scholarly journals First Report of Fusarium asiaticum Causing Stem Rot of Ligusticum chuanxiong in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Tingting Zhu ◽  
Linxuan Li ◽  
Antonios Petridis ◽  
George Xydis ◽  
Maozhi Ren
Keyword(s):  
Disease Incidence ◽  
Elongation Factor ◽  
Stem Rot ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
First Report ◽  
Ligusticum Chuanxiong ◽  
Fusarium Asiaticum ◽  
Sterile Needle ◽  
Yellow Pigments

Ligusticum chuanxiong (known as Chuanxiong in China) is a traditional edible-medicinal herb, which has been playing important roles in fighting against COVID-19 (Ma et al. 2020). In March 2021, we investigated stem rot of Chuanxiong in six adjacent fields (~100 ha) in Chengdu, Sichuan Province, China. The disease incidence was above 5% in each field. Symptomatic plants showed stem rot, watersoaked lesions, and blackening with white hyphae present on the stems. Twelve symptomatic Chuanxiong plants (2 plants/field) were sampled. Diseased tissues from the margins of necrotic lesions were surface sterilized in 75% ethanol for 45 s, and 2% NaClO for 5 min. Samples were then rinsed three times in sterile distilled water and cultured on potato dextrose agar (PDA) at 25ºC for 72 h. Fourteen fungal cultures were isolated from 18 diseased tissues, of which eight monosporic isolates showed uniform characteristics. The eight fungal isolates showed fluffy white aerial mycelia and produced yellow pigments with age. Mung bean broth was used to induce sporulation. Macroconidia were sickle-shaped, slender, 3- to 5-septate, and averaged 50 to 70 μm in length. Based on morphological features of colonies and conidia, the isolates were tentatively identified as Fusarium spp. (Leslie and Summerell 2006). To identify the species, the partial translation elongation factor 1 alpha (TEF1-α) gene was amplified and sequenced (O’Donnell et al. 1998). TEF1-α sequences of LCSR01, LCSR02 and LCSR05 isolates (GenBank nos. MZ169386, MZ169388 and MZ169387) were 100%, 99.72% and 99.86% identical to that of F. asiaticum strain NRRL 26156, respectively. The phylogenetic tree based on TEF1-α sequences showed these isolates clustered with F. asiaticum using Neighbor-Joining algorithm. Furthermore, these isolates were identified using the specific primer pair Fg16 F/R (Nicholson et al. 1998). The results showed these isolates (GenBank nos. MZ164938, MZ164939 and MZ164940) were 100% identical to F. asiaticum NRRL 26156. Pathogenicity test of the isolate LCSR01 was conducted on Chuanxiong. After wounding Chuanxiong stalks and rhizomes with a sterile needle, the wounds were inoculated with mycelia PDA plugs. A total of 30 Chuanxiong rhizomes and stalks were inoculated with mycelia PDA plugs, and five mock-inoculated Chuanxiong rhizomes and stalks served as controls. After inoculation, the stalks and rhizomes were kept in a moist chamber at 25°C in the dark. At 8 days post inoculation (dpi), all inoculated stalks and rhizomes exhibited water-soaked and blackened lesions. At 10 dpi, the stalks turned soft and decayed, and abundant hyphae grew on the exterior of infected plants, similar to those observed in the field. No disease symptoms were observed on the control plants. The pathogen was re-isolated from the inoculated tissues and the identity was confirmed as described above. Ten fungal cultures were re-isolated from the 10 inoculated tissues, of which nine fungal cultures were F. asiaticum, fulfilling Koch’s postulates. To our knowledge, this is the first report of F. asiaticum causing stem rot of Chuanxiong in China. Chuanxiong has been cultivated in rotation with rice over multiple years. This rotation may have played a role in the increase in inoculum density in soil and stem rot epidemics in Chuanxiong. Diseased Chuanxiong may be contaminated with the mycotoxins produced by F. asciaticum, 3-acetyldeoxynivalenol or nivalenol, which may deleteriously affect human health. Therefore, crop rotations should be considered carefully to reduce disease impacts.

scholarly journals First Report of Fruit Rot of Melon Caused by Fusarium asiaticum in China

Plant Disease ◽  
2020 ◽  
Author(s):  
Fangmin Hao ◽  
Quanyu Zang ◽  
Weihong Ding ◽  
Erlei Ma ◽  
Yunping Huang ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Its Region ◽  
Fruit Rot ◽  
Post Inoculation ◽  
Basal Cells ◽  
First Report ◽  
Fusarium Asiaticum ◽  
Sterile Needle

Melon (Cucumis melo L.) is a member of the Cucurbitaceae family, an important economical and horticultural crop, which is widely grown in China. In May 2020, fruit rot disease with water-soaked lesions and pink molds on cantaloupe melons was observed in several greenhouses with 50% disease incidence in Ningbo, Zhejiang Province in China. In order to know the causal agent, diseased fruits were cut into pieces, surface sterilized for 1 min with 1% sodium hypochlorite (NaClO), 2 min with 75% ethyl alcohol, rinsed in sterile distilled water three times (Zhou et al. 2018), and then placed on potato dextrose agar (PDA) medium amended with streptomycin sulfate (100 μg/ml) plates at 25°C for 4 days. The growing hyphae were transferred to new PDA plates using the hyphal tip method, putative Fusarium colonies were purified by single-sporing. Twenty-five fungal isolates were obtained and formed red colonies with white aerial mycelia at 25°C for 7 days, which were identified as Fusarium isolates based on the morphological characteristics and microscopic examination. The average radial mycelial growth rate of Fusarium isolate Fa-25 was 11.44 mm/day at 25°C in the dark on PDA. Macroconidia were stout with curved apical and basal cells, usually with 4 to 6 septa, and 29.5 to 44.2 × 3.7 to 5.2 μm on Spezieller Nährstoffarmer agar (SNA) medium at 25°C for 10 days (Leslie and Summerell 2006). To identify the species, the internal transcribed spacer (ITS) region and translational elongation factor 1-alpha (TEF1-α) gene of the isolates were amplified and cloned. ITS and TEF1-α was amplified using primers ITS1/ITS4 and EF1/EF2 (O’Donnell et al. 1998), respectively. Sequences of ITS (545 bp, GenBank Accession No. MT811812) and TEF1-α (707 bp, GenBank Acc. No. MT856659) for isolate Fa-25 were 100% and 99.72% identical to those of F. asiaticum strains MSBL-4 (ITS, GenBank Acc. MT322117.1) and Daya350-3 (TEF1-α, GenBank Acc. KT380124.1) in GenBank, respectively. A phylogenetic tree was established based on the TEF1-α sequences of Fa-25 and other Fusarium spp., and Fa-25 was clustered with F. asiaticum. Thus, both morphological and molecular characterizations supported the isolate as F. asiaticum. To confirm the pathogenicity, mycelium agar plugs (6 mm in diameter) removed from the colony margin of a 2-day-old culture of strain Fa-25 were used to inoculate melon fruits. Before inoculation, healthy melon fruits were selected, soaked in 2% NaClO solution for 2 min, and washed in sterile water. After wounding the melon fruits with a sterile needle, the fruits were inoculated by placing mycelium agar plugs on the wounds, and mock inoculation with mycelium-free PDA plugs was used as control. Five fruits were used in each treatment. The inoculated and mock-inoculated fruits were incubated at 25°C with high relative humidity. Symptoms were observed on all inoculated melon fruits 10 days post inoculation, which were similar to those naturally infected fruits, whereas the mock-inoculated fruits remained symptomless. The fungus re-isolated from the diseased fruits resembled colony morphology of the original isolate. The experiment was conducted three times and produced the same results. To our knowledge, this is the first report of fruit rot of melon caused by F. asiaticum in China.

scholarly journals First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽  
2020 ◽  
Author(s):  
Boda Praveen ◽  
A. Nagaraja ◽  
M. K. Prasanna Kumar ◽  
Devanna Pramesh ◽  
K. B. Palanna ◽  
...  
Keyword(s):  
Crop Yields ◽  
Disease Incidence ◽  
Leaf Blight ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Pcr Assay ◽  
Causal Organism ◽  
First Report ◽  
Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

scholarly journals First report of Fusarium solani causing stem rot of Dracaena in Iran

2016 ◽  
Vol 56 (1) ◽  
pp. 100-103 ◽  
Author(s):  
Mostafa Abedi-Tizaki ◽  
Doustmorad Zafari ◽  
Jamal Sadeghi
Keyword(s):  
Fusarium Solani ◽  
Elongation Factor ◽  
Stem Rot ◽  
Pathogenicity Test ◽  
Translation Elongation Factor ◽  
Translation Elongation ◽  
First Report ◽  
Brown Discoloration ◽  
Elongation Factor 1 Alpha ◽  
Elongation Factor 1

Abstract In July 2013, symptoms of stem rot were observed in the Dracaena sanderiana cuttings in greenhouses of Mahallat County, Markazi Province, Iran. The symptoms first appeared as severe wilting. Later, leaves became brown and necrotic. Symptoms on the cuttings were observed as rotted areas on the middle of the stems. The cortical tissues of the plants showed a distinct brown discoloration. Eventually, the infected plants died. The pathogen was isolated from Dracaena stems and identified as F. solani by a fragment of the translation elongation factor 1-alpha (EF-1α) gene. Fusarium solani was confirmed by a pathogenicity test, and the causal agent was re-isolated from infected D. sanderiana plants. To the best of our knowledge, this is the first report of stem rot caused by F. solani on the cuttings of D. sanderiana.

scholarly journals First Report of Pectobacterium versatile Causing Aerial Stem Rot of Potato in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Wanxin Han ◽  
Jinhui Wang ◽  
Zheng Li ◽  
Yang Pan ◽  
Dai Zhang ◽  
...  
Keyword(s):  
16S Rdna ◽  
Disease Incidence ◽  
New York State ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Stem Rot ◽  
Post Inoculation ◽  
First Report ◽  
Potato Plants ◽  
Aerial Stem

Pectobacterium species cause blackleg, soft rot and stem rot in potato and many other vegetable crops (Charkowski 2015). In July 2020, potato plants showing characteristic symptoms of aerial stem rot were observed in a field (cv. Xisen 6) in Fengning Manchu Autonomous County, Chengde, Hebei Province (North China). The disease incidence in that field (5 ha in size) was more than 50%. Putative pectolytic bacteria were obtained from symptomatic stem tissues (light brown and water-soaked stem sections) by culturing on the crystal violet pectate (CVP) medium. Bacterial colonies producing pits, were restreaked and purified on Luria-Bertani (LB) agar. The isolates causing stem rot were gram negative and rod shaped, negative for oxidase, urease, indole production, gelatin liquefaction and acid production from maltose and D-sorbitol. All isolates were catalase positive, produced acid from lactose, rhamnose, saccharose, raffinose and D-arabinose, and were tolerant to 5% NaCl, and able to utilize citrate. The bacterial gDNA was extracted using the EasyPure Bacteria Genomic DNA Kit (TransGen Biotech). The 16S rDNA region was amplified by PCR using the universal primer pair 27F/1492R and sequenced. Result of the Blastn analysis of the 16S rDNA amplicons (MZ379788, MZ379789) suggested that the isolates FN20111 and FN20121 belonged to the genus Pectobacterium. To determine the species of the stem rot Pectobacterium isolates, multi-locus sequence analysis (MLSA) was performed with six housekeeping genes acnA, gapA, icdA, mdh, proA and rpoS (MZ403781-MZ403792), and phylogenetic tree was reconstructed using RAxML v8.2.12 (https://github.com/stamatak/standard-RAxML). The result of phylogenetic analysis showed that the stem rot Pectobacterium isolates FN20111 and FN20121 clustered with P. versatile (syn. ‘Candidatus Pectobacterium maceratum’) strains CFBP6051T (Portier et al. 2019), SCC1 (Niemi et al. 2017) and F131 (Shirshikov et al. 2018). And the isolates FN20111 and FN20121 were more closely related to the type strain CFBP6051T than to strains SCC1 and F131. Potato seedlings (cv. Xisen 6 and Favorita) were inoculated with the isolates FN20111 and FN20121 by injecting 100 µl of bacterial suspensions (108 CFU·mL-1) into the upper parts of the stems of potato plants, or injected with 100 µl of 0.9% saline solution as control. The seedlings were grown at 28°C and 50% relative humidity. Three days post-inoculation, only the bacteria-inoculated seedlings showed diseased symptoms resembling to those observed in the field. Bacterial colonies were obtained from the infected stems and were identified using the same PCR primers of housekeeping genes as described above, fulfill Koch’s postulates. P. versatile causing soft rot and blackleg on potato plants has been reported in Finland (Niemi et al. 2017), Russia (Shirshikov et al. 2018), Netherlands (Portier et al. 2019), Poland (Waleron et al. 2019) and in New York State (Ma et al. 2021). To our knowledge, this is the first report of P. versatile causing aerial stem rot of potato in China.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Bleeding Canker of Pear Tree Trunks Caused by Dickeya fangzhongdai in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Eu Ddeum Choi ◽  
Youngmin Kim ◽  
Yerim Lee ◽  
Min-Hye Jeong ◽  
Gyoung Hee Kim ◽  
...  
Keyword(s):  
16S Rrna ◽  
Intergenic Spacer ◽  
Fine Powder ◽  
Luria Bertani ◽  
Bacterial Suspension ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Flower Bud ◽  
First Report ◽  
Pear Tree

Pears (Pyrus pylifolia L.) are cultivated nationwide as one of the most economically important fruit trees in Korea. At the end of October 2019, bleeding canker was observed in a pear orchard located in Naju, Jeonnam Province (34°53′50.54″ N, 126°39′00.32″ E). The canker was observed on trunks and branches of two 25-year-old trees, and the diseased trunks and branches displayed partial die-back or complete death. When the bark was peeled off from the diseased trunks or branches, brown spots or red streaks were found in the trees. Bacterial ooze showed a rusty color and the lesion was sap-filled with a yeasty smell. Trunks displaying bleeding symptoms were collected from two trees. Infected bark tissues (3 × 3 mm) from the samples were immersed in 70% ethanol for 1 minute, rinsed three times in sterilized water, ground to fine powder using a mortar and pestle, and suspended in sterilized water. After streaking each suspension on Luria-Bertani (LB) agar, the plates were incubated at 25°C without light for 2 days. Small yellow-white bacterial colonies with irregular margins were predominantly obtained from all the samples. Three representative isolates (ECM-1, ECM-2 and ECM-3) were subjected to further characterization. These isolates were cultivated at 39 C, and utilized (-)-D-arabinose, (+) melibiose, (+)raffinose, mannitol and myo-inositol but not 5-keto-D-gluconate, -gentiobiose, or casein. These isolates were identified as Dickeya sp. based on the sequence of 16S rRNA (MT820458-820460) gene amplified using primers 27f and 1492r (Heuer et al. 2000). The 16S rRNA sequences matched with D. fangzhongdai strain ND14b (99.93%; CP009460.1) and D. fangzhongdai strain PA1(99.86%; CP020872.1). The recA, fusA, gapA, purA, rplB, and dnaX genes and the intergenic spacer (IGS) regions were also sequenced as described in Van der wolf et al. (2014). The recA (MT820437-820439), fusA (MT820440-820442), gapA (MT820443-820445), purA (MT820446-820448), rplB (MT820449-820451), dnaX (MT820452-820454) and IGS (MT820455-820457) sequences matched with D. fangzhongdai strains JS5, LN1 and QZH3 (KT992693-992695, KT992697-992699, KT992701-992703, KT992705-992707, KT992709-992711, KT992713-992715, and KT992717-992719, respectively). A neighbor-joining phylogenetic analysis based on the concatenated recA, fusA, gapA, purA, rplB, dnaX and IGS sequences placed the representative isolates within a clade comprising D. fangzhongdai. ECM-1 to 3 were grouped into a clade with one strain isolated from waterfall, D. fangzhongdai ND14b from Malaysia. Pathogenicity test was performed using isolate ECM-1. Three two-year-old branches and flower buds on 10-year-old pear tree (cv. Nittaka), grown at the National Institute of Horticultural and Herbal Science Pear Research Institute (Naju, Jeonnam Province in Korea), were inoculated with 10 μl and 2 μl of a bacterial suspension (108 cfu/ml), respectively, after wounding inoculation site with a sterile scalpel (for branch) or injecting with syringe (for flower bud). Control plants were inoculated with water. Inoculated branches and buds in a plastic bag were placed in a 30℃ incubator without light for 2 days (Chen et al. 2020). Both colorless and transparent bacterial ooze and typical bleeding canker were observed on both branches and buds at 3 and 2 weeks post inoculation, respectively. No symptoms were observed on control branches and buds. This pathogenicity assay was conducted three times. We reisolated three colonies from samples displaying the typical symptoms and checked the identity of one by sequencing the dnaX locus. Dickeya fangzhongdai has been reported to cause bleeding canker on pears in China (Tian et al. 2016; Chen et al. 2020). This study will contribute to facilitate identification and control strategies of this disease in Korea. This is the first report of D. fangzhongdai causing bleeding canker on pears in Korea.

scholarly journals First Report of Phytophthora drechsleri Associated with Stem and Foliar Blight of Gynura bicolor in Taiwan

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 874-874 ◽  
Author(s):  
Y. M. Shen ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Hyphal Growth ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
First Report ◽  
Foliar Blight ◽  
Dual Cultures ◽  
Phytophthora Drechsleri ◽  
Gynura Bicolor

Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) μm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.

scholarly journals First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1580-1580 ◽  
Author(s):  
C. Kithan ◽  
L. Daiho
Keyword(s):  
Leaf Surface ◽  
Agricultural Research ◽  
Disease Incidence ◽  
Indian Agricultural Research Institute ◽  
Mountain Range ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Conidial Suspension ◽  
First Report ◽  
Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

scholarly journals First Report of Phomopsis citri Associated with Dieback of Citrus lemon in India

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1281-1281 ◽  
Author(s):  
S. Mahadevakumar ◽  
Vandana Yadav ◽  
G. S. Tejaswini ◽  
S. N. Sandeep ◽  
G. R. Janardhana
Keyword(s):  
Fungal Pathogen ◽  
The United States ◽  
Apical Region ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
Productivity Level ◽  
First Report ◽  
Dieback Disease

Lemon (Citrus lemon (L.) Burm. f.) is an important fruit crop cultivated worldwide, and is grown practically in every state in India (3). During a survey conducted in 2013, a few small trees in a lemon orchard near Mysore city (Karnataka) (12°19.629′ N, 76°31.892′ E) were found affected by dieback disease. Approximately 10 to 20% of trees were affected as young shoots and branches showed progressive death from the apical region downward. Different samples were collected and diagnosed via morphological methods. The fungus was consistently isolated from the infected branches when they were surface sanitized with 1.5% NaOCl and plated on potato dextrose agar (PDA). Plates were incubated at 26 ± 2°C for 7 days at 12/12 h alternating light and dark period. Fungal colonies were whitish with pale brown stripes having an uneven margin and pycnidia were fully embedded in the culture plate. No sexual state was observed. Pycnidia were globose, dark, 158 to 320 μm in diameter, and scattered throughout the mycelial growth. Both alpha and beta conidia were present within pycnidia. Alpha conidia were single celled (5.3 to 8.7 × 2.28 to 3.96 μm) (n = 50), bigittulate, hyaline, with one end blunt and other truncated. Beta conidia (24.8 to 29.49 × 0.9 to 1.4 μm) (n = 50) were single celled, filiform, with one end rounded and the other acute and curved. Based on the morphological and cultural features, the fungal pathogen was identified as Phomopsis citri H.S. Fawc. Pathogenicity test was conducted on nine healthy 2-year-old lemon plants via foliar application of a conidial suspension (3 × 106); plants were covered with polythene bags for 6 days and maintained in the greenhouse. Sterile distilled water inoculated plants (in triplicate) served as controls and were symptomless. Development of dieback symptoms was observed after 25 days post inoculation and the fungal pathogen was re-isolated from the inoculated lemon trees. The internal transcribed spacer region (ITS) of the isolated fungal genomic DNA was amplified using universal-primer pair ITS1/ITS4 and sequenced to confirm the species-level diagnosis (4). The sequence data of the 558-bp amplicon was deposited in GenBank (Accession No. KJ477016.1) and nBLAST search showed 99% homology with Diaporthe citri (teleomorph) strain 199.39 (KC343051.1). P. citri is known for its association with melanose disease of citrus in India, the United States, and abroad. P. citri also causes stem end rot of citrus, which leads to yield loss and reduction in fruit quality (1,2). Dieback disease is of serious concern for lemon growers as it affects the overall productivity level of the tree. To the best of our knowledge, this is the first report of P. citri causing dieback of lemon in India. References: (1) I. H. Fischer et al. Sci. Agric. (Piracicaba). 66:210, 2009. (2) S. N. Mondal et al. Plant Dis. 91:387, 2007. (3) S. P. Raychaudhuri. Proc. Int. Soc. Citriculture 1:461, 1981. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China

Plant Disease ◽  
2020 ◽  
Author(s):  
Yue Lian Liu ◽  
Jian Rong Tang ◽  
Yu Han Zhou
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Pathogenicity Test ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Rdna Its ◽  
Colletotrichum Siamense ◽  
Monstera Deliciosa ◽  
Pure Cultures

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

Sign in / Sign up

Export Citation Format

Share Document