scholarly journals First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽  
2020 ◽  
Author(s):  
Boda Praveen ◽  
A. Nagaraja ◽  
M. K. Prasanna Kumar ◽  
Devanna Pramesh ◽  
K. B. Palanna ◽  
...  
Keyword(s):  
Crop Yields ◽  
Disease Incidence ◽  
Leaf Blight ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Pcr Assay ◽  
Causal Organism ◽  
First Report ◽  
Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1580-1580 ◽  
Author(s):  
C. Kithan ◽  
L. Daiho
Keyword(s):  
Leaf Surface ◽  
Agricultural Research ◽  
Disease Incidence ◽  
Indian Agricultural Research Institute ◽  
Mountain Range ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Conidial Suspension ◽  
First Report ◽  
Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

scholarly journals First Report of Phomopsis citri Associated with Dieback of Citrus lemon in India

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1281-1281 ◽  
Author(s):  
S. Mahadevakumar ◽  
Vandana Yadav ◽  
G. S. Tejaswini ◽  
S. N. Sandeep ◽  
G. R. Janardhana
Keyword(s):  
Fungal Pathogen ◽  
The United States ◽  
Apical Region ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
Productivity Level ◽  
First Report ◽  
Dieback Disease

Lemon (Citrus lemon (L.) Burm. f.) is an important fruit crop cultivated worldwide, and is grown practically in every state in India (3). During a survey conducted in 2013, a few small trees in a lemon orchard near Mysore city (Karnataka) (12°19.629′ N, 76°31.892′ E) were found affected by dieback disease. Approximately 10 to 20% of trees were affected as young shoots and branches showed progressive death from the apical region downward. Different samples were collected and diagnosed via morphological methods. The fungus was consistently isolated from the infected branches when they were surface sanitized with 1.5% NaOCl and plated on potato dextrose agar (PDA). Plates were incubated at 26 ± 2°C for 7 days at 12/12 h alternating light and dark period. Fungal colonies were whitish with pale brown stripes having an uneven margin and pycnidia were fully embedded in the culture plate. No sexual state was observed. Pycnidia were globose, dark, 158 to 320 μm in diameter, and scattered throughout the mycelial growth. Both alpha and beta conidia were present within pycnidia. Alpha conidia were single celled (5.3 to 8.7 × 2.28 to 3.96 μm) (n = 50), bigittulate, hyaline, with one end blunt and other truncated. Beta conidia (24.8 to 29.49 × 0.9 to 1.4 μm) (n = 50) were single celled, filiform, with one end rounded and the other acute and curved. Based on the morphological and cultural features, the fungal pathogen was identified as Phomopsis citri H.S. Fawc. Pathogenicity test was conducted on nine healthy 2-year-old lemon plants via foliar application of a conidial suspension (3 × 106); plants were covered with polythene bags for 6 days and maintained in the greenhouse. Sterile distilled water inoculated plants (in triplicate) served as controls and were symptomless. Development of dieback symptoms was observed after 25 days post inoculation and the fungal pathogen was re-isolated from the inoculated lemon trees. The internal transcribed spacer region (ITS) of the isolated fungal genomic DNA was amplified using universal-primer pair ITS1/ITS4 and sequenced to confirm the species-level diagnosis (4). The sequence data of the 558-bp amplicon was deposited in GenBank (Accession No. KJ477016.1) and nBLAST search showed 99% homology with Diaporthe citri (teleomorph) strain 199.39 (KC343051.1). P. citri is known for its association with melanose disease of citrus in India, the United States, and abroad. P. citri also causes stem end rot of citrus, which leads to yield loss and reduction in fruit quality (1,2). Dieback disease is of serious concern for lemon growers as it affects the overall productivity level of the tree. To the best of our knowledge, this is the first report of P. citri causing dieback of lemon in India. References: (1) I. H. Fischer et al. Sci. Agric. (Piracicaba). 66:210, 2009. (2) S. N. Mondal et al. Plant Dis. 91:387, 2007. (3) S. P. Raychaudhuri. Proc. Int. Soc. Citriculture 1:461, 1981. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Leaf Blight Caused by Septoria allii on Garlic Chives in Korea

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 147-147
Author(s):  
J. H. Park ◽  
S. E. Cho ◽  
K. S. Han ◽  
H. D. Shin
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Its Region ◽  
Leaf Blight ◽  
Plant Diseases ◽  
Cultivated Plants ◽  
Sequence Information ◽  
Conidial Suspension ◽  
Korean Society ◽  
First Report

Garlic chives, Allium tuberosum Roth., are widely cultivated in Asia and are the fourth most important Allium crop in Korea. In June 2011, a leaf blight of garlic chives associated with a Septoria spp. was observed on an organic farm in Hongcheon County, Korea. Similar symptoms were also found in fields within Samcheok City and Yangku County of Korea during the 2011 and 2012 seasons. Disease incidence (percentage of plants affected) was 5 to 10% in organic farms surveyed. Diseased voucher specimens (n = 5) were deposited at the Korea University Herbarium (KUS). The disease first appeared as yellowish specks on leaves, expanding to cause a leaf tip dieback. Half of the leaves may be diseased within a week, especially during wet weather. Pycnidia were directly observed in leaf lesions. Pycnidia were amphigenous, but mostly epigenous, scattered, dark brown to rusty brown, globose, embedded in host tissue or partly erumpent, separate, unilocular, 50 to 150 μm in diameter, with ostioles of 20 to 40 μm in diameter. Conidia were acicular, straight to sub-straight, truncate at the base, obtuse at the apex, hyaline, aguttulate, 22 to 44 × 1.8 to 3 μm, mostly 3-septate, occasionally 1- or 2-septate. These morphological characteristics matched those of Septoria allii Moesz, which is differentiated from S. alliacea on conidial dimensions (50 to 60 μm long) (1,2). A monoconidial isolate was cultured on potato dextrose agar (PDA). Two isolates have been deposited in the Korean Agricultural Culture Collection (Accession Nos. KACC46119 and 46688). Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 482-bp was deposited in GenBank (JX531648 and JX531649). ITS sequence information was at least 99% similar to those of many Septoria species, however no information was available for S. allii. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on PDA. Control leaves were sprayed with sterile water. The plants were placed in humid chambers (relative humidity 100%) for the first 48 h. After 7 days, typical leaf blight symptoms started to develop on the leaves of inoculated plants. S. allii was reisolated from the lesions of inoculated plants, confirming Koch's postulates. No symptoms were observed on control plants. The host-parasite association of A. tuberosum and S. allii has been known only from China (1). S. alliacea has been recorded on several species of Allium, e.g. A. cepa, A. chinense, A. fistulosum, and A. tuberosum from Japan (4) and A. cepa from Korea (3). To the best of our knowledge, this is the first report of S. allii on garlic chives. No diseased plants were observed in commercial fields of garlic chives which involved regular application of fungicides. The disease therefore seems to be limited to organic garlic chive production. References: (1) P. K. Chi et al. Fungous Diseases on Cultivated Plants of Jilin Province, Science Press, Beijing, China, 1966. (2) P. A. Saccardo. Sylloge Fungorum Omnium Hucusque Congnitorum. XXV. Berlin, 1931. (3) The Korean Society of Plant Pathology. List of Plant Diseases in Korea, Suwon, Korea, 2009. (4) The Phytopathological Society of Japan. Common Names of Plant Diseases in Japan, Tokyo, Japan, 2000.

scholarly journals First Report of Leaf Spot Disease Caused by Epicoccum nigrum on Lablab purpureus in India

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 284-284 ◽  
Author(s):  
S. Mahadevakumar ◽  
K. M. Jayaramaiah ◽  
G. R. Janardhana
Keyword(s):  
Leaf Spot ◽  
Leaf Surface ◽  
Disease Incidence ◽  
Leaf Spot Disease ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Lablab Purpureus ◽  
First Report ◽  
Spot Disease ◽  
Epicoccum Nigrum

Lablab purpureus (L.) Sweet (Indian bean) is an important pulse crop grown in arid and semi-arid regions of India. It is one of the most widely cultivated legume species and has multiple uses. During a September 2010 survey, we recorded a new leaf spot disease on L. purpureus in and around Mysore district (Karnataka state) with 40 to 80% disease incidence in 130 ha of field crop studied, which accounted for 20 to 35% estimated yield loss. The symptoms appeared as small necrotic spots on the upper leaf surface. The leaf spots were persistent under mild infection throughout the season with production of conidia in clusters on abaxial leaf surface. A Dueteromyceteous fungus was isolated from affected leaf tissues that were surface sterilized with 2% NaOCl2 solution then washed thrice, dried, inoculated on potato dextrose agar (PDA) medium, and incubated at 28 ± 2°C at 12 h alternate light and dark period for 7 days. The fungal colony with aerial mycelia interspersed with dark cushion-shaped sporodochia consists of short, compact conidiophores bearing large isodiametric, solitary, muricate, brown, globular to pear shaped conidia (29.43 to 23.92 μm). Fungal isolate was identified as Epicoccum sp. based on micro-morphological and cultural features (1). Further authenticity of the fungus was confirmed by PCR amplification of the internal transcribed spacer (ITS) region using ITS1/ITS4 universal primer. The amplified PCR product was purified, sequenced directly, and BLASTn search revealed 100% homology to Epicoccum nigrum Link. (DQ093668.1 and JX914480.1). A representative sequence of E. nigrum was deposited in GenBank (Accession No. KC568289.1). The isolated fungus was further tested for its pathogenicity on 30-day-old healthy L. purpureus plants under greenhouse conditions. A conidial suspension (106 conidia/ml) was applied as foliar spray (three replicates of 15 plants each) along with suitable controls. The plants were kept under high humidity (80%) for 5 days and at ambient temperature (28 ± 2°C). The appearance of leaf spot symptoms were observed after 25 days post inoculation. Further, the pathogen was re-isolated and confirmed by micro-morphological characteristics. E. nigrum has been reported to cause post-harvest decay of cantaloupe in Oklahoma (2). It has also been reported as an endophyte (3). Occurrence as a pathogen on lablab bean has not been previously reported. To our knowledge, this is the first report of the occurrence of E. nigrum on L. purpureus in India causing leaf spot disease. References: (1) H. L. Barnet and B. B. Hunter. Page 150 in: Illustrated Genera of Imperfect Fungi, 1972. (2) B. D. Bruten et al. Plant Dis. 77:1060, 1993. (3) L. C. Fávaro et al. PLoS One 7(6):e36826, 2012.

scholarly journals First report of Fusarium incarnatum causing spikelet rot on rice in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Ling Wang ◽  
S. L. Ge ◽  
Kehan Zhao ◽  
huang Shiwen
Keyword(s):  
Natural Science ◽  
Disease Incidence ◽  
Science And Technology ◽  
Agricultural Science ◽  
Zhejiang Province ◽  
Maturity Stage ◽  
Post Inoculation ◽  
Distilled Water ◽  
Conidial Suspension ◽  
First Report

Rice (Oryza sativa L.) is the most important and widely grown crop, covering about 29.9 million ha of total cultivation area in China. In the last decade, spikelet rot disease on rice became much more frequent in the middle and lower reaches of the Yangtze River, China. Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg was reported to be a causal agent of spikelet rot on rice in Hangzhou, Zhejiang province (Huang et al. 2012). In September 2019, a survey was conducted to understand the etiology of the disease in the main rice growing regions of Jinshan District of Shanghai. Symptomatic panicles exhibiting reddish or brown discoloration on the glumes were collected from different rice fields, where disease incidence was estimated to be between 20 to 80%. Diseased glumes were cut into small sections (5 × 5 mm) from the boundary of necrotic and healthy tissues, surface-sterilized with 75% ethanol for 30 s and 3% sodium hypochlorite for 90 s, rinsed twice with sterile distilled water, then placed onto 1/5 strength potato dextrose agar (PDA). After 3 to 5 days of incubation at 28°C in the dark, fungal growth with Fusarium-like colonies were transferred to PDA and purified by the single-spore isolation method. A total of 12 isolates were obtained and colonies showed loosely floccose, white mycelium and pale-yellow pigmentation on PDA. Microconidia were ovoid mostly with 0 to 1 septum, and measured 4.2 to 16.6 × 2.5 to 4.1 μm (n = 50). After 5-7 days of inoculation on carnation leaf agar (CLA), macroconidia produced usually had 3 to 5 septa, slightly curved at the apex, ranging from 15.7 to 39.1 × 3.3 to 5.0 μm (n = 50). Chlamydospores were produced in hyphae, most often solitary in short chains or in clumps, ellipsoidal or subglobose with thick and roughened walls. Molecular identification was performed on the representative isolates (JS3, JS9, and JS21). The rDNA internal transcribed spacer (ITS), translation elongation factor (TEF-1α) and β-tubulin (β-TUB) genes were amplified and sequenced using the paired primers ITS1/ITS4 (White et al. 1990), EF1/EF2 (O’Donnell et al. 1998) and T1/T22 (O’Donnell and Cigelnik 1997), respectively. The obtained sequences were deposited in GenBank under accession numbers MT889972 to MT889974 (ITS), MT895844 to MT895846 (TEF-1α), and MT895841 to MT895843 (β-TUB), respectively. BLASTn search of the sequences revealed 99 to 100% identity with ITS (MF356578), TEF-1α (HM770725) and β-TUB (GQ915444) of Fusarium incarnatum isolates. FUSARIUM-ID (Geiser et al. 2004) analysis showed 99 to 100% similarity with sequences of the F. incarnatum-equiseti species complex (FIESC) (FD_01651 and FD_01628). In addition, a phylogenetic analysis based on the concatenated nucleotide sequences placed the isolates in the F. incarnatum clade at 100% bootstrap support. Thus, both morphological observations and molecular criteria supported identification of the isolates as F. incarnatum (Desm.) Sacc (synonym: Fusarium semitectum) (Leslie and Summerell 2006, Nirenberg 1990). Pathogenicity tests were performed on susceptible rice cultivar ‘Xiushui134’. At pollen cell maturity stage, a 2-ml conidial suspension (5 × 105 macroconidia/ml) of each isolate was injected into 10 rice panicles. Control plants were inoculated with sterile distilled water. Then, the pots were kept in a growth chamber at 28°C, 80% relative humidity, and 12 h/12 h light (10,000 lux)/dark. The experiment was repeated two times for each isolate. Two weeks post-inoculation, all inoculated panicles showed similar symptoms with the original samples, whereas no symptoms were observed on the control. The pathogen was re-isolated from inoculated panicles and identified by the method described above to fulfill Koch's postulates. Previous studies reported that F. incarnatum reproduced perithecia to overwinter on rice stubble as the inoculum of Fusarium head blight of wheat in southern China (Yang et al. 2018). To our knowledge, this is the first report of spikelet rot on rice caused by F. incarnatum in China. Further investigation is needed to gain a better understanding its potential geographic distribution of this new pathogen on rice crop. References: (1) Huang, S. W., et al. 2011. Crop Prot. 30: 10. (2) White, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. (3) O’Donnell, K., et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95: 2044. (4) O'Donnell, K., Cigelnik, E. 1997. Mol. Phylogenet. Evol. 7: 103. (5) Geiser, D. M., et al. 2004. Eur. J. Plant Pathol. 110: 473. (6) Leslie, J. F., and Summerell, B. A. 2006. The Fusarium Laboratory Manual. Blackwell, Ames, IA. (7) Nirenberg, H. I. 1990. Stud. Mycol. 32: 91. (8) Yang, M. X., et al. 2018. Toxins. 10: 115. The author(s) declare no conflict of interest. Funding: Funding was provided by National Natural Science Foundation of China (grant no. 31800133), Zhejiang Provincial Natural Science Foundation of China (grant no. LQ18C140005), Key Research and Development Program of Zhejiang Province (grant no. 2019C02018), Shanghai Science and Technology for Agriculture Promotion Project (2019-02-08-00-08-F01127), and the Agricultural Science and Technology Innovation Program of China Academy of Agricultural Science (CAAS-ASTIP-2013- CNRRI).

scholarly journals First Report of Fusarium asiaticum Causing Stem Rot of Ligusticum chuanxiong in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Tingting Zhu ◽  
Linxuan Li ◽  
Antonios Petridis ◽  
George Xydis ◽  
Maozhi Ren
Keyword(s):  
Disease Incidence ◽  
Elongation Factor ◽  
Stem Rot ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
First Report ◽  
Ligusticum Chuanxiong ◽  
Fusarium Asiaticum ◽  
Sterile Needle ◽  
Yellow Pigments

Ligusticum chuanxiong (known as Chuanxiong in China) is a traditional edible-medicinal herb, which has been playing important roles in fighting against COVID-19 (Ma et al. 2020). In March 2021, we investigated stem rot of Chuanxiong in six adjacent fields (~100 ha) in Chengdu, Sichuan Province, China. The disease incidence was above 5% in each field. Symptomatic plants showed stem rot, watersoaked lesions, and blackening with white hyphae present on the stems. Twelve symptomatic Chuanxiong plants (2 plants/field) were sampled. Diseased tissues from the margins of necrotic lesions were surface sterilized in 75% ethanol for 45 s, and 2% NaClO for 5 min. Samples were then rinsed three times in sterile distilled water and cultured on potato dextrose agar (PDA) at 25ºC for 72 h. Fourteen fungal cultures were isolated from 18 diseased tissues, of which eight monosporic isolates showed uniform characteristics. The eight fungal isolates showed fluffy white aerial mycelia and produced yellow pigments with age. Mung bean broth was used to induce sporulation. Macroconidia were sickle-shaped, slender, 3- to 5-septate, and averaged 50 to 70 μm in length. Based on morphological features of colonies and conidia, the isolates were tentatively identified as Fusarium spp. (Leslie and Summerell 2006). To identify the species, the partial translation elongation factor 1 alpha (TEF1-α) gene was amplified and sequenced (O’Donnell et al. 1998). TEF1-α sequences of LCSR01, LCSR02 and LCSR05 isolates (GenBank nos. MZ169386, MZ169388 and MZ169387) were 100%, 99.72% and 99.86% identical to that of F. asiaticum strain NRRL 26156, respectively. The phylogenetic tree based on TEF1-α sequences showed these isolates clustered with F. asiaticum using Neighbor-Joining algorithm. Furthermore, these isolates were identified using the specific primer pair Fg16 F/R (Nicholson et al. 1998). The results showed these isolates (GenBank nos. MZ164938, MZ164939 and MZ164940) were 100% identical to F. asiaticum NRRL 26156. Pathogenicity test of the isolate LCSR01 was conducted on Chuanxiong. After wounding Chuanxiong stalks and rhizomes with a sterile needle, the wounds were inoculated with mycelia PDA plugs. A total of 30 Chuanxiong rhizomes and stalks were inoculated with mycelia PDA plugs, and five mock-inoculated Chuanxiong rhizomes and stalks served as controls. After inoculation, the stalks and rhizomes were kept in a moist chamber at 25°C in the dark. At 8 days post inoculation (dpi), all inoculated stalks and rhizomes exhibited water-soaked and blackened lesions. At 10 dpi, the stalks turned soft and decayed, and abundant hyphae grew on the exterior of infected plants, similar to those observed in the field. No disease symptoms were observed on the control plants. The pathogen was re-isolated from the inoculated tissues and the identity was confirmed as described above. Ten fungal cultures were re-isolated from the 10 inoculated tissues, of which nine fungal cultures were F. asiaticum, fulfilling Koch’s postulates. To our knowledge, this is the first report of F. asiaticum causing stem rot of Chuanxiong in China. Chuanxiong has been cultivated in rotation with rice over multiple years. This rotation may have played a role in the increase in inoculum density in soil and stem rot epidemics in Chuanxiong. Diseased Chuanxiong may be contaminated with the mycotoxins produced by F. asciaticum, 3-acetyldeoxynivalenol or nivalenol, which may deleteriously affect human health. Therefore, crop rotations should be considered carefully to reduce disease impacts.

scholarly journals First Report of Passalora Leaf Spot Caused by Passalora bougainvilleae on Bougainvillea in Mexico

Plant Disease ◽  
2011 ◽  
Vol 95 (6) ◽  
pp. 775-775 ◽  
Author(s):  
V. Ayala-Escobar ◽  
V. Santiago-Santiago ◽  
A. Madariaga-Navarrete ◽  
A. Castañeda-Vildozola ◽  
C. Nava-Diaz
Keyword(s):  
Uv Light ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
The United States ◽  
Pathogenicity Test ◽  
Commonwealth Mycological Institute ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report ◽  
Bougainvillea Spectabilis

Bougainvillea (Bougainvillea spectabilis Willd) growing in 28 gardens during 2009 showed 100% disease incidence and 3 to 7% disease severity. Bougainvilleas with white flowers were the most affected. Symptoms consisted of light brown spots with dark brown margins visible on adaxial and abaxial sides of the leaves. Spots were circular, 2 to 7 mm in diameter, often surrounded by a chlorotic halo, and delimited by major leaf veins. Single-spore cultures were incubated at 24°C under near UV light for 7 days to obtain conidia. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 spores/ml) on leaves of potted bougainvillea plants (white, red, yellow, and purple flowers), incubating the plants in a dew chamber for 48 h and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed at the residential gardens appeared on inoculated plants after 45 to 60 days. The fungus was reisolated from inoculated plants that showed typical symptoms. No symptoms developed on control plants treated with sterile distilled water. The fungus produced distinct stromata that were dark brown, spherical to irregular, and 20 to 24 μm in diameter. Conidiophores were simple, born from the stromata, loose to dense fascicles, brown, straight to curved, not branched, zero to two septate, 14 × 2 μm, with two to four conspicuous and darkened scars. The conidia formed singly, were brown, broad, ellipsoid, obclavate, straight to curved with three to four septa, 40 × 4 μm, and finely verrucous with thick hilum at the end. Fungal DNA from the single-spore cultures was obtained using a commercial DNA Extraction Kit (Qiagen, Valencia, CA); ribosomal DNA was amplified with ITS5 and ITS4 primers and sequenced. The sequence was deposited at the National Center for Biotechnology Information Database (GenBank Accession Nos. HQ231216 and HQ231217). The symptoms (4), morphological characteristics (1,2,4), and pathogenicity test confirm the identity of the fungus as Passalora bougainvilleae (Muntañola) Castañeda & Braun (= Cercosporidium bougainvilleae Muntañola). This pathogen has been reported from Argentina, Brazil, Brunei, China, Cuba, El Salvador, India, Indonesia, Jamaica, Japan, Thailand, the United States, and Venezuela (3). To our knowledge, this is the first report of this disease on B. spectabilis Willd in Mexico. P. bougainvilleae may become an important disease of bougainvillea plants in tropical and subtropical areas of Mexico. References: (1) U. Braun and R. R. Castañeda. Cryptogam. Bot. 2/3:289, 1991. (2) M. B. Ellis. More Dematiaceous Hypomycetes. Commonwealth Mycological Institute, Kew, Surrey, UK, 1976. (3) C. Nakashima et al. Fungal Divers. 26:257, 2007. (4) K. L. Nechet and B. A. Halfeld-Vieira. Acta Amazonica 38:585, 2008.

scholarly journals First Report of Fusarium Wilt Caused by Fusarium oxysporum on Strawberry in Spain

Plant Disease ◽  
2009 ◽  
Vol 93 (3) ◽  
pp. 323-323 ◽  
Author(s):  
F. T. Arroyo ◽  
Y. Llergo ◽  
A. Aguado ◽  
F. Romero
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Potato Dextrose Agar ◽  
Fluorescent Light ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Soilless Culture ◽  
Fragaria Ananassa ◽  
Pcr Assay ◽  
First Report

In the spring of 2007, wilted and dead strawberry plants (Fragaria × ananassa Duch. cvs. Camarosa and Ventana) were observed in a soilless culture system in Huelva, southwestern Spain. Approximately 8% of the plants in the field died. Isolations from necrotic crowns and roots and necrotic flowers were made on potato dextrose agar after disinfestation in 0.6% NaOCl for 30 s. Colonies with light purple mycelia and beige or orange reverse colony colors developed after 9 days of incubation at 25°C. Colonies produced abundant microconidia, macroconidia, and chlamydospores. Microconidia were hyaline and oval-ellipsoid to cylindrical (5.9 to 9.2 × 2.1 to 3.4 μm). Macroconidia were 3 to 5 septate and fusoid-subulate with a pedicellate base (28.8 to 37.3 × 3.2 to 4.3 μm). Morphology and growth matched descriptions of Fusarium oxysporum Schlechtend emend. Snyder & Hansen (2). A PCR assay for amplification of r-DNA using primers PFO2 and PFO3 established the identity of the isolate as F. oxysporum (1). To confirm the pathogenicity of the fungus, roots of 30-day-old strawberry cvs. Camarosa and Ventana (20 plants each) were inoculated by dipping the roots into a conidial suspension (107 conidia per ml) for 15 min. The inoculated plants were transplanted into plastic pots containing sterilized peat and maintained at 25°C and 100% relative humidity in a growth chamber with a daily 12-h photoperiod of fluorescent light. The pathogenicity test was conducted twice. Within 30 days, all inoculated plants developed wilt symptoms similar to that observed in the field and eventually 75% of the plants died. No symptoms were observed on plants dipped in distilled water. The fungus was successfully reisolated from crowns, roots, and necrotic flowers, fulfilling Koch's postulates. To our knowledge, this is the first report of the occurrence of Fusarium wilt caused by F. oxysporum on strawberry plants in Spain. References: (1) V. Edel et al. Mycol. Res. 104:518, 2000. (2) W. C. Snyder and H. N. Hansen. Am. J. Bot. 27:64, 1940.

scholarly journals First Report of Stewart's Wilt of Maize in Argentina Caused by Pantoea stewartii

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1819-1819 ◽  
Author(s):  
A. G. Albarracín Orio ◽  
E. Brücher ◽  
M. C. Plazas ◽  
P. Sayago ◽  
F. Guerra ◽  
...  
Keyword(s):  
Leaf Growth ◽  
Leaf Blight ◽  
Bacterial Suspension ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
First Report ◽  
Pantoea Stewartii ◽  
Maize Plants ◽  
Stewart's Wilt ◽  
Negative Controls

Stewart's wilt is a serious disease of corn (Zea mays L.) caused by the bacterium Pantoea stewartii subsp. stewartii (Pss). Typical symptoms of infected fields and dent corn are longitudinal streaks with irregular or wavy margins, which are parallel to the veins and may extend the length of the leaf. These pale to green yellow lesions become dry and brown as the disease progresses producing a leaf blight (4). During the growing seasons 2010 to 2011 and 2011 to 2012, symptoms of bacterial leaf blight of corn were observed in central Argentina maize fields, with an incidence of 54% in Córdoba province. To identify the pathogen, leaves from 10 symptomatic maize plants per field were collected from 15 fields covering a representative geographical area. High populations of morphologically uniform bacteria were isolated from leaf tissues by conventional methods using King's medium B agar (2). Ten representative facultatively anaerobic gram-negative, non-fluorescing, non-motile, catalase positive and oxidase negative rod-shaped and yellow-pigmented bacterial isolates were evaluated further. The biochemical profile obtained was: fermentative metabolism, negative indol, acetoin and hydrogen sulfide production, negative gelatin hydrolysis (22°C), positive acid production from D-glucose and lactose, negative gas production from D-glucose, and negative nitrate reduction (1). All the isolates produced a 300-bp band with PCR using the species specific primer pair PST3581/PST3909c (3). The Pss ATCC 8199 and Pseudomonas fluorescens ATCC 13525 strains were used as positive and negative controls for the PCR assays, respectively. The pathogenicity test was performed by stem inoculation of five to ten P2069 YR maize plants (one to two leaf growth stage) grown in growth chamber. Plants were inoculated by syringe with a 107 to 108 cell/ml bacterial suspension and kept in a humid chamber at 25 to 27°C. Plants inoculated with Pss ATCC 8199 or with sterile water were used as positive and negative control treatments, respectively. The development of symptoms similar to those originally found in the field was observed on all the plants inoculated with the different isolates at 7 to 10 days post inoculation. In addition, symptoms on inoculated plants were similar to those observed for the positive control treatment. No symptoms were found on negative controls. Koch's postulates were fulfilled since bacteria isolated from symptomatic tissue had identical characteristics to isolates used to inoculate plants and to the reference Pss strain for biochemical tests and PCR reaction mentioned above. To our knowledge, this is the first report of P. stewartii subsp. stewartii isolated from diseased maize in Argentina. References: (1) J. G. Holt et al. Page 179 in: Bergey's manual of determinative bacteriology. Williams and Wilkins, Baltimore, MD, 1994. (2) OEPP/EPPO. Bulletin OEPP/EPPO Bulletin, 36: 111, 2006. Pantoea stewartii subsp. stewartii diagnostic. (3) A. Wensing et al. Appl. Environ. Microbiol. 76:6248, 2010. (4) D. G. White Page 4 in: Compendium of corn disease. The American Phytopathology Society, 1999.

Sign in / Sign up

Export Citation Format

Share Document