × 2.2 to 7.0 μm (n = 40). The microconidia (n = 40) were hyaline, one to two celled, produced in false heads that measured 7.4 to 20.1 (average 13.7) μm × 2.4 to 8.9 (average 5.3) μm (n = 40) at the tips of long monophialides, and were oval or reniform, with apexes rounded, 8.3 to 12.1 × 1.6 to 4.7 μm; chlamydospores were not evident. These characteristics fit those of the Fusarium solani (Mart.) Sacc. species complex, FSSC (Summerell et al. 2003). The internal transcribed spacer and the translation elongation factor 1 alpha (EF1-α) genes (O’Donnell et al. 1998) were amplified by polymerase chain reaction and sequenced from the isolate Ff02 and Ff08 (GenBank accession nos. KJ501093 and MN082369). Maximum likelihood analysis was carried out using the EF1-α sequences (KJ501093 and MN082369) from the Ff02 and Ff08 isolates and other species from the Fusarium solani species complex (FSSC). Phylogenetic analysis revealed the isolate most closely related with F. falciforme (100% bootstrap). For pathogenicity testing, a conidial suspension (1x106 conidia/ml) was prepared by harvesting spores from 10-days-old cultures on PDA. Twenty 2-week-old chickpea seedlings from two cultivars (P-2245 and WR-315) were inoculated by dipping roots into the conidial suspension for 20 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80% and a 12-h/12-h light/dark cycle. After 8 days, the first root rot symptoms were observed on inoculating seedlings and the infected plants eventually died within 3 to 4 weeks after inoculation. No symptoms were observed plants inoculated with sterilized distilled water. The fungus was reisolated from symptomatic tissues of inoculated plants and was identified by sequencing the partial EF1-α gene again and was identified as F. falciforme (FSSC 3 + 4) (O’Donnell et al. 2008) based on its morphological characteristics, genetic analysis, and pathogenicity test, fulfilling Koch’s postulates. The molecular identification was confirmed via BLAST on the FusariumID and Fusarium MLST databases. Although FSSC has been previously reported causing root rot in chickpea in USA, Chile, Spain, Cuba, Iran, Poland, Israel, Pakistan and Brazil, to our knowledge this is the first report of root rot in chickpea caused by F. falciforme in Mexico. This is important for chickpea producers and chickpea breeding programs.

Download Full-text

First Report of Basal Stem Rot of Apple Cactus (Cereus peruvianus monstruosus) Caused by Fusarium oxysporum in Italy

Plant Disease ◽

10.1094/pdis-03-11-0216 ◽

2011 ◽

Vol 95 (7) ◽

pp. 877-877

Author(s):

A. Garibaldi ◽

P. Pensa ◽

D. Bertetti ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

United States ◽

Fusarium Oxysporum ◽

The United States ◽

Stem Rot ◽

Fluorescent Light ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

Basal Stem Rot ◽

First Report

During the summer of 2010, 20% of 7,000 4-month-old plants of apple cactus (Cereus peruvianus monstruosus) showed symptoms of a basal stem rot in a commercial nursery located in Liguria (northern Italy). Affected plants showed yellow orange-to-pale brown color from the crown level to the stem apex and a water-soaked rot was observed on the stem starting from the base. Brown discoloration was observed in the vascular system. Eventually stems bent, plants collapsed and died, and affected tissues dried out. A Fusarium sp. was consistently and readily isolated from symptomatic tissue on Komada selective medium. Isolates were purified and subcultured on potato dextrose agar (PDA). Single-spore cultures on PDA, Spezieller Nährstoffarmer agar (SNA) (3), and carnation leaf-piece agar (CLA) (2) were incubated at 26 ± 1°C (12-h fluorescent light, 12-h dark). On PDA, cultures produced a thick growth of white-to-pink mycelium and pale pink pigments in the agar. On SNA, cultures produced short monophialides with unicellular, ovoid-elliptical microconidia measuring 4.3 to 8.2 × 2.3 to 3.8 (average 6.0 × 2.8) μm. Chlamydospores were abundant, single or paired, terminal and intercalary, rough walled, and 6 to 8 μm in diameter. On CLA, cultures produced orange sporodochia with macroconidia that were 3 to 4 septate, nearly straight with a foot-shaped basal cell and a short apical cell, and measured 31.1 to 51.5 × 4.4 to 3.5 (average 43.2 × 3.8) μm. Such characteristics are typical of Fusarium oxysporum (3). Amplification of the ITS (internal transcribed spacer) of the rDNA using primers ITS1/ITS4 (4) yielded a 498-bp band. Sequencing and BLASTn analysis of this band showed an E-value of 0.0 with F. oxysporum. The nucleotide sequence has been assigned GenBank Accession No. JF422071. To confirm pathogenicity, five 6-month-old healthy plants of C. peruvianus monstruosus were inoculated by dipping roots in a conidial suspension (2.4 × 106 CFU/ml) of F. oxysporum isolated from affected plants. Inoculum was obtained from pure cultures of three single-spore isolates grown for 10 days on casein hydrolysate liquid medium. Roots were not wounded before the inoculation. Plants were transplanted into pots filled with steam-sterilized substrate (sphagnum peat/perlite/pine bark/clay 50:20:20:10). Five noninoculated plants served as a control. Plants were placed in a climatic chamber at 25 ± 1°C (12-h fluorescent light, 12 h-dark). Basal stem rot and vascular discoloration in the crown and stem developed within 30 days on each inoculated plant. Noninoculated plants remained healthy. F. oxysporum was consistently isolated from symptomatic plants. The pathogenicity test was conducted twice. F. oxysporum has been reported on Cereus spp. in the United States (1). To our knowledge, this is the first report of F. oxysporum on C. peruvianus monstruosus in Italy as well as in Europe. Currently, this disease is present in a few nurseries in Liguria. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (2) N. L. Fisher et al. Phytopathology 72:151, 1982. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell, Ames, IA, 2006. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

Download Full-text

First Report of Leptosphaeria biglobosa Causing Black Leg on Brassica campestris ssp. chinensis var. purpurea in Central China

Plant Disease ◽

10.1094/pdis-01-14-0098-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1156-1156 ◽

Cited By ~ 1

Author(s):

X. Cai ◽

L. Yang ◽

J. Zhang ◽

G. Q. Li

Keyword(s):

Gene Sequence ◽

Brassica Campestris ◽

Its Sequences ◽

Central China ◽

Colony Morphology ◽

Conidial Suspension ◽

First Report ◽

Black Leg ◽

Species Specific ◽

Β Tubulin

Purple cai-tai (Brassica campestris ssp. chinensis var. purpurea) is a traditional vegetable widely grown in southern China. In 2012 and 2013, black leg disease was observed on purple cai-tai in three surveyed cities (Jingzhou, Qianjiang, and Huanggang) in Hubei Province of China. Disease incidence ranged from 5 to 88% in eight surveyed fields. White cankers occurred on basal stems and numerous black pycnidia and pink conidia were present on the stem surface. Surface-sterilized (5% NaOCl for 90 s, rinsed in sterilized water three times) stem pieces were plated on potato dextrose agar (PDA) and incubated at 20°C and 12 h light/12 h dark for 7 days. A total of 22 isolates were obtained. All of the isolates appeared similar in colony morphology on PDA (20°C, 7 to 10 days), producing yellow pigment and black-brown, globose pycnidia containing cylindrical hyaline conidia (4 to 5 × 2 μm). These characteristics matched the description for Phoma lingam, the anamorph Leptosphaeria maculans and L. biglobosa (2). Species-specific primers LbigF, LmacF, and LmacR (1) were used in PCR-based identification of the isolates. A 444-bp DNA fragment characteristic of L. biglobosa was amplified from DNA extracted from all of the collected isolates. DNA amplification from the isolate UK-1 of L. maculans from B. napus in Hertfordshire of the United Kingdom yielded a 331-bp fragment. Two isolates, HGHCT2-1 and HGHCT2-2, were further identified by cloning and analysis of the ITS sequences and the partial sequences encoding β-tubulin and actin (3,4). The ITS sequences (586 bp, GenBank Accession. Nos. KF371660 and KF371661) were 100% identical to L. biglobosa ‘brassicae’ strain UK28 (DQ133893). The DNA sequences for β-tubulin (479 bp, KF307760 and KF307761) and actin (899 bp, KF307758 and KF307759) were 99 and 100% identical to the partial β-tubulin gene sequence (AY748997) and the partial actin gene sequence (AY748949) of the L. biglobosa ‘brassicae’ strain 2379-4, respectively. Pathogenicity of six randomly selected isolates was determined on two purple cai-tai cvs. Wanzi Qianhong and Jiu Yue Xian. Cotyledons of 10-day-old seedlings grown in potting mix in pots were pricked with a sterilized needle, and each wound was inoculated with 10 μl of conidial suspension (1 × 107 conidia/ml) of an isolate or 10 μl sterilized water (control). There were 12 cotyledons for each isolate and control. The experiment was repeated once. The treated seedlings were incubated at 20°C in an incubator under 12 h light/12 h dark for 12 days. The control cotyledons were healthy, but necrotic lesions were developed on the cotyledons that were inoculated with L. biglobosa and formation of pycnidia was observed on some lesions. Fungi re-isolated from the lesions were similar to the original L. biglobosa isolates both in colony morphology on PDA and in species-specific PCR testing. No fungi were isolated from the control cotyledons. This is the first report of L. biglobosa causing black leg on B. campestris ssp. chinensis var. purpurea in central China. The finding will be useful for understanding of the epidemiology of black leg on cruciferous crops and for management of this disease. References: (1) S. Y. Liu et al. Plant Pathol. 55:401, 2006. (2) R. A. Shoemaker and H. Burn. Can J Bot. 79:412, 2001. (3) L. Vincenot et al. Phytopathology 98:321, 2008. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Corynespora Leaf Spot of Eucalyptus in China

Plant Disease ◽

10.1094/pdis-07-14-0697-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 419-419 ◽

Cited By ~ 1

Author(s):

C. K. Phan ◽

J. G. Wei ◽

F. Liu ◽

B. S. Chen ◽

J. T. Luo ◽

...

Keyword(s):

Leaf Spot ◽

Southern China ◽

Tap Water ◽

Pathogenic Fungi ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Eucalyptus is widely planted in the tropics and subtropics, and it has become an important cash crop in Southern China because of its fast-growing nature. In the Guangxi Province of southern China, Eucalyptus is produced on approximately 2 million ha, and two dominant asexual clones, Guanglin No. 9 (E. grandis × E. urophylla) and DH3229 (E. urophylla × E. grandis), are grown. Diseases are an increasing threat to Eucalyptus production in Guangxi since vast areas are monocultured with this plant. In June 2013, a leaf spot disease was observed in eight out of 14 regions in the province on a total of approximately 0.08 million ha of Eucalyptus. Initially, the lesions appeared as water-soaked dots on leaves, which then became circular or irregular shaped with central gray-brown necrotic lesions and dark red-brown margins. The size of leaf spots ranged between 1 and 3 mm in diameter. The main vein or small veins adjacent to the spots were dark. The lesions expanded rapidly during rainy days, producing reproductive structures. In severe cases, the spots coalesced and formed large irregular necrotic areas followed by defoliation. The causal fungus was isolated from diseased leaves. Briefly, the affected leaves were washed with running tap water, sterilized with 75% ethanol (30 s) and 0.1% mercuric dichloride (3 min), and then rinsed three times with sterilized water. Small segments (0.5 to 0.6 cm2) were cut from the leading edge of the lesions and plated on PDA. The plates were incubated at 25°C for 7 to 10 days. When mycelial growth and spores were observed, a single-spore culture was placed on PDA and grown in the dark at 25°C for 10 days. A pathogenicity test was done by spraying a conidial suspension (5 × 105 conidia ml–1) of isolated fungus onto 30 3-month-old leaves of Guanglin No. 9 seedlings. The plants were covered with plain plastic sheets for 7 days to keep the humidity high. Lesions similar to those observed in the forests were observed on the inoculated leaves 7 to 10 days after incubation. The same fungus was re-isolated. Leaves of control plants (sprayed with sterilized water) were disease free. Conidiophores of the fungus were straight to slightly curved, erect, unbranched, septate, and pale to light brown. Conidia were formed in chains or singly with 4 to 15 pseudosepta, which were oblong oval to cylindrical, subhyaline to pale olivaceous brown, straight to curved, 14.5 to 92.3 μm long, and 3.5 to 7.1 μm wide. The fungus was morphologically identified as Corynespora cassiicola (1). DNA of the isolate was extracted, and the internal transcribed spacer (ITS) region (which included ITS 1, 5.8S rDNA gene of rDNA, and ITS 2) was amplified with primers ITS5 and ITS4. 529 base pair (bp) of PCR product was obtained and sequenced. The sequence was compared by BLAST search to the GenBank database and showed 99% similarity to C. cassiicola (Accession No. JX087447). Our sequence was deposited into GenBank (KF669890). The biological characters of the fungus were tested. Its minimum and maximum growth temperatures on PDA were 7 and 37°C with an optimum range of 25 to 30°C. At 25°C in 100% humidity, 90% of conidia germinated after 20 h. The optimum pH for germination was 5 to 8, and the lethal temperature of conidia was 55°C. C. cassiicola has been reported causing leaf blight on Eucalyptus in India and Brazil (2,3) and causing leaf spot on Akebia trifoliate in Guangxi (4). This is the first report of this disease on Eucalyptus in China. References: (1) M. B. Ellis and P. Holliday. CMI Descriptions of Pathogenic Fungi and Bacteria, No. 303. Commonwealth Mycological Institute, Kew, Surrey, UK, 1971. (2) B. P. Reis, et al. New Dis. Rep. 29:7, 2014. (3) K. I. Wilson and L. R. Devi. Ind. Phytopathol. 19:393, 1966. (4) Y. F. Ye et al. Plant Dis. 97:1659, 2013.

Download Full-text