First Report of Marasmiellus mesosporus Causing Marasmiellus Blight on Seashore Paspalum

Seashore paspalum (Paspalum vaginatum Sw.) is a newly cultivated C4 turfgrass that has exceptional salinity tolerance and is highly suited for use on golf courses in coastal areas. In October 2008 and June 2009, circular patches of blighted seashore paspalum ranging from 30 cm to >3 m in diameter were observed in fairways, tees, and roughs established with ‘Supreme’ seashore paspalum at Roco Ki Golf Club in Macao, Dominican Republic. Affected patches were initially chlorotic followed by reddish brown necrosis of leaves and leaf sheaths. Reddish brown-to-gray lesions were also observed on leaf sheaths during the early stages of necrosis. During periods of wet or humid weather from June through October, basidiocarps were produced on necrotic plant tissue and identified as Marasmiellus mesosporus Singer (2). Three isolates were obtained by plating symptomatic leaf sheaths that were surface sterilized with a 0.5% NaOCl solution on potato dextrose agar amended with 50 ppm each of streptomycin, chloramphenicol, and tetracycline (PDA+++). Sequences of the internal transcribed spacer (ITS) region of rDNA, obtained from these three isolates and three stipes of basidiocarps, were identical to each other and 99% similar to a M. mesosporus sequence deposited in the NCBI database (Accession No. AB517375). To confirm pathogenicity, a M. mesosporus isolate obtained from symptomatic plant tissue was inoculated onto 6-week-old P. vaginatum (‘Seaspray’) planted (0.5 mg seed/cm2) in 10-cm-diameter pots containing a mixture of 80% sand and 20% reed sedge peat. Two weeks prior to inoculation, the isolate was grown on a sterilized mixture of 100 cm3 of rye grain, 4.9 ml of CaCO3, and 100 ml of water. Infested grains were placed 0.5 cm below the soil surface for inoculation. Pots were inoculated with five infested grains or five sterilized, uninfested grains with three replications of each treatment. After inoculation, pots were placed in a growth chamber with a 12-h photoperiod set to 30°C during the day and 26°C at night. Approximately 20% of plants in inoculated pots were necrotic 7 days postinoculation and this increased to 75% by 21 days postinoculation. Diseased plants in inoculated pots exhibited symptoms similar to those observed in the field. Leaves were initially chlorotic with brown lesions on lower leaf sheaths and eventually turned necrotic, reddish brown, and collapsed. Pots receiving uninfested grains were healthy and showed no symptoms on all rating dates. At 21 days postinoculation, basidiocarps were observed emerging from three colonized plants at the base of the oldest leaf sheath near the crown. Three reisolations were made on PDA+++ from stem lesions surface sterilized with a 0.5% NaOCl solution. All reisolations were confirmed as M. mesosporus by culture morphology and ITS sequence data. M. mesosporus was previously reported causing disease on American beachgrass (Ammophila breviligulata Fernald) in North Carolina (1) and recently in Japan (3). The pathogen was initially placed in the genus Marasmius and reported as the cause of the disease Marasmius blight (1). Subsequent morphological observation found that the pathogen belonged in the genus Marasmiellus (2). To our knowledge, this is the first report of M. mesosporus causing Marasmiellus blight on seashore paspalum, a high-amenity turfgrass. References: (1) L. Lucas et al. Plant Dis. Rep. 55:582, 1971. (2) R. Singer et al. Mycologia 65:468, 1973. (3) S. Takehashi et al. Mycoscience 48:407, 2007.

Download Full-text

First Report of Sclerotinia sclerotiorum on African Daisy (Osteospermum sp.) in Italy

Plant Disease ◽

10.1094/pdis-92-6-0982c ◽

2008 ◽

Vol 92 (6) ◽

pp. 982-982

Author(s):

A. Garibaldi ◽

P. Pensa ◽

A. Minuto ◽

M. L. Gullino

Keyword(s):

Sclerotinia Sclerotiorum ◽

Soil Surface ◽

Its Region ◽

The United States ◽

First Report ◽

Leaf Yellowing ◽

Affected Tissue ◽

Blastn Analysis ◽

Plant Grown ◽

Stem Lesions

African daisy (Osteospermum sp.) is an ornamental plant grown in the winter as a potted plant in Liguria (northern Italy) and is generally marketed in early-to-late spring in Italy and central and northern Europe. In the winter of 2006, stem lesions, general chlorosis, wilt, and plant death occurred in a greenhouse nursery. Affected plants were characterized by the presence of soft, watery tissues. Necrotic tissues were covered with a white, cottony mycelium. During periods of high humidity, black sclerotia differentiated within the mycelium. To recover the pathogen, diseased stem tissue was surface sterilized for 1 min in 1% NaOCl and plated on potato dextrose agar (PDA) amended with 100 mg/l of streptomycin sulfate. Sclerotinia sclerotiorum (Lib.) de Bary (2) was consistently isolated from affected tissue. Sclerotia produced on PDA measured 1.3 to 3.1 × 1.5 to 3.5 mm in diameter. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and then sequenced. BLASTn analysis (1) of the 633 bp showed a 100% identity with S. sclerotiorum. The nucleotide sequence was assigned GenBank Accession No. EU 556701. Pathogenicity of two isolates obtained from infected plants was confirmed by inoculating 10 80-day-old plants grown in 14-cm-diameter pots. Inoculum consisted of 1 cm2 of mycelium excised from a 10-day-old PDA culture of each isolate and placed on the soil surface around the base of each plant. Ten plants were inoculated with each isolate and 10 noninoculated plants served as controls. Plants were maintained in a greenhouse under shade at temperatures of 10 to 22°C (average 19°C), in high relative humidity (>90%), and were watered as needed. The trial was conducted twice. All inoculated plants developed leaf yellowing within 12 days of inoculation. White, cottony mycelium and black sclerotia developed on stems and at the base of all inoculated plants, which eventually wilted. Control plants remained symptomless. S. sclerotiorum was reisolated from the stems of inoculated plants. This disease has been reported on an Osteospermum sp. in the United States (3) and Argentina (4). To our knowledge, this is the first report of white mold on an Osteospermum sp. in Italy as well as in Europe. Currently, the economic importance of this disease is limited. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) N. F. Buchwald. Den. Kgl. Veterin.er-og Landbohojskoles Aarsskrift. 75, 1949. (3) H. S. Gill. Plant Dis. Rep. 59:82, 1975. (4) E. R. Wright et al. Plant Dis. 89:1014, 2005.

Download Full-text

First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽

10.1094/pdis-08-13-0873-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 843-843 ◽

Cited By ~ 6

Author(s):

N.-H. Lu ◽

Q.-Z. Huang ◽

H. He ◽

K.-W. Li ◽

Y.-B. Zhang

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Avicennia Marina ◽

Optical Microscope ◽

Ethanol Solution ◽

Morphological Observation ◽

Fusarium Equiseti ◽

First Report ◽

Initial Symptoms ◽

Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Download Full-text

First Report of Euphorbia larica Dieback Caused by Fusarium brachygibbosum in Oman

Plant Disease ◽

10.1094/pdis-09-12-0828-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 687-687 ◽

Cited By ~ 9

Author(s):

I. H. Al-Mahmooli ◽

Y. S. Al-Bahri ◽

A. M. Al-Sadi ◽

M. L. Deadman

Keyword(s):

Elongation Factor ◽

Aerial Mycelium ◽

Its Region ◽

Common Component ◽

First Report ◽

Ethnobotanical Uses ◽

Artificial Inoculations ◽

Stem Lesions ◽

Desert Flora

Euphorbia larica Boiss. (Arabic = Isbaq) is a dominant and common component of the native desert flora of northern Oman. Traditional ethnobotanical uses have included use of the latex for treating camels with parasites. In February 2011, E. larica plants showing stem lesions up to several cm long and in many cases with stem dieback were collected from Al-Khoudh 50 km west of Muscat. The disease appeared widespread within the location where several dead specimens were also recorded, although the cause was unclear. Sections (5 mm) of five diseased branches taken from different plants and placed on potato dextrose agar (PDA) in all cases yielded Fusarium-like colonies. Colonies recovered were initially white becoming rose to medium red in color with abundant aerial mycelium. Macroconidia were scarce and scattered (mean of 20 spores: 26.83 × 4.73 μm) with three to four septa per spore; microconidia were slightly curved, ovoid, and fusiform (mean of 20 spores: 11.64 × 4.03 μm) with zero to two septa per spore. Spherical chlamydospores (mean of 20 spores: 11.05 μm) were terminal and intercalary, single, and in chains. In vitro characters and spores measurements conformed to previously described features of Fusarium brachygibbosum Padwick (1). Mycelial plugs (5 mm) were taken from 7-day-old cultures of the fungus grown on 2.5% PDA and applied to a small incision (3 mm) on the stems of healthy E. larica grown in situ and protected with wet cotton and Parafilm. The residual agar, mycelium, cotton, and Parafilm were removed after 7 days and symptoms were recorded. Control stems were inoculated using PDA (5 mm) plugs alone and inoculations were repeated twice. Artificial inoculations resulted in dieback of all stems within 11 days and fungal colonies identical to initial isolations were recovered from artificially infected surface-sterilized stem pieces. Identification of F. brachygibbosum was confirmed by comparing sequences generated from the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1 and ITS4 primers) and the intron region of translation elongation factor alpha (EF1-α) (EF-1-986 and EF-728 primers). The ITS and EF1-α sequences were found to share 100% and 99% nucleotide similarity to previously published sequences of the ITS (HQ443206) and EF1-α (JQ429370) regions of F. brachygibbosum in GenBank. The accession number of ITS sequence of one isolate assigned to EMBL-Bank was HF562936. The EF sequence was assigned to EMBL-Bank accession (submission number Hx2000027017; number will be sent later). This pathogen has previously been reported on date palm (2) in Oman but, to our knowledge, this is the first report of this pathogen on E. larica. References: (1) A. M. Al-Sadi et al. Crop Prot. 37:1, 2012. (2) G. W. Padwick. Mycol. Pap. 12:11, 1945.

Download Full-text

First Report of Dolabra nepheliae Associated with Corky Bark Disease of Rambutan and Pulasan in Honduras

Plant Disease ◽

10.1094/pdis-01-12-0081-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 765-765 ◽

Cited By ~ 2

Author(s):

A. Rossman ◽

J. Melgar ◽

D. Walker ◽

A. Gonzales ◽

T. Ramirez ◽

...

Keyword(s):

Puerto Rico ◽

Sequence Data ◽

Management Strategies ◽

Pairwise Comparison ◽

Its Region ◽

Its Sequence ◽

Centraalbureau Voor ◽

First Report ◽

Intergenic Spacers ◽

Old Trees

In the last decade, rambutan (Nephelium lappaceum L., Sapindaceae) and pulasan (N. mutabile Blume) have been cultivated in Honduras to produce exotic fruits for export to North America (2). Recently, a disease was observed that produces dark brown to black fissured cankers from 1 to 3 cm long and 1 to 4 cm wide. The infected bark tissue becomes swollen with the middle region 3 to 8 mm thick. Symptoms appear when the trees are approximately 3 years old. As the trees mature, the cankers increase in size and weaken the branches, often resulting in breakage with the weight of the fruit causing substantial plant damage and fruit loss. In August 2010, fissured branch samples of rambutan and pulasan were collected from 6- to 8-year-old trees from the Humid Tropical Demonstrative Agroforestry Center in Honduras, Atlantida, La Masica (15°33′47.4″N, 87°05′2.5″W, elevation 106 m). A fungus associated with the cankers was identified as Dolabra nepheliae. It produces black, stipitate, elongate ascomata, 312 to 482 × 250 to 281 μm with broadly cylindric, bitunicate asci, 120 to 138 × 11.2 to 15.0 μm, and filiform, hyaline ascospores, 128 to 135 × 2.8 to 3.2 μm. Fungi from rambutan and pulasan were isolated on cornmeal agar plus 0.5% dextrose and antibiotics. On potato dextrose agar, the ascospores produced slow-growing colonies, 5 mm per week. In culture, isolates from both hosts produced pycnidia with elongated, slightly to strongly curved or S-shaped, hyaline conidia, 22.8 to 46.4 × 2.8 to 3.7 μm. This fungus was first reported on rambutan and pulasan from Malaysia (1,4), and later reported on rambutan and litchi in Hawaii and Puerto Rico (3). To our knowledge, this is the first report of D. nepheliae on pulasan and rambutan from Honduras. Specimens have been deposited at the U.S. National Fungus Collections (BPI 882442 on N. lappaceum and BPI 882443 on N. mutabile). Cultures were deposited at the Centraalbureau voor Schimmelcultures (CBS) as CBS 131490 on N. lappaceum and CBS 131491 on N. mutabile. Sequences of the internal transcribed spacer (ITS) region including ITS1, 5.8S, and ITS2 intergenic spacers were deposited in GenBank (Accession No. JQ004281 on N. lappaceum and Accession No. JQ004280 on N. mutabile). A BLAST search and pairwise comparison using the GenBank web server were used to compare ITS sequence data and recovered the following results: (i) CBS 131490 on N. lappaceum is 99% (538 of 544) identical to D. nepheliae CBS 123297 on Litchi chinensis from Puerto Rico; and (ii) CBS 131491 on N. mutabile is 99% (527 of 533) identical to the same strain of D. nepheliae. On the basis of the ITS sequence data, the isolates from Honduras were confirmed as the same species, D. nepheliae from Puerto Rico. Efforts to develop resistant germplasm and management strategies to control this disease have been initiated. References: (1) C. Booth and W. P. Ting. Trans. Brit. Mycol. Soc. 47:235, 1964. (2) T. Ramírez et al. Manual Para el Cultivo de Rambutan en Honduras. Fundación Hondureña de Investigación Agrícola. La Lima, Cortes, Honduras, 2003. (3) A. Y. Rossman et al. Plant Dis. 91:1685, 2007. (4) H. Zalasky et al. Can. J. Bot. 49:559, 1971.

Download Full-text

First Report of Sugar Beet Seedling Damping-Off Caused by Binucleate Rhizoctonia AG-A in China

Plant Disease ◽

10.1094/pdis-05-12-0492-pdn ◽

2012 ◽

Vol 96 (11) ◽

pp. 1696-1696 ◽

Cited By ~ 6

Author(s):

P. P. Wang ◽

X. H. Wu

Keyword(s):

Sugar Beet ◽

Disease Incidence ◽

Soil Surface ◽

Its Region ◽

Molecular Characteristics ◽

Damping Off ◽

First Report ◽

Binucleate Rhizoctonia ◽

Hyphal Diameter ◽

Wheat Seeds

Sugar beet (Beta vulgaris L.) is grown worldwide and produces one-third of the world's sugar supply. Sugar beet seedling Rhizoctonia damping-off is an important disease mainly caused by Rhizoctonia solani AG-2, AG-4, and AG-5 (2). In 2010, diseased sugar beet seedlings with about 20% incidence affected by damping-off, which showed dark brown lesions on the stems just below the soil surface and portions of the roots, were collected from nurseries in three locations in Heilongjiang province, northeast China. Root fragments taken from the margins of healthy tissues and lesions on roots were surface disinfected with 0.5% sodium hypochlorite for 2 min, rinsed with sterile water, then placed on potato dextrose agar (PDA) and incubated at 25°C in the dark. Three (designed HLJ-RAA1, HLJ-RAB1, HLJ-RAB2) of nine Rhizoctonia isolates were obtained from diseased tissues and preliminarily identified as binucleate Rhizoctonia (BNR) anamorph (teleomorph Ceratobasidium Rogers) species-like. Fungal colonies were white with large amounts of floccose, aerial hyphae. Hyphal cells were determined to be binucleate when stained with 4′-6-diamidino-2-phenylindole (DAPI) (1). No sclerotia were produced after 14 days on PDA. Average hyphal diameter of the three isolates were 4.2, 4.3, and 4.8 μm, respectively. Further, the internal transcribed spacer (ITS) region of rDNA was amplified from the genomic DNA extracted from hyphae by bead beating in 2% CTAB solution using stainless steel beads with primers ITS1 and ITS4. The ITS sequences (GenBank Accession Nos. JX073668, JX073669, and JX073670) were over 99% identical to those of more than 50 Ceratobasidium sp. AG-A isolates (e.g., GenBank Accession No. JQ688054.1; strain HY-15). Therefore, based on morphological and molecular characteristics, these isolates were identified to be BNR AG-A. To determine the pathogenicity of the isolates, sugar beet (cv. HI0305) seedlings were inoculated with wheat seeds colonized with each of the isolated Rhizoctonia strains (one seed per seedling), and grew in pots under greenhouse conditions (3). After 3 weeks, some inoculated plants showed damping-off as observed in the nurseries, whereas noninoculated control plants (sterile wheat seeds only) remained healthy. Disease incidence from the trials averaged 53.3%, 70%, and 53.3% for the isolates HLJ-RAA1, HLJ-RAB1, and HLJ-RAB2, respectively. The three BNR cultures of the pathogens were consistently reisolated from symptomatic roots, and their identities confirmed by morphological and molecular characteristics as described above, fulfilling Koch's postulates. BNR AG-A was previously reported to be pathogenic to soybean, pea, snap bean, and pak choy in China (4). However, to our knowledge, this is the first report of BNR AG-A causing sugar beet seedling damping-off in China. Sugar beet is often grown in crop rotation with soya bean and such a rotation could increase the risk of soilborne infection to either crop by BNR AG-A. References: (1) W. C. Kronland and M. E. Stanghellini. Phytopathology 78:820, 1988. (2) E. O'Sullivan and J. A. Kavanagh. Plant Pathol. 40:128, 1991. (3) C. E. Windels and D. J. Nabben. Phytopathology 79:83, 1989. (4) G. H. Yang et al. J. Phytopathol. 153:333, 2005.

Download Full-text

First Report of Anthracnose Disease on Young Stems of Bawanghua (Hylocereus undatus) Caused by Colletotrichum gloeosporioides in China

Plant Disease ◽

10.1094/pdis-06-13-0609-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 991-991 ◽

Cited By ~ 2

Author(s):

W. J. Ma ◽

X. Yang ◽

X. R. Wang ◽

Y. S. Zeng ◽

M. D. Liao ◽

...

Keyword(s):

Colletotrichum Gloeosporioides ◽

Sequence Data ◽

Southern China ◽

Morphological Characteristics ◽

Its Region ◽

Pathogenic Fungi ◽

First Report ◽

Guangzhou City ◽

Anthracnose Disease ◽

Hylocereus Undatus

Hylocereus undatus widely grows in southern China. Some varieties are planted for their fruits, known as dragon fruits or Pitaya, while some varieties for their flowers known as Bawanghua. Fresh or dried flowers of Bawanghua are used as routine Chinese medicinal food. Since 2008, a serious anthracnose disease has led to great losses on Bawanghua flower production farms in the Baiyun district of Guangzhou city in China. Anthracnose symptoms on young stems of Bawanghua are reddish-brown, sunken lesions with pink masses of spores in the center. The lesions expand rapidly in the field or in storage, and may coalesce in the warm and wet environment in spring and summer in Guangzhou. Fewer flowers develop on infected stems than on healthy ones. The fungus overwinters in infected debris in the soil. The disease caused a loss of up to 50% on Bawanghua. Putative pathogenic fungi with whitish-orange colonies were isolated from a small piece of tissue (3 × 3 mm) cut from a lesion margin and cultured on potato dextrose agar in a growth chamber at 25°C, 80% RH. Dark colonies with acervuli bearing pinkish conidial masses formed 14 days later. Single celled conidia were 11 to 18 × 4 to 6 μm. Based on these morphological characteristics, the fungi were identified as Colletotrichum gloeosporioides (Penz.) Penz. & Sacc (2). To confirm this, DNA was extracted from isolate BWH1 and multilocus analyses were completed with DNA sequence data generated from partial ITS region of nrDNA, actin (ACT) and glutamine synthetase (GS) nucleotide sequences by PCR, with C. gloeosporioides specific primers as ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) / CgInt (5′-GGCCTCCCGCCTCCGGGCGG-3′), GS-F (5′-ATGGCCGAGTACATCTGG-3′) / GS-R (5′-GAACCGTCGAAGTTCCAC-3′) and actin-R (5′-ATGTGCAAGGCCGGTTTCGC-3′) / actin-F (5′-TACGAGTCCTTCTGGCCCAT-3′). The sequence alignment results indicated that the obtained partial ITS sequence of 468 bp (GenBank Accession No. KF051997), actin sequence of 282 bp (KF712382), and GS sequence of 1,021 bp (KF719176) are 99%, 96%, and 95% identical to JQ676185.1 for partial ITS, FJ907430 for ACT, and FJ972589 for GS of C. gloeosporioides previously deposited, respectively. For testing its pathogenicity, 20 μl of conidia suspension (1 × 106 conidia/ml) using sterile distilled water (SDW) was inoculated into artificial wounds on six healthy young stems of Bawanghua using sterile fine-syringe needle. Meanwhile, 20 μl of SDW was inoculated on six healthy stems as a control. The inoculated stems were kept at 25°C, about 90% relative humidity. Three independent experiments were carried out. Reddish-brown lesions formed after 10 days, on 100% stems (18 in total) inoculated by C. gloeosporioides, while no lesion formed on any control. The pathogen was successfully re-isolated from the inoculated stem lesions on Bawanghua. Thus, Koch's postulates were fulfilled. Colletotrichum anthracnose has been reported on Pitaya in Japan (3), Malaysia (1) and in Brazil (4). To our knowledge, this is the first report of anthracnose disease caused by C. gloeosporioides on young stems of Bawanghua (H. undatus) in China. References: (1) M. Masyahit et al. Am. J. Appl. Sci. 6:902, 2009. (2) B. C. Sutton. Page 402 in: Colletotrichum Biology, Pathology and Control. J. A. Bailey and M. J. Jeger, eds. CAB International, Wallingford, UK, 1992. (3) S. Taba et al. Jpn. J. Phytopathol. 72:25, 2006. (4) L. M. Takahashi et al. Australas. Plant Dis. Notes 3:96, 2008.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America

Plant Disease ◽

10.1094/pdis-94-2-0279b ◽

2010 ◽

Vol 94 (2) ◽

pp. 279-279 ◽

Cited By ~ 1

Author(s):

A. M. Minnis ◽

A. Y. Rossman ◽

D. L. Clement ◽

M. K. Malinoski ◽

K. K. Rane

Keyword(s):

North America ◽

Powdery Mildew ◽

Dna Sequence ◽

Sequence Data ◽

Its Region ◽

Podosphaera Leucotricha ◽

First Report ◽

Pyrus Calleryana ◽

Dna Sequence Data ◽

Callery Pear

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

Download Full-text

First Report of Soybean Neocosmospora Stem Rot Caused by Neocosmospora vasinfecta var. vasinfecta in China

Plant Disease ◽

10.1094/pdis-04-11-0287 ◽

2011 ◽

Vol 95 (8) ◽

pp. 1031-1031

Author(s):

Y. Gai ◽

R. Pan ◽

D. Xu ◽

C. Ji ◽

M. Deng ◽

...

Keyword(s):

Soil Surface ◽

Its Region ◽

The United States ◽

Crown Rot ◽

Stem Rot ◽

Universal Primers ◽

Conidial Suspension ◽

Fruiting Bodies ◽

Gentle Pressure ◽

Stem Lesions

During October 2009, the occurrence of a disease on soybean (Glycine max) was observed in several fields in Boluo County and Zengcheng City, Guangdong Province. Top leaves of infected plants initially turned yellow and plants eventually were defoliated, while stems and roots became black and rotted. The stem lesions sometimes extended 10 to 15 cm upward from the soil surface. Orange-to-brown spherical fruiting bodies, which were very similar with those of the soybean red crown rot pathogen, scattered or congregated on the stem lesions. Plants with symptoms were sampled from fields. Fruiting bodies were excised from diseased tissues. Microscopic examination revealed that they were perithecia, globose to pyriform, ostiolate with a short neck, and measured 160 to 298 × 151 to 235 μm. Under gentle pressure, asci and ascospores were exuded from these perithecia. Asci were eight spored, narrowly cylindrical to clavate, thin walled, with a short stalk, and measured 58 to 124 μm long and 8 to 15 μm in diameter. Ascospores were uniseriately arranged, globose to ellipsoid, thick walled, one celled, hyaline to pale, and measured 14 to 17 × 8 to 12 μm. Isolation was made from stem tissues at the edge of disease lesions on potato dextrose agar (PDA) amended with streptomycin sulfate and incubated at 25°C. Mycelia were white and floccose. Conidia were cylindrical to oblong-ellipsoidal, hyaline, one celled, and measured 6 to 22 × 2 to 5 μm, aggregating in a slimy mass on the apex of the conidiogenous cell. Abundant orange-to-brown spherical perithecia were produced on the colony. Ascospores had walls with a rugose ornamentation that could be clearly seen under a scanning electron microscope. The fungus was identified as Neocosmospora vasinfecta var. vasinfecta (anamorph Acremonium sp.) (1). The internal transcribed spacer (ITS) region of rDNA of two isolates were amplified with universal primers ITS1/ITS4 and sequenced (GenBank Accession No. JF705861 and JF705862), and comparisons with GenBank accessions showed 99% similarity with N. vasinfecta strain Pec070 (Accession No. FJ940902) and strain NRRL22497 (Accession No. AY381142). Pathogenicity tests were conducted. Five, 3-week-old seedlings of soybean cv. Huaxia No. 3 planted in plastic pots (20 cm in diameter) were wounded with a needle at the base of the stem below the soil line and near the root system, and then inoculated by drenching the soil with a conidial suspension (105 per ml). Control plants were inoculated with sterile water. There were six replicates for each treatment. The treated plants were incubated at 25 ± 2°C in a greenhouse. All inoculated plants exhibited symptoms of leaf yellowing and black rot of stems and roots 3 weeks after inoculation. N. vasinfecta var. vasinfecta was reisolated from the diseased plants. All control plants remained healthy. To our knowledge, this is the first observation of Neocosmospora stem rot of soybean in China. The pathogen could pose a threat to soybean, which is a major crop in China. This disease has been previously reported in the United States though the anamorph of the pathogen has either not been identified or has been identified as a Cylindrocarpon sp. (2,4). This fungus is also associated with human infections (3). References: (1) P. F. Cannon and D. L. Hawksworth. Trans. Br. Mycol. Soc. 82:673, 1984. (2) F. A. Gray et al. Plant Dis. 64:321, 1980. (3) P. Manikandan et al. Med. Mycol. 46:279, 2008. (4) D. V. Phillips. Phytopathology 62:612, 1972.

Download Full-text

First Report of Target Spot of Broadleaf Tobacco Caused by Rhizoctonia solani (AG-3) in Connecticut

Plant Disease ◽

10.1094/pdis-04-12-0335-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

Rhizoctonia Solani ◽

Sequence Data ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2011, 15 transplant beds of broadleaf cigar wrapper tobacco (Nicotiana tabacum L., cv. C9) plants in Hartford County, Connecticut, were observed with almost every plant diseased. Leaf lesion symptoms ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Disease was subsequently observed, also at nearly 100% incidence in a 10-hectare field on that farm and at additional broadleaf tobacco farms from two other towns in Hartford County and one town in Tolland County. Lesions exhibited a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A. B. Frank) was isolated from the margins of lesions that had been surface sterilized in 0.5% NaOCl for 30 s and then rinsed in sterile distilled water and placed on the surface of half-strength potato dextrose agar (PDA). Multiple isolations were made and the pathogen was identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm, and hyphal branches occurring at approximately right angles, constricted at the base (4). Eight-week-old potted tobacco plants were each inoculated by spraying with a mycelial suspension (1 × 105 CFU) of an isolate of R. solani recovered from tobacco onto leaves, or with water alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants placed in trays filled to a depth of 1 cm with water in the growth chamber. After 8 days, the pathogen was reisolated from all inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were asymptomatic. DNA was liberated from hyphae of the R. solani isolate by bead beating in STE buffer using 0.15 mm zirconium beads. Two microliters of the eluate was used to amplify the ITS region. Amplified DNA was purified in a Qiagen QIAquick PCR purification kit and submitted to the Yale science hill genomic facility for standard Sanger dideoxy sequencing. The sequence was exactly the same as an isolate from Massachusetts that we sequenced in 2010 (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease has been previously reported on tobacco from South America, South Africa, and the southern United States (1), Canada (3), and Massachusetts (2). Conditions were very conducive for disease because 2011 was a very wet year in Connecticut. To our knowledge, this is the first report of this disease in broadleaf cigar wrapper tobacco in Connecticut. The sequence data suggested that it may have been introduced to Connecticut from Massachusetts. We have found the target spot pathogen distributed across the tobacco producing area of Connecticut. This constitutes a serious threat as there are no systemic fungicides currently registered for control of this disease in broadleaf tobacco. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993. (2) J. A. LaMondia and C. R. Vossbrinck, Plant Dis. 95:496, 2010. (3) R. D. Reeleder et al., Plant Dis., 80:712. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Colletotrichum higginsianum Causing Anthracnose of Arugula (Eruca sativa) in Florida

Plant Disease ◽

10.1094/pdis-09-13-0926-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1269-1269 ◽

Cited By ~ 2

Author(s):

J. S. Patel ◽

M. I. Costa de Novaes ◽

S. Zhang

Keyword(s):

Sequence Data ◽

Morphological Characteristics ◽

Its Region ◽

The United States ◽

Economic Losses ◽

Infected Leaf ◽

Eruca Sativa ◽

First Report ◽

Small Water ◽

Colletotrichum Higginsianum

Arugula (Eruca sativa) is grown in Florida and is an important component in packaged salad products. During spring 2013, leaf lesions on arugula caused significant economic losses in Miami-Dade County, Florida. Symptoms initially appeared as small water-soaked lesions that later became circular, sunken, and white in the center with a dark brown to black halo, up to 4 mm in diameter. Acervuli were found under a dissecting microscope on infected leaf lesions with black spines or setae. Occasionally, small, circular, often longitudinal dark brown spots appeared on leaf branches. Leaf tissues (5 × 5 mm) from lesion margins were surface sterilized in 0.9% sodium hypochlorite for 10 min, rinsed with sterile distilled water, and plated on potato dextrose agar (PDA). PDA plates were incubated at 21°C under 24-h fluorescent lights for 4 to 6 days. The fungus initially produced gray mycelium followed by orange conidial mass. Hyphae of the fungus were septate and hyaline. After 5 to 7 days, the fungus produced acervuli with dark brown to black setae (75 to 130 μm long) (n = 20). Conidia were found in the colonies, which were single celled, oblong, hyaline, and 12 to 25 × 4 to 6 μm (n = 20). The cultural and morphological characteristics of the conidia were similar to those for Colletotrichum higginsianum Sacc (1). To further confirm the species of the isolates, the sequence of the ITS region of rDNA, chitin synthase 1 (CHS1), and actin (ACT) was amplified from isolates 05131 and 05132 using primer pairs ITS 1 and ITS 4 (4), CHS-79F and CHS-354R, and ACT-512F and ACT-783R (3), respectively. The sequenced data of each locus were deposited in GenBank with accessions KF550281.1, KF550282.1, KJ159904, KJ159905, KJ159906, and KJ159907. The resulting sequence of ITS showed 100% identity with sequences of C. higginsianum in JQ005760.1, and sequence of ACT gene showed 100% identity with C. higginsianum in JQ005823.1. The sequence of ACT gene and ITS region had ≤99% identity with other closely related Colletotrichum spp. CHS1 gene had 100% identity with JQ005781.1 belonging to C. higginsianum, and one accession JQ005783.1 belonging to C. fuscum. However, ACT gene and ITS region does not share 100% identity with C. fuscum and therefore, sequence data from three loci proves that isolated pathogen is C. higginsianum. All the above mentioned accessions that shared 100% identity with sequences of isolates used in our study have been previously used to represent the species in the C. destructivum clade in a systematics study (2). To confirm its pathogenicity, a suspension of isolate 05132 at 5 × 105 conidia/ml was sprayed on leaves of five arugula plants until runoff. The other five arugula plants sprayed with water served as non-inoculated controls. Both inoculated and non-inoculated plants were separately covered with a plastic bag to maintain high humidity for 24 h at 27 ± 5°C under natural day/night conditions in the greenhouse. Symptoms first appeared 3 to 4 days after inoculation as small water-soaked lesions, which became sunken with dark brown to black margins. Small circular and longitudinal dark brown spots were also seen on leaf branches as seen initially on naturally infected arugula. No symptoms developed on non-inoculated control plants. C. higginsianum was re-isolated from the lesions with the same morphological characteristics as described above, fulfilling Koch's postulates. To our knowledge, this is the first report of C. higginsianum causing anthracnose of arugula in Florida. This pathogen may potentially affect the salad industry in the United States. References: (1) A. J. Caesar et al. Plant Dis. 94:1166, 2010. (2) P. F. Cannon et al. Stud. Mycol. 73:181, 2012. (3) I. Carbone and L. M. Kohn. Mycologia 91:553, 1999. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text