First report of Diplodia seriata, D. mutila, and Dothiorella omnivora associated with apple cankers and dieback in Rio Negro, Argentina

Apple (Malus domestica Borkh.) is an important fruit crop in Río Negro, Argentina. In recent years, the frequency of canker and dieback symptoms have increased affecting different apple cultivars. In September 2014, a higher occurrence of cankers (29%) and dieback (9%) was observed in a commercial orchard of 10-year-old apple trees (n=210) cv ʻItal Redʼ in General Roca, Río Negro, Argentina (39°2'36.73"S – 67°32'44.55"W). Symptoms initially appeared as necrotic bark lesions on tree trunks and branches often associated with pruning wounds. Superficially, papyrus detachment of the bark and cracked bark were observed on the affected area. When the bark was removed, the diseased wood showed dark brown color. Cross sections of diseased branches revealed necrotic lesions that progress to branch death. Samples were collected from different symptomatic trees (n=30) and were superficially disinfected with 70% ethanol. Internal tissues (0.5 cm2) were excised from the advance margin of the necrotic lesions, plated on potato dextrose agar (PDA), and incubated at 22°C. Pycnidia were induced on sterilised pine needles overlaid on 2% water agar under near-UV light. Optimum temperature of culture growth on PDA was studied. According to their morpho-cultural characteristics, three different morphotypes were identified. The first, showed optimum growth at 30°C, had moderately dense white aerial mycelia and turned dark gray after 7 d. Conidia were ovoid, mostly aseptate, 20.8-25.6 × 8-11.4 µm (n=50) and hyaline to brown. The second, exhibited optimum growth from 25 to 30°C, was white to gray, with sparse to moderate aerial mycelium that turned dark olive green. Conidia were ovoid, 1-septate, 17.6-22.4 × 8.1-11.2 µm (n=50) and brown. Finally, the third showed optimum growth at 25°C, mycelium was grey to dark olive green. Conidia were oblong to ovoid with both ends rounded, aseptate and 1-septate at maturity, 20.8-24 × 11.2-14.4 µm (n=50), hyaline turned brown. Genomic DNA was extracted from one representative isolate of each morphotype and the ITS and EF1-α loci were amplified with the primer sets ITS1/ITS4 (White et al., 1990) and EF1-728F/EF1-986R (Carbone and Kohn, 1999), respectively. The nucleotide sequences indicated ≥99% identity to D. seriata (CBS 114796 and CBS 112555), D. mutila (CBS 302.36 and CBS 112553), and D. juglandis (CBS 188.87), reclassified as Dothiorella omnivora (Linaldeddu et al., 2016), for both DNA regions. The sequences were deposited in the GenBank database (MW596418, MW598375; MH665432, MK955889; MH665413, MK937229). To confirm pathogenicity, healthy 1-year-old twigs of adult apple trees were pruned and wounds of attached twigs immediately inoculated with 20 μL of conidial suspension (103 conidia.mL-1, n=9 per isolate) or sterile distilled water (control, n=9), and wrapped with Parafilm. The experimental design was randomized, and the experiment was repeated once. After 90 d, the area of lesion on all twigs inoculated was determined. D. mutila and Do. omnivora produced mean canker areas (65 and 73 mm2, respectively) significantly larger (p < 0.005) than D. seriata (48 mm2). No lesion occurred in the negative controls. Fulfilling Koch’s postulates, fungi were reisolated from all inoculated twigs and no fungus was recovered from controls. To our knowledge, this is the first report of D. seriata, D. mutila, and Do. omnivora associated with apple canker and dieback in Argentina, which shows the need of study the role of these fungi in orchard health.

Download Full-text

First Report of Lasiodiplodia theobromae Causing Dieback of Aquilaria sinensis in Taiwan

Plant Disease ◽

10.1094/pdis-10-12-0998-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 690-690 ◽

Cited By ~ 2

Author(s):

M.-C. Fan ◽

H.-C. Yeh ◽

C.-F. Hong

Keyword(s):

Uv Light ◽

Aerial Mycelium ◽

Molecular Characteristics ◽

Width Ratio ◽

Sodium Hypochlorite Solution ◽

Aquilaria Sinensis ◽

Lasiodiplodia Theobromae ◽

First Report ◽

Tree Survival ◽

Pathogenicity Tests

Incense trees (Aquilaria sinensis (Lour.) Gilg) belong to a plant family used for alternative medicine in China and the production of wood. In the summer of 2012, at a nursery in Niaosong district, Kaohsiung City, Taiwan, more than 30% of a total of 400 incense trees had dieback symptoms on twigs with leaves attached, leading to eventual death of the entire plant. Symptomatic twigs and trunk pieces from six trees were collected and discolored tissues were excised, surface sterilized in 0.5% sodium hypochlorite solution, rinsed in sterilized distilled water, dried on sterilized filter paper, and then placed in petri dishes containing 2% water agar (WA). The dishes were incubated at room temperature for 1 to 2 days to obtain fungal strains from diseased tissues. The hyphal tips from developing fungal colonies were transferred to potato dextrose agar (PDA, Difco) dishes and placed under UV light (12 h/day) at 30°C. The purified colonies were used as inoculum in the pathogenicity tests. Pathogenicity tests were performed on 2-month-old A. sinensis seedlings, each treatment had three plants. Each plant was wounded by removing bark of the twigs with a disinfected scalpel enough to place a mycelium plug (about 5 × 10 mm2) of 7-day-old fungal isolate on the wound. The inoculated area was wrapped with a wet paper towel and Parafilm. Control plants were treated with PDA plugs. The symptoms described above were observed on inoculated plants 4 to 8 days after inoculation whereas control plants did not show symptoms. Diseased twigs were cut and placed in a moist chamber 21 days after inoculation and conidia oozing from pycnidia were observed. The same fungal pathogen was reisolated from inoculated plants, but not from the control. To identify the pathogen, the fungus was cultured as described above. The colonies were initially white with green to gray aerial mycelium after 5 to 6 days and eventually turned darker. Immature conidia were hyaline and one-celled, but mature conidia were dark brown, two-celled, thin-walled, and oval-shaped with longitudinal striations. The average size of 100 conidia was 25.23 ± 1.97 × 13.09 ± 0.99 μm with a length/width ratio of 1.92. For the molecular identification, the internal transcribed spacer (ITS) region of ribosomal DNA was PCR amplified with primers ITS1 and ITS4 (2) and sequenced. The sequences were deposited in GenBank (Accession No. JX945583) and showed 99% identity to Lasiodiplodia theobromae (HM346871, GQ469929, and HQ315840). Hence, both morphological and molecular characteristics confirmed the pathogen as L. theobromae (Pat.) Griffon & Maubl (1). To the best of our knowledge, this is the first report of L. theobromae causing dieback on Incense tree. This disease threatens tree survival and may decrease the income of growers. References: (1) W. H. Ko et al. Plant Dis. 88:1383, 2004. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.

Download Full-text

First report of Trichoderma afroharzianum causing seed rot on maize in Italy

Plant Disease ◽

10.1094/pdis-12-21-2697-pdn ◽

2022 ◽

Author(s):

Martina Sanna ◽

Massimo Pugliese ◽

Maria Lodovica GULLINO ◽

Monica Mezzalama

Keyword(s):

Rna Polymerase Ii ◽

Elongation Factor ◽

Aerial Mycelium ◽

Light Cycle ◽

Conidial Suspension ◽

Ear Rot ◽

Trichoderma Spp ◽

Trichoderma Species ◽

First Report ◽

Pathogenicity Tests

Maize (Zea mays L.) is a cereal crop of great economic importance in Italy; production is currently of 60,602,320 t, covering 588,597 ha (ISTAT 2021). Trichoderma species are widespread filamentous fungi in soil, well known and studied as biological control agents (Vinale et al., 2008). Seeds of a yellow grain hybrid (class FAO 700, 132 days) were collected in September 2020 from an experimental field located in Carmagnola (TO, Italy: GPS: 44°53'11.0"N 7°40'60.0"E) and tested with blotter test (Warham et al., 1996) to assess their phytosanitary condition. Over the 400 seeds tested, more than 50% showed rotting and development of green mycelium typical of the genus Trichoderma. Due to the high and unexpected percentage of decaying kernels, ten colonies were identified by morphological and molecular methods. Single conidia colonies of one Trichoderma (T5.1) strain were cultured on Potato Dextrose Agar (PDA) for pathogenicity tests, and on PDA and Synthetic Nutrient-Poor Agar (SNA) for morphological and molecular identification. The colonies grown on PDA and SNA showed green, abundant, cottony, and radiating aerial mycelium, and yellow pigmentation on the reverse. Colony radius after 72 h at 30°C was of 60-65 mm on PDA and of 50-55 mm on SNA. The isolates produced one cell conidia 2.8 - 3.8 µm long and 2.1 - 3.6 µm wide (n=50) on SNA. Conidiophores and phialides were lageniform to ampulliform and measured 4.5 – 9.7 µm long and 1.6 – 3.6 µm wide (n=50); the base measure 1.5 – 2.9 µm wide and the supporting cell 1.4 – 2.8 µm wide (n=50). The identity of one single-conidia strain was confirmed by sequence comparison of the internal transcribed spacer (ITS), the translation elongation factor-1α (tef-1α), and RNA polymerase II subunit (rpb2) gene fragments (Oskiera et al., 2015). BLASTn searches of GenBank using ITS (OL691534) the partial tef-1α (OL743117) and rpb2 (OL743116) sequences of the representative isolate T5.1, revealed 100% identity for rpb2 to T. afroharzianum TRS835 (KP009149) and 100% identity for tef-1α to T. afroharzianum Z19 (KR911897). Pathogenicity tests were carried out by suspending conidia from a 14-days old culture on PDA in sterile H2O to 1×106 CFU/ml. Twenty-five seeds were sown in pots filled with a steamed mix of white peat and perlite, 80:20 v/v, and maintained at 23°C under a seasonal day/night light cycle. Twenty primary ears were inoculated, by injection into the silk channel, with 1 ml of a conidial suspension of strain T5.1 seven days after silk channel emergence (BBCH 65) (Pfordt et al., 2020). Ears were removed four weeks after inoculation and disease severity, reaching up to 75% of the kernels of the twenty cobs, was assessed visually according to the EPPO guidelines (EPPO, 2015). Five control cobs, inoculated with 1 ml of sterile distilled water were healthy. T. afroharzianum was reisolated from kernels showing a green mold developing on their surface and identified by resequencing of tef-1α gene. T. afroharzianum has been already reported on maize in Germany and France as causal agent of ear rot of maize (Pfordt et al. 2020). Although several species of Trichoderma are known to be beneficial microorganisms, our results support other findings that report Trichoderma spp. causing ear rot on maize in tropical and subtropical areas of the world (Munkvold and White, 2016). The potential production of mycotoxins and the losses that can be caused by the pathogen during post-harvest need to be explored. To our knowledge this is the first report of T. afroharzianum as a pathogen of maize in Italy.

Download Full-text

First Report of Stem Dieback Caused by Lasiodiplodia parva on Styphnolobium japonicum in China

Plant Disease ◽

10.1094/pdis-08-21-1598-pdn ◽

2021 ◽

Author(s):

Ziwei Zhou ◽

Cuiping Wu ◽

Jing Yang ◽

Jieying Xu ◽

Zhenpeng Chen ◽

...

Keyword(s):

Robinia Pseudoacacia ◽

Elongation Factor ◽

Aerial Mycelium ◽

Random Trees ◽

Molecular Evidence ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Accurate Identification ◽

Individual Tree ◽

First Report

Styphnolobium japonicum (L.) Schott is a variant of Robinia pseudoacacia and is a popular Asian tree widely used in traditional medicine. From March 2019 to 2021, a disease was found on the campus of Nanjing Forestry University and several landscape sites of Xuanwuhu Park, causing dieback. Most of the trees (approximately 40%) have rotted branches. On average, 60% of the branches per individual tree were affected by this disease. The initial round lesions were grayish brown. In the later stage, the whole branch becomes black and produces spherical fruiting bodies . Twenty diseased branches were picked from three random trees. Small tissues (3-4mm²) were surface-sterilized in 75% ethanol for 30 s followed by 1% NaClO for 90 s and placed on potato dextrose agar (PDA), and incubated in the dark at 25°C for three days. Hyphae were visibly emerged from 70% of the samples. Three representative isolates (Lth-soj1, Lth-soj2, and Lth-soj3) were obtained and deposited in China’s Forestry Culture Collection Center (Lth-soj1: cfcc55896, Lth-soj2: cfcc55897, Lth-soj3: cfcc55898). The colonies of three isolates on PDA were fast growing and white, which turned grey to dark grey after 3 days of incubation in the dark at 28°C . Two-weeks old colonies were black and fluffy on PDA, with abundant aerial mycelium, and the reverse side too was black in color. The fungus usually grew well on PDA and produced pycnidia and conidia within 3–4 weeks. Conidia were initially hyaline and aseptate, ellipsoid to ovoid, with granular content, apex broadly rounded, remaining hyaline and later becoming dark brown, one septate, thick walled, base truncate or round and longitudinally striate. The conidia (n=30) of a representative isolate（Lth-soj1）, measured 24.3 ± 0.3 μm in length and 13.3 ± 0.5 μm in width . The morphological characters of the three isolates matched those of Lasiodiplodia parva(Alves et al. 2008). For accurate identification, the DNA of the three isolates was extracted. The internal transcribed spacer region (ITS), translation elongation factor (EF1-α), and β-tubulin 2 (TUB2) genes were amplified using the primer pairs ITS1/ITS4 , EF1-728F/EF1-986R, and Bt2a/Bt2b , respectively. The sequences were deposited in GenBank under accession numbers MZ613154, MZ643245 and MZ643242 for Lth-soj1, MZ613155, MZ643246 and MZ643244 for Lth-soj2, and MZ613157, MZ643247 and MZ643243 for Lth-soj3. The ITS, EF1-α, and TUB2 sequences of isolate Lth-soj1 (GenBank Acc. No. MZ613154, MZ643245, MZ643242) were 100% (519/519 nt), 99.34% (299/301 nt), and 99.77% (436/437 nt) identical to those of MZ182360, EF622063, and MK294119, respectively. Interspecific differences were observed in a maximum-likelihood tree of Lasiodiplodia species using the concatenated dataset. Based on the morphological and molecular evidence, the isolates were identified as L. parva. The pathogenicity of three isolates were tested on potted three-year-old seedlings (100-cm tall) of S. japonicum maintained in a greenhouse. Healthy stems were wounded with a sterile needle then inoculated with 10 µL of conidial suspension. Control plants were treated with ddH2O. In total, 12 seedlings were inoculated including three controls. Three seedlings per isolate and 10 stems per seedling were used for each treatment. The plants were kept inside sealed polythene bags for the first 24 h and sterilized H2O was sprayed into the bags twice a day to maintain humidity and kept in a greenhouse at the day/night temperatures at 25/16°C. Within seven days, all the inoculated points showed lesions similar to those observed in field and the conidiomatas growing on the surface of the branches, whereas controls were asymptomatic . The infection rate of each of the three isolates was 100%. The strain was re-isolated from the lesions and sequenced as L.parva, whereas not from control stems. This is the first report of L. parva causing rotten branches of S. japonicum in China and the worldwide. These data will help to develop effective strategies for managing this newly emerging disease.

Download Full-text

First Report of Passalora Leaf Spot Caused by Passalora bougainvilleae on Bougainvillea in Mexico

Plant Disease ◽

10.1094/pdis-11-10-0787 ◽

2011 ◽

Vol 95 (6) ◽

pp. 775-775 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

V. Santiago-Santiago ◽

A. Madariaga-Navarrete ◽

A. Castañeda-Vildozola ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Disease Incidence ◽

Morphological Characteristics ◽

The United States ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Bougainvillea Spectabilis

Bougainvillea (Bougainvillea spectabilis Willd) growing in 28 gardens during 2009 showed 100% disease incidence and 3 to 7% disease severity. Bougainvilleas with white flowers were the most affected. Symptoms consisted of light brown spots with dark brown margins visible on adaxial and abaxial sides of the leaves. Spots were circular, 2 to 7 mm in diameter, often surrounded by a chlorotic halo, and delimited by major leaf veins. Single-spore cultures were incubated at 24°C under near UV light for 7 days to obtain conidia. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 spores/ml) on leaves of potted bougainvillea plants (white, red, yellow, and purple flowers), incubating the plants in a dew chamber for 48 h and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed at the residential gardens appeared on inoculated plants after 45 to 60 days. The fungus was reisolated from inoculated plants that showed typical symptoms. No symptoms developed on control plants treated with sterile distilled water. The fungus produced distinct stromata that were dark brown, spherical to irregular, and 20 to 24 μm in diameter. Conidiophores were simple, born from the stromata, loose to dense fascicles, brown, straight to curved, not branched, zero to two septate, 14 × 2 μm, with two to four conspicuous and darkened scars. The conidia formed singly, were brown, broad, ellipsoid, obclavate, straight to curved with three to four septa, 40 × 4 μm, and finely verrucous with thick hilum at the end. Fungal DNA from the single-spore cultures was obtained using a commercial DNA Extraction Kit (Qiagen, Valencia, CA); ribosomal DNA was amplified with ITS5 and ITS4 primers and sequenced. The sequence was deposited at the National Center for Biotechnology Information Database (GenBank Accession Nos. HQ231216 and HQ231217). The symptoms (4), morphological characteristics (1,2,4), and pathogenicity test confirm the identity of the fungus as Passalora bougainvilleae (Muntañola) Castañeda & Braun (= Cercosporidium bougainvilleae Muntañola). This pathogen has been reported from Argentina, Brazil, Brunei, China, Cuba, El Salvador, India, Indonesia, Jamaica, Japan, Thailand, the United States, and Venezuela (3). To our knowledge, this is the first report of this disease on B. spectabilis Willd in Mexico. P. bougainvilleae may become an important disease of bougainvillea plants in tropical and subtropical areas of Mexico. References: (1) U. Braun and R. R. Castañeda. Cryptogam. Bot. 2/3:289, 1991. (2) M. B. Ellis. More Dematiaceous Hypomycetes. Commonwealth Mycological Institute, Kew, Surrey, UK, 1976. (3) C. Nakashima et al. Fungal Divers. 26:257, 2007. (4) K. L. Nechet and B. A. Halfeld-Vieira. Acta Amazonica 38:585, 2008.

Download Full-text

First Report of Diaporthe novem Causing Postharvest Rot of Kiwifruit During Controlled Atmosphere Storage in Chile

Plant Disease ◽

10.1094/pdis-02-14-0183-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1274-1274 ◽

Cited By ~ 5

Author(s):

G. A. Díaz ◽

B. A. Latorre ◽

S. Jara ◽

E. Ferrada ◽

P. Naranjo ◽

...

Keyword(s):

Aerial Mycelium ◽

Soft Rot ◽

Storage Conditions ◽

Negative Control ◽

Its2 Region ◽

Conidial Suspension ◽

Controlled Atmosphere ◽

First Report ◽

Postharvest Rot ◽

Negative Controls

Chile is considered the third major exporter of kiwifruits (Actinidia deliciosa (A. Chev.) C. F. Liang & A. R. Ferguson) worldwide after Italy and New Zealand (1). The genus Diaporthe Nitschke (anamorph: genus Phomopsis) has been reported as causing postharvest rot in kiwifruit (4). During the current study, 1,400 fruits arbitrarily collected from seven controlled atmosphere (CA) rooms after 90 days of storage conditions (2% O2, 5% CO2) determined that 21.5% of the fruit were affected by decay and 0.86% developed symptoms different than those caused by Botrytis cinerea, the main postharvest pathogen associated to kiwifruit. Symptoms were soft rot with brown skin that started at the stem-end and in severe cases affected the entire fruit. Internally, affected fruit showed browning and watery tissues. Twelve affected fruits were surface disinfested (75% ethanol) and small pieces of internal rotten tissues were placed on acidified potato dextrose agar (APDA) for 7 days at 20°C. Twelve isolates were obtained, and four of them were identified morphologically and molecularly as Diaporthe ambigua, a species that has been previously described causing rot in stored kiwifruits in Chile (2). However, eight other flat, white to grayish colonies with sparse dirty-white aerial mycelium at the edge of the dish were obtained (3). Black pycnidia contained unicellular, hyaline, biguttulate, oval to cylindrical alpha conidia, with obtuse ends of (7.9) 6.7 (5.3) × (2.9) 2.5 (2.1) μm (n = 30). These isolates were tentatively identified as a Diaporthe sp. The species identification was determined by sequencing comparison of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA (GenBank Accession Nos. KJ210020 to 24, KJ210027, and KJ210033) and a portion of beta-tubulin (BT) (KJ210034 to 38, KJ210041, and KJ210047) using primers ITS4-ITS5 and Bt2a-Bt2b, respectively. BLAST analyses showed 99 to 100% identity with D. novem J.M. Santos, Vrandecic & A.J.L Phillips reference ex-type (KC343156 and KC344124 for ITS and BT, respectively) (3). Eighteen mature kiwifruits cv. Hayward were inoculated using a sterile cork borer on the surface of the fruit and placing 5-mm agar plugs with mycelial of D. novem (DN-1-KF). An equal number of fruits treated with sterile agar plugs were used as negative controls. After 30 days at 0°C under CA, all inoculated fruit showed rot symptoms with lesions 7.8 to 16.4 mm in diameter. The same D. novem isolate was inoculated with 30 μl of a conidial suspension (106 conidia/ml) on the surface of 18 ripe kiwifruits that were previously wounded and non-wounded as described above. An equal number of wounded and non-wounded fruits, treated with 30 μl sterile water, were used as negative controls. All inoculated wounded fruits developed rot symptoms with necrotic lesions of 14.1 to 20.2 mm of diameter after 14 days at 25°C. Inoculated non-wounded and negative control fruits remained symptomless. Koch's postulates were fulfilled by re-isolating D. novem only from the symptomatic fruits. To our knowledge, this is the first report of rot caused by D. novem on kiwifruit during cold storage in Chile and worldwide. Therefore, both Diaporthe species appears to be associated to Diaporthe rot of kiwifruit in Chile. References: (1) Belrose, Inc. World Kiwifruit Review. Belrose, Inc. Publishers, Pullman, WA, 2012. (2) J. Auger et al. Plant Dis. 97:843, 2013. (3) R. Gomes et al. Persoonia 31:1, 2013. (4) L. Luongo et al. J. Plant Pathol. 93:205, 2011.

Download Full-text

First report of anthracnose caused by Colletotrichum fructicola on tea in Taiwan

Plant Disease ◽

10.1094/pdis-06-20-1288-pdn ◽

2020 ◽

Author(s):

Shiou-Ruei Lin ◽

Si-Ying Yu ◽

Tsai-De Chang ◽

Yi-Jia Lin ◽

Chen-Jie Wen ◽

...

Keyword(s):

Morphological Characteristics ◽

Intergenic Spacer ◽

Leaf Tissue ◽

Nuclear Ribosomal Dna ◽

Conidial Suspension ◽

Water Control ◽

First Report ◽

Colletotrichum Fructicola ◽

Symptomatic Leaf ◽

Tea Plants

Tea (Camellia sinensis (L.) O. Kuntze) is a very popular beverage and cash crop that is widely cultivated in tropical and subtropical areas. In November 2017, diseased tea plants that exhibiting brown blight disease were observed in Guanxi Township of Hsinchu County in Taiwan. In the plantation,15% of tea trees (about 4000 plants) had an average of 20% of the leaves with at least one lesion. The symptoms began as small, water-soaked lesions on young leaves and twigs and later became larger, dark brown, necrotic lesions of 1 to 3 cm in diameter on leaves and 2 to 5 cm in length on twigs. Symptomatic leaf tissue (1 cm2) from five samples per sample) was surface sterilized with 1% NaClO (from commercial bleach, Clorox) for 1 min, washed with sterilized water 3 times, plated onto potato dextrose agar (PDA), and incubated under 12h/12h cycles of light and darkness at 25°C until sporulation to determine the causal agent. A fungus was consistently isolated from symptomatic leaf samples (80% isolation rate). The fungus initially produced white-to-gray fluffy aerial hyphae, which subsequently exhibited dark pigmentation. Acervuli and setae were absent. The conidia were hyaline, aseptate, smooth-walled, and cylindrical with obtuse to slightly rounded ends, with sizes of 12.10 to 16.02 × 3.58 to 4.91 (average 13.77 × 4.05, n = 30) μm. The majority had two rounded guttules. The appressoria were brown to dark brown, ovoid and slightly obtuse at the tip in shape, had lengths ranging from 3.59 to 10.31 μm (with an average of 7.18 μm, n = 30), and had diameters of 3.14 to 6.43 μm (with an average of 5.10 μm, n = 30). Morphological characteristics matched the descriptions of Colletotrichum fructicola (Liu et al. 2015; Fuentes-Aragón et al. 2018). The internal transcribed spacer of nuclear ribosomal DNA (ITS), actin (ACT), chitin synthase (CHS-1), and Apn2-Mat1-2 intergenic spacer and partial mating-type Mat1-2 gene (ApMAT) sequences of the isolates were obtained to confirm this identification. The sequences showed close identity with those of C. fructicola ex-type cultures ICMP18581 and CBS 130416 (Weir et al. 2012) of 99.65% for the ITS (JX010165), 99.29% for the ACT (JX009501), and 100.00% for the CHS-1 (JX009866), as well as close identity with the other ex-type culture LF506 (Liu et al. 2015) of 99.59% for the ApMat (KJ954567), supporting the isolate’s identification as C. fructicola. The sequences were deposited in GenBank, with the following accession Nos.: MN608177 (ITS), MN393175 (ACT), MT087546 (CHS-1), and MT087542 (ApMAT). Based on morphology and DNA sequence analysis, the associated fungus was identified as C. fructicola. Pathogenicity tests were performed next according to the procedures described in Chen et al. (2017). Healthy leaves on tea plants (Ca. sinensis ‘Chin-shin Oolong’) were wounded by pinpricking in the middle of each counterpart and inoculated with conidial suspension (1 × 107 conidia/ml, 10 μl). Both non-wounded and wounded healthy leaves were inoculated with the conidial suspension and sterile distilled water (a water control). The tea plants were covered with plastic bags to maintain high relative humidity for two days. One week after inoculation, anthracnose was observed on 40% of inoculated leaves, whereas all the control leaves remained healthy. The fungus was re-isolated from the diseased plants, and identified as C. fructicola by resequencing of the four genes. To the best of our knowledge, this is the first report of anthracnose caused by C. fructicola on tea in Taiwan although the pathogen has been present in China and Indonesia (Wang et al. 2016; Shi et al. 2017; Farr and Rossman, 2020).

Download Full-text

First Report of Anthracnose Caused by Glomerella cingulata on Passion Fruit in Argentina

Plant Disease ◽

10.1094/pdis.2000.84.6.706a ◽

2000 ◽

Vol 84 (6) ◽

pp. 706-706 ◽

Cited By ~ 4

Author(s):

S. Wolcan ◽

S. Larran

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Passion Fruit ◽

High Yield ◽

Conidial Suspension ◽

Glomerella Cingulata ◽

First Report ◽

Plastic Bags ◽

Subtropical Fruit

Passion fruit (Passiflora edulis Sims.) is a subtropical fruit recently cultivated in Misiones Province, Argentina. In spring 1997, a severe epidemic of anthracnose was observed. Disease incidence was ≍95%, causing high yield losses. Sunken, gray lesions on the whole surface of young fruits were observed. Under humid conditions, acervuli containing masses of spores and dark setae were found within lesions. On leaves, tendrils, and twigs, circular and irregular brown spots with darker edges were observed. Abortion of flowers also was recorded. Cultures on potato dextrose agar yielded abundant, gray aerial mycelium and one-celled, hyaline, oblong conidia with obtuse or rounded ends (11.2 to 15.0 × 3.8 to 4.6 μm). Perithecia were scarce (90.2 to 220.0 μm). Asci were not conspicuous, and ascospores measured 10.8 to 23.4 × 3.5 to 7.0 μm. Based on morphological characteristics, the fungus was identified as Glomerella cingulata (anamorph Colletotrichum gloeosporioides) (2). Fruits and leaves of P. edulis with and without wounds were sprayed with a conidial suspension (106/ml) and incubated in plastic bags for 48 h. Lesions similar to original symptoms were observed after 2 weeks only on wounded leaves and fruits. G. cingulata was reisolated, confirming Koch's postulates. This disease has been recorded in Brazil and Japan (1). This is the first report of G. cingulata on passion fruit in Argentina. Reference: (1) E. Francisco Neto et al. Summa Phytopathol. 21:25, 1995. (2) J. A. von Arx. Phytopathol. Z. 29:413, 1957.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing root rot on chickpea in Mexico

Plant Disease ◽

10.1094/pdis-05-21-1123-pdn ◽

2021 ◽

Author(s):

Sixto Velarde Felix ◽

Victor Valenzuela ◽

Pedro Ortega ◽

Gustavo Fierros ◽

Pedro Rojas ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Species Complex ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Chickpea (Cicer aretinium L.) is a legume crop of great importance worldwide. In January 2019, wilting symptoms on chickpea (stunted grow, withered leaves, root rot and wilted plants) were observed in three fields of Culiacan Sinaloa Mexico, with an incidence of 3 to 5%. To identify the cause, eighty symptomatic chickpea plants were sampled. Tissue from roots was plated on potato dextrose agar (PDA) medium. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Ff01 to Ff10). On PDA the colonies were abundant with white aerial mycelium, hyphae were branched and septae and light purple pigmentation was observed in the center of old cultures (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidias were falciform, hyaline, with slightly curved apexes, three to five septate, with well-developed foot cells and blunt apical cells, and measured 26.6 to 45.8 × 2.2 to 7.0 μm (n = 40). The microconidia (n = 40) were hyaline, one to two celled, produced in false heads that measured 7.4 to 20.1 (average 13.7) μm × 2.4 to 8.9 (average 5.3) μm (n = 40) at the tips of long monophialides, and were oval or reniform, with apexes rounded, 8.3 to 12.1 × 1.6 to 4.7 μm; chlamydospores were not evident. These characteristics fit those of the Fusarium solani (Mart.) Sacc. species complex, FSSC (Summerell et al. 2003). The internal transcribed spacer and the translation elongation factor 1 alpha (EF1-α) genes (O’Donnell et al. 1998) were amplified by polymerase chain reaction and sequenced from the isolate Ff02 and Ff08 (GenBank accession nos. KJ501093 and MN082369). Maximum likelihood analysis was carried out using the EF1-α sequences (KJ501093 and MN082369) from the Ff02 and Ff08 isolates and other species from the Fusarium solani species complex (FSSC). Phylogenetic analysis revealed the isolate most closely related with F. falciforme (100% bootstrap). For pathogenicity testing, a conidial suspension (1x106 conidia/ml) was prepared by harvesting spores from 10-days-old cultures on PDA. Twenty 2-week-old chickpea seedlings from two cultivars (P-2245 and WR-315) were inoculated by dipping roots into the conidial suspension for 20 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80% and a 12-h/12-h light/dark cycle. After 8 days, the first root rot symptoms were observed on inoculating seedlings and the infected plants eventually died within 3 to 4 weeks after inoculation. No symptoms were observed plants inoculated with sterilized distilled water. The fungus was reisolated from symptomatic tissues of inoculated plants and was identified by sequencing the partial EF1-α gene again and was identified as F. falciforme (FSSC 3 + 4) (O’Donnell et al. 2008) based on its morphological characteristics, genetic analysis, and pathogenicity test, fulfilling Koch’s postulates. The molecular identification was confirmed via BLAST on the FusariumID and Fusarium MLST databases. Although FSSC has been previously reported causing root rot in chickpea in USA, Chile, Spain, Cuba, Iran, Poland, Israel, Pakistan and Brazil, to our knowledge this is the first report of root rot in chickpea caused by F. falciforme in Mexico. This is important for chickpea producers and chickpea breeding programs.

Download Full-text

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China

Plant Disease ◽

10.1094/pdis-02-12-0166-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 283-283

Author(s):

C. J. You ◽

C. M. Tian ◽

Y. M. Liang ◽

X. B. Dong ◽

C. Tsui

Keyword(s):

Pinus Sylvestris ◽

Early Stage ◽

Aerial Mycelium ◽

Its Region ◽

Distilled Water ◽

Academic Press ◽

Conidial Suspension ◽

Pitch Canker ◽

Canker Disease ◽

First Report

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Cercospora Leaf Spot Caused by Cercospora apii (= C. molucellae) on Bells-of-Ireland (Molucella laevis) in Mexico

Plant Disease ◽

10.1094/pdis-93-2-0197a ◽

2009 ◽

Vol 93 (2) ◽

pp. 197-197 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

U. Braun ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Cercospora Leaf Spot ◽

Single Spore ◽

First Report ◽

Cornell University ◽

Specific Fragment ◽

Species Specific

In late 2007, a new disease was found in commercial cutflower fields of bells-of-Ireland (Molucella laevis L.) in Texcoco, Mexico. Four plantings surveyed during this time had 100% incidence. A few spots on cutflowers make them unmarketable. Symptoms consisted of gray-green spots on leaves, calyxes, and stems, which turned brown with age. Spots were initially circular to oval, delimited by major leaf veins, and were visible on both adaxial and abaxial sides of the leaves. A Cercospora species was consistently associated with the spots. The fungus was isolated on V8 agar medium. Three single-spore cultures were obtained from isolation cultures. Cultures were incubated at 24°C under near-UV light for 7 days. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 condia/ml) on leaves of 16 potted M. laevis plants, incubating the plants in a dew chamber for 48 h, and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed in the field appeared on all inoculated plants after 2 weeks. No symptoms developed on control plants treated with autoclaved distilled water. The pathogenicity test was repeated twice with similar results. The fungus produced erumpent stromata, which were dark brown, spherical to irregular, 10 to 26 μm diameter, and giving rise to fascicles of five to nine divergent conidiophores, which were clear brown, paler near the subtruncate apex, straight to curved, not branched, rarely geniculate with two to four septa, and 57 × 3.4 μm. The conidia were formed singly, hyaline, acicular, base truncate, tip acute, straight to curved with 11 to 19 septa, and 172 × 3.5 μm. Fungal DNA from single-spore cultures was obtained with a commercial extraction kit (Qiagen, Hilden, Germany), amplified with ITS5 and ITS4 primers, and sequenced. The sequence, deposited at the National Center for Biotechnology Information Database (GenBank Accession No. EU564808), aligned almost perfectly (99% identity) to the bells-of-Ireland isolates from California (GenBank Accession Nos. AY156918 and AY156919) and New Zealand (Accession No. DQ233321). A 176-bp species-specific fragment was amplified with CercoCal-apii primers but not with CercoCal-beta or CercoCal-sp primers. These results, coupled with the morphological characteristics (1) and pathogenicity test, confirm the identity of the fungus as Cercospora apii sensu lato (including C. molucellae) (2,3,4). Although C. apii sensu lato has been reported on other hosts in Mexico (1,2), to our knowledge, this is the first report of this disease on M. laevis plants in this country. References: (1) C. Chupp. A Monograph of the Fungus Cercospora. Cornell University Press, Ithaca, NY, 1954. (2) P. W. Crous and U. Braun. CBS Biodiversity Series 1:1, 2003. (3) M. Groenewald et al. Phytopathology 95:951, 2005. (4) S. T Koike et al. Plant Dis. 87:203, 2003.

Download Full-text