First Report of Gray Mold of Strawberry Caused by Botrytis cinerea in South Carolina

Gray mold caused by Botrytis spp. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. From April to June 2011, strawberries with symptoms resembling gray mold disease were collected from different locations (Chesnee, Florence, Lexington, McBee, Monetta, and North Augusta) in South Carolina. Fruit infections began as small, firm, light brown lesions that enlarged quickly, becoming covered with a gray, fuzzy mass of spores followed by a soft rot. To isolate the causal agent, spores from symptomatic fruit were suspended in 1% Tween 20, streaked onto the surface of potato dextrose agar plates, and incubated at 22°C. Fungal colonies from single spores were at first colorless and later became gray to brown when the conidiphores and conidia developed. Conidia were identified by their morphological characteristics: an average size of 14 × 9 μm, ellipsoid to rounded without internal structure, and with a scar on the point of union to the conidiophore (1). Sclerotia produced in culture were hard, dark, irregular shaped, and formed after 2 weeks. The pathogen was identified as Botrytis cinerea Pers.: on the basis of morphology and confirmed by a restriction digest with ApoI of the 413-kb PCR amplification product obtained with BA2f/BA1r primers (2). Koch's postulates were conducted by inoculating 10 surface-sterilized strawberries with a conidial suspension (105 spores/ml) of a randomly chosen B. cinerea isolate previously characterized; 10 control fruit received sterile water without conidia. The inoculated fruit were incubated for 3 days at room temperature in air-tight plastic bags. Inoculated fruit developed typical gray mold symptoms with gray sporulating lesions. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. For many Botrytis spp., the internal transcribed spacer region does not reveal nucleotide variations and thus is useless for species identification. We used additional, more appropriate genetic markers for molecular-based species identification and verified that strawberries in South Carolina are affected by gray mold disease caused by B. cinerea. To our knowledge, this is the first scientific report of B. cinerea causing gray mold of strawberry in South Carolina. References: (1) W. R. Jarvis. Botryotinia and Botrytis Species: Taxonomy, Physiology and Pathogenicity. A Guide to the Literature. Monograph no. 15. Canada Department of Agriculture, Research Branch, Ottawa, 1977. (2) K. Nielsen et al. Plant Dis. 86:682, 2002.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Gray Mold of Blackberry Caused by Botrytis cinerea in South Carolina

Plant Disease ◽

10.1094/pdis-06-11-0530 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1592-1592 ◽

Cited By ~ 1

Author(s):

X. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Signs And Symptoms ◽

Gray Mold ◽

Fluorescent Light ◽

Its2 Region ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

First Report ◽

Control Fruit

Botrytis cinerea Pers.: Fr. is a causal agent of gray mold of blackberry but may also affect grapevine, tomato, bulb flowers, and ornamental crops (2). In August 2010, blackberries (Rubus fruticosus and other species) showing gray mold symptoms were found in Longcreek, Six Mile, and Cheddar, SC. Symptomatic blackberry fruit exhibited patterns of brown-to-gray mycelia and conidiophores. Upon isolation, the mycelium grew at a rate of 12.3 mm per day at 22°C on potato dextrose agar, forming pale white-to-gray colonies with concentric rings and conidiophores (less than 12 h of fluorescent light per day). Some isolates formed dark brown sclerotia in the dark after 18 days. The lemon-shaped spores averaged 12 × 9 μm and were consistent with descriptions of B. cinerea. (1) The ribosomal internal transcribed spacer (ITS) ITS1-5.8S-ITS2 region was amplified via PCR from genomic DNA obtained from mycelia using primers ITS1 and ITS4. A BLAST search in GenBank revealed highest similarity (99 to 100%) to sequences from various Botrytis spp. collected in China, Canada, and Spain (GenBank Accession Nos. FJ169666.1, GU934505.1, and EF207414.1). The ITS sequence amplified from the blackberry isolate was submitted to GenBank (Accession No. JN164269). The pathogen was further identified to the species level as B. cinerea using glyceraldehyde-3-phosphate dehydrogenase, heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) gene sequences (2) (GenBank Accession Nos. JN164270, JN164271, JN164272). Pathogenicity was confirmed by inoculating three surface-sterilized (soaked in 5% bleach for 15 min), mature blackberry fruit (R. fruticosus) with a conidial suspension (105 spores/ml) of the blackberry isolate. A 20-μl droplet was placed on the fruit; control fruit received sterile water without conidia. After 5 days of incubation at room temperature in an air-tight Magenta box, the inoculated fruit developed typical signs and symptoms of gray mold. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. To our knowledge, this is the first report of B. cinerea on blackberry in South Carolina. The disease must be managed with fungicides to obtain high quality fruit with market-requested shelf life. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 17, 2011. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea from a Blackberry Field in Georgia

Plant Disease ◽

10.1094/pdis-10-13-1020-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 848-848 ◽

Cited By ~ 6

Author(s):

D. Fernández-Ortuño ◽

A. Grabke ◽

P. K. Bryson ◽

E. D. Beasley ◽

L. A. Fall ◽

...

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Crop Protection ◽

The United States ◽

Gray Mold ◽

Resistant Isolate ◽

Malt Extract ◽

First Report ◽

Control Fruit ◽

Lesion Diameter

Botrytis cinerea Pers. is an important plant-pathogenic fungi responsible for gray mold on more than 230 plant species worldwide, including blackberry (Rubus). One of the main strategies to control the disease involves the application of different classes of fungicides. The phenylpyrrole fludioxonil is currently marketed in combination with the anilinopyrimidine cyprodinil as Switch 62.5WG (Syngenta Crop Protection Inc., Greensboro, NC) for gray mold control. In August 2013, blackberries affected with symptoms resembling gray mold were collected from a field located in Berrien County (Georgia), where Switch 62.5WG had been used extensively over the last 5 years. Three single-spore isolates, each from a different fruit, were obtained and identified as B. cinerea on the basis of morphology and confirmed by a 238-bp PCR amplification product obtained with primer set G3PDH-F1 (5′-GGACCCGAGCTAATTTATGTCACGT-3′), G3PDH-F2 (5′-GGGTGTCAACAACGAGACCTACACT-3′), and G3PDH-R (5′-ACCGGTGCTCGATGGGATGAT-3′). In vitro sensitivity to fludioxonil (Scholar SC, Syngenta) was determined on 1% malt extract agar (MEA) using a conidial germination assay as previously described (4). One isolate was moderately resistant due to growth on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and residual growth at 10 μg/ml (4). To assess performance of fludioxonil in detached fruit assays, commercially grown strawberries (24 in total for each isolate and treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water (control fruit) or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Scholar SC was used because fludioxonil was the sole active ingredient in this product and strawberries were used because latent infections in fresh blackberry fruit interfered with inoculation experiments. This dose reflects the rate recommended for postharvest gray mold control according to the Scholar label. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of the two sensitive or the resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolates developed gray mold on non-treated (2.7 cm lesion diameter) but not on Scholar SC-treated fruit (0.0 cm lesion diameter). The resistant isolate developed gray mold disease on the water-treated control fruit (2.5 cm lesion diameter) and the fungicide-treated fruit (1.8 cm lesion diameter). EC50 values were determined in microtiter assays as described previously (3) using the concentrations of 0.01, 0.04, 0.12, 0.37, 1.1, 3.3, and 10 μg/ml fludioxonil. Values were 0.02 and 0.05 μg/ml for the two sensitive isolates and 3.15 μg/ml for the resistant isolate. All experiments were performed twice. This is the first report of fludioxonil resistance in B. cinerea from blackberry in Georgia. Prior to this study, resistance to fludioxonil in B. cinerea was reported in France, Germany, and only a few states in the United States including Maryland, South Carolina, Virginia, and Washington (1,2). The emergence of resistance to fludioxonil emphasizes the importance of resistance management strategies. References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 98:692, 2013. (3) M. Kretschmer et al. PLOS Pathog. 5:e1000696, 2009. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Gray Mold of Strawberry Caused by Botrytis caroliniana in North Carolina

Plant Disease ◽

10.1094/pdis-12-11-1018-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 914-914 ◽

Cited By ~ 4

Author(s):

D. Fernández-Ortuño ◽

X. P. Li ◽

F. Wang ◽

G. Schnabel

Keyword(s):

North Carolina ◽

South Carolina ◽

New Species ◽

Aerial Mycelium ◽

Gray Mold ◽

Tween 20 ◽

Strawberry Fruit ◽

Single Spore ◽

First Report ◽

Control Fruit

Gray mold caused by Botrytis spp. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. In June 2011, strawberry fruit that was symptomatic of gray mold disease was collected from High Point county in North Carolina. Fruit had brown lesions that enlarged quickly and were covered with green-gray masses of spores followed by a soft rot. To isolate the causal agent, conidia were scraped off the fruit, suspended in 1% Tween 20, spread on water agar amended with 0.1% lactic acid, and emerging colonies were then transferred onto potato dextrose agar (PDA) medium. All but one single-spore colony (designated HP33) were at first colorless and later became gray to brown when the conidiphores and conidia developed on PDA. Isolate HP33 was white to pale gray with short, tufted aerial mycelium, black sclerotia in concentric rings, and did not produce conidia on PDA. Conidia were subhyaline to light brown, smooth, ellipsoid, ovoid or obovoid, and were on average 11.7 × 8.6 μm. The conidiophores were erect, septate, and brown to subhyaline from the base to apex, with swollen basal cell and multiple inflated conidiogenous cells. These morphological features were consistent with Botrytis caroliniana X. P. Li & G. Schnabel sp. nov., a new species isolated recently from blackberry fruit in South Carolina (2). All other single-spore isolates were confirmed to be B. cinerea as described previously (1). To confirm the identity of isolate HP33 to the species level, the necrosis and ethylene-inducing protein 1 (NEP1) was PCR amplified and sequenced by primer pairs NEP1for/NEP1rev as described previously (3). The nucleotide sequence matched the ones published for B. caroliniana (GenBank Accession Nos. JF811593, JF811594, and JF811595). Pathogenicity tests were conducted by inoculating 10 surface-sterilized strawberry fruit with single agar plugs (6 mm in diameter) containing actively growing mycelium; 10 control fruit received agar plugs without mycelium. The inoculated fruit were incubated for 3 days at room temperature in airtight plastic bags and after that developed typical gray mold symptoms. Koch's postulates were fulfilled by the reisolation of B. caroliniana from symptomatic fruit. Control fruit remained healthy. To our knowledge, this is the first report of B. caroliniana on strawberry. It is uncertain whether the new species requires management strategies different from those that control gray mold caused by B. cinerea. References: (1) D. Fernández-Ortuño et al. Plant Dis. 95:1482, 2011. (2) X. P. Li et al. Mycologia 2012, doi:10.3852/11-218. (3) M. Staats et al. Fungal Genet. Biol. 44:52, 2007.

Download Full-text

First Report of Thiophanate-Methyl Resistance in Botrytis cinerea on Strawberry from South Carolina

Plant Disease ◽

10.1094/pdis-06-12-0557-pdn ◽

2012 ◽

Vol 96 (11) ◽

pp. 1700-1700 ◽

Cited By ~ 8

Author(s):

D. Fernández-Ortuño ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Fungicide Resistance ◽

Pathogenic Fungi ◽

Gray Mold ◽

Resistant Isolate ◽

Conidial Suspension ◽

Strawberry Fruit ◽

Single Spore ◽

Thiophanate Methyl

Botrytis cinerea Pers.:Fr. is the causal agent of gray mold disease and one of the most important plant-pathogenic fungi affecting strawberry (Fragaria× ananassa). Control of gray mold mainly depends on fungicides, including the methyl benzimidazole carbamate (MBC) thiophanate-methyl. In 2011, strawberries with gray mold symptoms were collected from commercial fields near Chesnee, Florence, Lexington, McBee, Monetta, and North Augusta, all in South Carolina. MBC fungicides were used in most of these fields for gray mold control during the last 3 years. A total of 124 single spore B. cinerea isolates were obtained, each from a different fruit. Resistance to thiophanate-methyl (Topsin M 70WP, Cerexagri-Nisso LLC, King of Prussia, PA) was determined using a conidial germination assay as described previously (1). The majority of isolates (81.4%) were resistant; the rest were sensitive. Resistant isolates were found in all locations with some populations (Chesnee, McBee, and Lexington) revealing no sensitive isolates. Genomic DNA from 35 resistant isolates (representing all locations) and 10 sensitive isolates (from Chesnee, Monetta, and North Augusta, SC) was extracted, and the molecular basis of MBC fungicide resistance was determined as described previously (2). All MBC-resistant isolates possessed the E198A mutation known to confer high levels of MBC fungicide resistance in many fungi, including B. cinerea (2,3). Disease was assessed using a detached strawberry fruit assay. Commercially grown strawberry fruit (24 in total for each isolate and fungicide treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water or 2.4 g/liter of Topsin M to runoff using a hand mister. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of a conidial suspension (106 spores/ml) of either a sensitive or resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolate developed gray mold disease in untreated but not Topsin M-treated fruit. The resistant isolate developed gray mold disease of equal severity in both, the control and fungicide-treated fruit. This experiment was repeated once. The results of the study show that resistance to MBC fungicides is common and widespread in B. cinerea from strawberry in South Carolina. Prior to this study, resistance to MBCs has only been reported in B. cinerea from ornamental crops grown in greenhouses in South Carolina (4). References: (1) J. E. Luck and M. R. Gillings. Mycol. Res. 99:1483, 1995. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011. (3) O. Yarden and T. Katan. Phytopathology 83:1478, 1993. (4) L. F. Yourman and S. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Botrytis Leaf Blight and Fruit Rot on Schisandra chinensis Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-02-11-0086 ◽

2011 ◽

Vol 95 (6) ◽

pp. 769-769

Author(s):

R. H. Yu ◽

J. Gao ◽

J. Wang ◽

X. Wang

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Leaf Blight ◽

Jilin Province ◽

Fruit Rot ◽

Conidial Suspension ◽

Schisandra Chinensis ◽

Mycelium Growth ◽

First Report

Schisandra (Schisandra chinensis (Turcz.) Baill) is a perennial plant belonging to Magnoliaceae. It is a very important medicinal herb in China and is mainly used for treatment of insomnia and memory decay. From July to September 2008, an unknown leaf blight and fruit rot on schisandra were first observed at Jingyu County, Jilin Province. The same symptoms were detected in other areas of Jilin Province, such as Ji'an City, Baishan City, and Hunchun City. Initially, some small, brown spots appeared on the tip or margin of the leaves. Light brown or brown necrotic lesions developed and eventually covered entire leaves. Seriously affected leaves were rolled or distorted and eventually became completely dry and brittle. Small spots appeared on the surface of mature fruits, coalesced, and the fruits finally dropped. Gray mycelia and conidiophores developed on the diseased leaves and fruits. To isolate the causal agent, conidia and conidiophores were scraped aseptically from the internal tissues, suspended in sterile water, and streaked onto the surface of potato dextrose agar (PDA). Single-hyphal tips were transferred on PDA and the isolated fungus was identified as Botrytis cinerea Pers.: Fr. on the basis of its morphological characteristics and internal transcribed spacer (ITS) sequence. Colonies of B. cinerea on PDA were colorless at first and became gray to brown 20 days later with the mycelium growth and conidia producing in cultures. Conidia are single celled, lemon shaped, colorless to a light color, and 4.4 to 15.0 × 7.0 to 10.0 μm. Sclerotia formed about 1 week later, were black-brown and varied in size (2.0 to 5.0 × 2.0 to 4.0 mm) and shape. The ITS region of rDNA was amplified from DNA extracted from single-spore isolate BC12 of B. cinerea using primers ITS4/ITS5 and sequenced (GenBank Accession No. GU724512), BLAST analysis (1) of the 535-bp segment showed 99% similarity with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). Pathogenicity tests were carried out on healthy schisandra plants that were 4 years old. After the surface of the leaves and fruits was disinfected with 5% sodium hypochlorite, a conidial suspension of 105 conidia/ml was sprayed on 10 schisandra leaves, and plugs of the fungus obtained from the colony margins were transferred onto a 3- × 3-mm wound on the surface of disinfected fruit. Ten control schisandra leaves and 10 fruits were inoculated at the same time. Plants were covered with polyethylene bags and incubated at 25°C in a greenhouse with relative humidity of 85% for 3 days. Similar symptoms to those observed on diseased leaves and fruits in the field were observed on inoculated schisandra leaves and fruits 7 days after inoculation, whereas control leaves and fruits showed no symptoms. The pathogen was successfully reisolated. The gray mold disease caused by B. cinerea was reported in many plants, such as Lavandula stoechas and Chamelaucium uncinatum in Italy (2,3). However, to our knowledge, this is the first report of gray mold disease of schisandra caused by B. cinerea in China. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. Garibaldi et al. Plant Dis. 94:968, 2009. (3) A. Garibaldi et al. Plant Dis. 94:380, 2010.

Download Full-text

First Report of Botrytis pseudocinerea Causing Gray Mold on Blueberry in North America

Plant Disease ◽

10.1094/pdis-06-14-0573-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1743-1743 ◽

Cited By ~ 16

Author(s):

S. Saito ◽

T. J. Michailides ◽

C. L. Xiao

Keyword(s):

North America ◽

Morphological Characteristics ◽

Gray Mold ◽

Postharvest Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Genetic Characteristics ◽

First Report ◽

Group I ◽

Pcr Rflp

Botrytis cinerea has previously been shown to consist of two sibling species, referred to as Group I and Group II, that can be differentiated by PCR-RFLP analysis of the Bc-hch gene, a vegetative incompatibility locus (1). Group I has recently been described as a new cryptic species, B. pseudocinerea (4). Gray mold caused by B. cinerea is a major postharvest disease of blueberries in the Central Valley of California. In 2012 and 2013, blueberry fruit were sampled at harvest from various locations in the region and stored at 0 to 1°C for 5 weeks, and fungi were isolated from decayed fruit. In total, 526 isolates of Botrytis spp. were obtained. Genomic DNA was extracted and PCR-RFLP of a fragment of the Bc-hch gene was performed. Four isolates showed the distinctive restriction band pattern associated with Group I (1). The identity of these four isolates was further investigated by sequencing portions of four genes: internal transcribed spacer region, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPBII), using the primers described previously (3,4). Sequences were deposited in GenBank (Accession Nos. KJ796643 to 58). BLAST analysis showed that sequences of all four genes for the four isolates were 99.8 to 100% similar to those of B. pseudocinerea. Morphological characteristics of the four blueberry isolates were examined as described previously (4). On potato dextrose agar, colonies were gray; the mycelial growth rate was 26 mm/day at 19°C in the dark. Conidiophores were simple and erect, and conidia were borne in grapelike clusters, one celled, hyaline, elliptical to ovoid, 6.5 to 15.7 × 5.6 to 9.8 μm (average of 7.4 × 10.1 μm). As reported previously, none of the morphological characters was able to differentiate between B. cinerea and B. pseudocinerea (4). To test pathogenicity, freshly harvested organic blueberry fruits were treated with 0.5% sodium hypochlorite for 2 min, rinsed with sterile water, wounded using a sterile needle, and inoculated by placing 1 μl of a conidial suspension (1.0 × 105 spores/ml) from each isolate into the wound with a pipette. Inoculated fruit (10 for each isolate) were incubated at 20°C for 5 days in the dark. Experiments were performed twice. All inoculated fruit developed rot, and no decay was observed on the noninoculated controls. All four isolates of B. pseudocinerea were pathogenic, and the fungus was re-isolated from decayed fruit. B. pseudocinerea isolates are known to be naturally insensitive to fenhexamid (1,4). Sensitivity of the four isolates to fenhexamid was examined in vitro as previously described (4). The EC50 values for fenhexamid for the four isolates ranged from 7.7 to 9.9 μg/ml and isolates were considered resistant to fenhexamid (1,4). Based on the morphological, physiological, and genetic characteristics, the four blueberry isolates were identified as B. pseudocinerea. It appeared that this species was present at very low frequency (0.76%) in blueberry fields in California. Previously, B. pseudocinerea has been reported from French, German, and New Zealand vineyards (1,2,4). To our knowledge, this is the first report of B. pseudocinerea causing gray mold in blueberry in California and in North America. References: (1) E. Fournier et al. Mycologia 95:251, 2003. (2) P. R. Johnston et al. Plant Pathol. 63:888, 2014. (3) M. Staats et al. Mol. Biol. Evol. 22: 333, 2005. (4) A.-S. Walker et al. Phytopathology 101:1433, 2011.

Download Full-text

Screening of Durum Wheat (Triticum turgidum L. subsp. durum (Desf.) Husn.) Italian Cultivars for Susceptibility to Fusarium Head Blight Incited by Fusarium graminearum

Plants ◽

10.3390/plants10010068 ◽

2020 ◽

Vol 10 (1) ◽

pp. 68

Author(s):

Gaetano Bentivenga ◽

Alfio Spina ◽

Karim Ammar ◽

Maria Allegra ◽

Santa Olga Cacciola

Keyword(s):

Durum Wheat ◽

Fusarium Head Blight ◽

Fusarium Graminearum ◽

Triticum Turgidum ◽

Disease Incidence ◽

Morphological Characteristics ◽

Pcr Amplification ◽

Conidial Suspension ◽

Head Blight ◽

Italian Origin

In 2009, a set of 35 cultivars of durum wheat (Triticum turgidum L. subsp. durum (Desf.) Husn.) of Italian origin was screened for fusarium head blight (FHB) susceptibility at CIMMYT (Mexico) and in the 2019–20 cropping season, 16 of these cultivars, which had been included in the Italian National Plant Variety Register, were tested again in southern and northern Italy. Wheat cultivars were artificially inoculated during anthesis with a conidial suspension of Fusarium graminearum sensu lato using a standard spray inoculation method. Inoculum was a mixture of mono-conidial isolates sourced in the same areas where the trials were performed. Isolates had been characterized on the basis of morphological characteristics and by DNA PCR amplification using a specific primer set and then selected for their virulence and ability to produce mycotoxins. The susceptibility to FHB was rated on the basis of the disease severity, disease incidence and FHB index. Almost all of the tested cultivars were susceptible or very susceptible to FHB with the only exception of “Duprì”, “Tiziana” and “Dylan” which proved to be moderately susceptible. The susceptibility to FHB was inversely correlated with the plant height and flowering biology, the tall and the late heading cultivars being less susceptible.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

Characterization of Botrytis cinerea Isolates from Strawberry with Reduced Sensitivity to Polyoxin D Zinc Salt

Plant Disease ◽

10.1094/pdis-02-16-0166-re ◽

2016 ◽

Vol 100 (10) ◽

pp. 2057-2061 ◽

Cited By ~ 5

Author(s):

Madeline E. Dowling ◽

Meng-Jun Hu ◽

Linus T. Schmitz ◽

Jennifer R. Wilson ◽

Guido Schnabel

Keyword(s):

United States ◽

South Carolina ◽

Botrytis Cinerea ◽

Tomato Fruit ◽

Resistance Management ◽

The United States ◽

Gray Mold ◽

Zinc Salt ◽

Malt Extract ◽

Action Committee

Polyoxin D is a Fungicide Resistance Action Committee (FRAC) code 19 fungicide that was recently registered for gray mold control of strawberry in the United States. In this study, we determined the sensitivity to polyoxin D zinc salt (hereafter, polyoxin D) of Botrytis cinerea isolates from 41 commercial strawberry farms in South Carolina, North Carolina, Maryland, Virginia, and Ohio and investigated the fitness of sensitive (S) and reduced sensitive (RS) isolates. Relative mycelial growth ranged between 0 and over 100% on malt extract agar amended with a discriminatory dose of polyoxin D at 5 μg/ml. Isolates that grew more than 70% at that dose were designated RS and were found in three of the five states. The 50% effective dose (EC50) values of three S and three RS isolates ranged from 0.59 to 2.27 and 4.6 to 5.8 μg/ml, respectively. The three RS isolates grew faster on detached tomato fruit treated with Ph-D WDG at recommended label dosage than S isolates (P < 0.008). In all, 25 randomly selected RS isolates exhibited reduced sporulation ability (P < 0.0001) and growth rate (P < 0.0001) but increased production of sclerotia (P < 0.0386) compared with 25 S isolates. Of 10 isolates tested per phenotype, the number of RS isolates producing sporulating lesions on apple, tomato, and strawberry was significantly lower compared with S isolates (P < 0.0001 for each fruit type). The results of this study indicate that resistance management is necessary for fungicides containing polyoxin D. To our knowledge, this is the first study demonstrating reduced sensitivity to FRAC 19 fungicides in B. cinerea isolates from the United States.

Download Full-text