First Report of Gray Mold of Blackberry Caused by Botrytis cinerea in South Carolina

Botrytis cinerea Pers.: Fr. is a causal agent of gray mold of blackberry but may also affect grapevine, tomato, bulb flowers, and ornamental crops (2). In August 2010, blackberries (Rubus fruticosus and other species) showing gray mold symptoms were found in Longcreek, Six Mile, and Cheddar, SC. Symptomatic blackberry fruit exhibited patterns of brown-to-gray mycelia and conidiophores. Upon isolation, the mycelium grew at a rate of 12.3 mm per day at 22°C on potato dextrose agar, forming pale white-to-gray colonies with concentric rings and conidiophores (less than 12 h of fluorescent light per day). Some isolates formed dark brown sclerotia in the dark after 18 days. The lemon-shaped spores averaged 12 × 9 μm and were consistent with descriptions of B. cinerea. (1) The ribosomal internal transcribed spacer (ITS) ITS1-5.8S-ITS2 region was amplified via PCR from genomic DNA obtained from mycelia using primers ITS1 and ITS4. A BLAST search in GenBank revealed highest similarity (99 to 100%) to sequences from various Botrytis spp. collected in China, Canada, and Spain (GenBank Accession Nos. FJ169666.1, GU934505.1, and EF207414.1). The ITS sequence amplified from the blackberry isolate was submitted to GenBank (Accession No. JN164269). The pathogen was further identified to the species level as B. cinerea using glyceraldehyde-3-phosphate dehydrogenase, heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) gene sequences (2) (GenBank Accession Nos. JN164270, JN164271, JN164272). Pathogenicity was confirmed by inoculating three surface-sterilized (soaked in 5% bleach for 15 min), mature blackberry fruit (R. fruticosus) with a conidial suspension (105 spores/ml) of the blackberry isolate. A 20-μl droplet was placed on the fruit; control fruit received sterile water without conidia. After 5 days of incubation at room temperature in an air-tight Magenta box, the inoculated fruit developed typical signs and symptoms of gray mold. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. To our knowledge, this is the first report of B. cinerea on blackberry in South Carolina. The disease must be managed with fungicides to obtain high quality fruit with market-requested shelf life. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 17, 2011. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea from a Blackberry Field in Georgia

Plant Disease ◽

10.1094/pdis-10-13-1020-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 848-848 ◽

Cited By ~ 6

Author(s):

D. Fernández-Ortuño ◽

A. Grabke ◽

P. K. Bryson ◽

E. D. Beasley ◽

L. A. Fall ◽

...

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Crop Protection ◽

The United States ◽

Gray Mold ◽

Resistant Isolate ◽

Malt Extract ◽

First Report ◽

Control Fruit ◽

Lesion Diameter

Botrytis cinerea Pers. is an important plant-pathogenic fungi responsible for gray mold on more than 230 plant species worldwide, including blackberry (Rubus). One of the main strategies to control the disease involves the application of different classes of fungicides. The phenylpyrrole fludioxonil is currently marketed in combination with the anilinopyrimidine cyprodinil as Switch 62.5WG (Syngenta Crop Protection Inc., Greensboro, NC) for gray mold control. In August 2013, blackberries affected with symptoms resembling gray mold were collected from a field located in Berrien County (Georgia), where Switch 62.5WG had been used extensively over the last 5 years. Three single-spore isolates, each from a different fruit, were obtained and identified as B. cinerea on the basis of morphology and confirmed by a 238-bp PCR amplification product obtained with primer set G3PDH-F1 (5′-GGACCCGAGCTAATTTATGTCACGT-3′), G3PDH-F2 (5′-GGGTGTCAACAACGAGACCTACACT-3′), and G3PDH-R (5′-ACCGGTGCTCGATGGGATGAT-3′). In vitro sensitivity to fludioxonil (Scholar SC, Syngenta) was determined on 1% malt extract agar (MEA) using a conidial germination assay as previously described (4). One isolate was moderately resistant due to growth on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and residual growth at 10 μg/ml (4). To assess performance of fludioxonil in detached fruit assays, commercially grown strawberries (24 in total for each isolate and treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water (control fruit) or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Scholar SC was used because fludioxonil was the sole active ingredient in this product and strawberries were used because latent infections in fresh blackberry fruit interfered with inoculation experiments. This dose reflects the rate recommended for postharvest gray mold control according to the Scholar label. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of the two sensitive or the resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolates developed gray mold on non-treated (2.7 cm lesion diameter) but not on Scholar SC-treated fruit (0.0 cm lesion diameter). The resistant isolate developed gray mold disease on the water-treated control fruit (2.5 cm lesion diameter) and the fungicide-treated fruit (1.8 cm lesion diameter). EC50 values were determined in microtiter assays as described previously (3) using the concentrations of 0.01, 0.04, 0.12, 0.37, 1.1, 3.3, and 10 μg/ml fludioxonil. Values were 0.02 and 0.05 μg/ml for the two sensitive isolates and 3.15 μg/ml for the resistant isolate. All experiments were performed twice. This is the first report of fludioxonil resistance in B. cinerea from blackberry in Georgia. Prior to this study, resistance to fludioxonil in B. cinerea was reported in France, Germany, and only a few states in the United States including Maryland, South Carolina, Virginia, and Washington (1,2). The emergence of resistance to fludioxonil emphasizes the importance of resistance management strategies. References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 98:692, 2013. (3) M. Kretschmer et al. PLOS Pathog. 5:e1000696, 2009. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Gray Mold of Strawberry Caused by Botrytis cinerea in South Carolina

Plant Disease ◽

10.1094/pdis-06-11-0529 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1482-1482 ◽

Cited By ~ 4

Author(s):

D. Fernández-Ortuño ◽

X. Li ◽

W. Chai ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Species Identification ◽

Morphological Characteristics ◽

Pcr Amplification ◽

Gray Mold ◽

Tween 20 ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Control Fruit

Gray mold caused by Botrytis spp. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. From April to June 2011, strawberries with symptoms resembling gray mold disease were collected from different locations (Chesnee, Florence, Lexington, McBee, Monetta, and North Augusta) in South Carolina. Fruit infections began as small, firm, light brown lesions that enlarged quickly, becoming covered with a gray, fuzzy mass of spores followed by a soft rot. To isolate the causal agent, spores from symptomatic fruit were suspended in 1% Tween 20, streaked onto the surface of potato dextrose agar plates, and incubated at 22°C. Fungal colonies from single spores were at first colorless and later became gray to brown when the conidiphores and conidia developed. Conidia were identified by their morphological characteristics: an average size of 14 × 9 μm, ellipsoid to rounded without internal structure, and with a scar on the point of union to the conidiophore (1). Sclerotia produced in culture were hard, dark, irregular shaped, and formed after 2 weeks. The pathogen was identified as Botrytis cinerea Pers.: on the basis of morphology and confirmed by a restriction digest with ApoI of the 413-kb PCR amplification product obtained with BA2f/BA1r primers (2). Koch's postulates were conducted by inoculating 10 surface-sterilized strawberries with a conidial suspension (105 spores/ml) of a randomly chosen B. cinerea isolate previously characterized; 10 control fruit received sterile water without conidia. The inoculated fruit were incubated for 3 days at room temperature in air-tight plastic bags. Inoculated fruit developed typical gray mold symptoms with gray sporulating lesions. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. For many Botrytis spp., the internal transcribed spacer region does not reveal nucleotide variations and thus is useless for species identification. We used additional, more appropriate genetic markers for molecular-based species identification and verified that strawberries in South Carolina are affected by gray mold disease caused by B. cinerea. To our knowledge, this is the first scientific report of B. cinerea causing gray mold of strawberry in South Carolina. References: (1) W. R. Jarvis. Botryotinia and Botrytis Species: Taxonomy, Physiology and Pathogenicity. A Guide to the Literature. Monograph no. 15. Canada Department of Agriculture, Research Branch, Ottawa, 1977. (2) K. Nielsen et al. Plant Dis. 86:682, 2002.

Download Full-text

First Report of Post-Harvest Gray Mold on Hyacinth bean (Lablab purpureus) Caused by Botrytis cinerea in Korea

Plant Disease ◽

10.1094/pdis-03-21-0457-pdn ◽

2021 ◽

Author(s):

Md Aktaruzzaman ◽

Tania Afroz ◽

Sung Kee Hong ◽

Byung Sup Kim ◽

Hyo-Won Choi

Keyword(s):

Botrytis Cinerea ◽

Petri Dish ◽

Gray Mold ◽

Distilled Water ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Lablab Purpureus ◽

First Report ◽

Post Harvest ◽

Hyacinth Bean

Hyacinth bean (Lablab purpureus L.) is a highly proteineous legume under the family Fabaceae. It is native to Africa, cultivated throughout the world, and recently introduced vegetable in Korea. In April 2020, approximately 10 to 15% of the total harvested pods showed gray mold rot symptoms after 3–5 days of storage at 4 °C in Jeonju, Jeonbuk province, Korea. The symptoms observed were irregular, water-soaked spots become brown or gray with white hyphae were appeared on the infected pods. Diseased tissue was excised, and surface sterilized by immersing in 1% sodium hypochlorite (NaOCl) for 1 min, rinsed three times with sterilized distilled water, placed on potato dextrose agar (PDA) plates, and incubated at 20 ± 2°C for 7 days. A total of five morphologically similar fungal isolates (HBGM001 to HBGM005) were obtained from diseased samples; isolate HBGM002 and HBGM005 were selected for identification. The fungus produced initially white colonies, after 7 days it changes to gray to dark colonies with dark mycelium that sporulated abundantly on PDA at 20ºC. The conidia (n = 50) were single-celled, ellipsoid or ovoid in shape, and 6.11 to 13.9 × 4.8 to 9.4 μm in size for HBGM001 isolate and 5.81 to 14.1× 4.5 to 9.6 μm in size for HBGM005. Conidiophores (n = 15) arose solitary or in groups, straight or flexuous, septate, with an inflated basal cell brown to light brown, and measured 103 to 420× 7 to 25 μm for HBGM001 isolate and 101 to 415 × 5 to 23 μm for HBGM005 isolate. After two weeks, the fungus formed several black sclerotia (n = 20) ranging from 0.5 to 4.2 × 0.5 to 3.4 mm for HBGM001 isolate and 0.4 to 4.4 × 0.3 to 3.3 mm for HBGM005 isolate near the edge of the Petri dish. Morphological characters were consistent with those of Botrytis cinerea Pers.: Fr. (Ellis 1971). As for molecular identification, the internal transcribed spacer (ITS) and three nuclear protein-coding genes (glyceraldehydes-3-phosphate dehydrogenase gene [G3PDH], heat-shock protein 60 gene [HSP60], and DNA-dependent RNA polymerase subunit gene [RPB2]) were amplified using primer pairs ITS1/ITS4 (White et al. 1990), G3PDH-F/G3PDH-R, HSP60-F/HSP60-R, and RPB2-F/RPB2-R (Staats et al. 2005), respectively. The ITS, G3PDH, HSP60, and RPB2 sequences of HBGM002 and HBGM005 isolates (GenBank accession number MT439648 and MT968495 for ITS; MT439649 and MT968496 for G3PDH; MT439650 and MT968497 for HSP60; MT439651 and MT968498 for RPB2 respectively) were 99% to 100% identical to those of B. cinerea (KY364366, KF015583, KJ018758, and KJ018756, respectively). To determine pathogenicity, five disinfected pods were pinpricked (3 sites per pod) with sterile needles and 50 µl of conidial suspension (1 × 105 conidia/ml) was inoculated by pipetting into the wounds. An analogous five pods, serving as controls, were inoculated with sterile distilled water. All the pods were placed in a growth chamber and maintained a temperature of 20±2ºC and a relative humidity >80%. After 5 days, gray mold symptoms developed on the inoculated pods, whereas no symptoms appeared on control pods. The pathogen was re-isolated from the inoculated pods, fulfilling Koch’s postulates. B. cinerea has been reported causing gray mold in Hyacinth bean in China, Taiwan and India (Farr and Rossman 2021). To our knowledge, this is the first report of B. cinerea causing post-harvest gray mold on hyacinth bean in Korea. The disease could represent a threat for hyacinth bean post-harvest and storage and management strategies should be investigated and applied.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Gray Mold Disease of Sponge Gourd (Luffa cylindrica) Caused by Botrytis cinerea in Taiwan

Plant Disease ◽

10.1094/pdis-91-9-1199a ◽

2007 ◽

Vol 91 (9) ◽

pp. 1199-1199 ◽

Cited By ~ 2

Author(s):

Y. Ko ◽

K. S. Yao ◽

C. Y. Chen ◽

C. H. Lin

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

Spore Suspension ◽

Fluorescent Light ◽

Distilled Water ◽

Luffa Cylindrica ◽

First Report ◽

Sponge Gourd ◽

Plastic Bag ◽

Central Taiwan

A disease of sponge gourd (Luffa cylindrica (L.) Roem., family Cucurbitaceae) has become a serious threat to sponge gourd production since 2003 in central Taiwan. Initially, symptoms appear as small, brown spots on the flower petals that spread to the entire flower and cause blossom blight within 2 to 3 days. Subsequently, the pathogen develops abundant mycelium and moves from the petals onto the fruits causing blossom end rot and fruit stem rot. Severely infected fruits become completely rotten and desiccate. Tissues were excised from diseased sponge gourd fruits (sampled from Fongyuan, located at 24.25°N, 120.72°E in Taichung County), immersed in a solution containing 3% sodium hypochlorite and 70% ethanol for 1 min, washed three times with sterile water, and then cultured on potato dextrose agar (PDA) medium. A fungus, identified as Botrytis cinerea, produced abundant mycelium on PDA medium when incubated under constant fluorescent light 185 ± 35 μE·m–2·s–1 at 24°C. The conidia were smooth, hyaline, and globoid or slightly ellipsoid. The conidia measured 9.5 to 19.3 μm (average 13.8 μm) long and 6.0 to 17.8 μm (average 10.1 μm) wide, dimensions that are similar to the descriptions of B. cinerea (11 × 11 to 15 μm) that causes gray mold of strawberry (2). The identity of B. cinerea was also confirmed by the production of numerous black sclerotia on PDA plates incubated either in the dark or under light at 20 to 24°C for 9 to 10 days. Koch's postulates were fulfilled by using 3-day-old mycelial agar discs of the fungus or a spore suspension containing 105 conidia per milliliter of distilled water as inoculum. Shallow (2 × 2 × 2 mm) incisions were made on fresh sponge gourd fruits with a sterile scalpel and inoculated with either a 5-mm mycelial disc or 0.5 ml of the spore suspension. Inoculated areas were covered with moist sterile cotton, and the fruits were enclosed in a plastic bag and incubated at 20 to 24°C for 3 days. Wounded fruits inoculated with PDA discs or sterile distilled water alone served as controls. Pathogenicity tests were performed three times using five fruits in each trial. Symptoms and signs of the disease similar to those described above were observed in all (100%) the inoculated fruits, while no symptoms developed in the control fruits. Reisolation from the inoculated fruits consistently yielded B. cinerea. Reciprocal inoculations on sponge gourd, guava, and strawberry with mycelial discs or spore suspensions of a B. cinerea isolate obtained from sponge gourd, guava, and strawberry showed cross pathogenicity among isolates and hosts. Important groups of plants that are attacked by B. cinerea are vegetables, small berry fruits, ornamentals, and bulbs (1). Though 80 species of host plants, mostly shrubs and nursery plants, were reported to be the host of B. cinerea in Taiwan (3), to our knowledge, this is the first report of gray mold disease affecting sponge gourd in Taiwan. References: (1) G. N. Agrios. Plant Pathology. Academic Press. San Diego, 2005. (2) J. L. Mass, ed. Page 56 in: Compendium of Strawberry Diseases. The American Phytopathological Society. St. Paul, MN, 1984. (3). Y. Ko et al. Plant Prot. Bull. (Taiwan) 37:439, 1995.

Download Full-text

Pathogenic Capacity of Botrytis cinerea on Leaves of Pyrus mamorensis, an Endemic Tree of Mamora Forest in Morocco

Atlas Journal of Biology ◽

10.5147/ajb.v2i2.159 ◽

2017 ◽

Vol 2 (2) ◽

pp. 125-129

Author(s):

Zineb Sellal ◽

Jamila Dahmani ◽

Rachid Benkirane ◽

Amina Ouazzani Touhami ◽

Allal Douira

Keyword(s):

Botrytis Cinerea ◽

Disease Severity ◽

Filter Paper ◽

Pathogenic Fungus ◽

Gray Mold ◽

Conidial Suspension ◽

First Report ◽

Conidia Production

A survey in the Mamora forest was done in the spring of 2010 and revealed that 67% of buds and 27% of leaves of Pyrus mamorensis (Trabut) samples collected had lesions with a gray felting. The pathogenic fungus was identified as Botrytis cinerea by the filter – paper technic. Koch´s postulate was verified by inoculating healthy leaves. The estimated disease severity on P. mamorensis leaves was respectively 75.56% and 68.81% for inoculation by conidial suspension and the mycelial disks. Conidia production of Botrytis cinerea on inoculated leaves by conidial suspension was 1.03.105 conidia.cm-2 and by mycelial disks was 0.60.105 conidia.cm-2. This was the first report of gray mold disease of Mamora pear caused by Botrytis cinerea in Morocco.

Download Full-text

First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽

10.1094/pdis-07-11-0543 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1481-1481

Author(s):

F. P. Chen ◽

X. L. Liu ◽

X. P. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Disease Incidence ◽

Gray Mold ◽

Resistant Isolate ◽

Cross Resistance ◽

Broad Host Range ◽

Paper Strip ◽

Single Spore ◽

First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea, the Causal Agent of Gray Mold, from Strawberry Fields in Maryland and South Carolina

Plant Disease ◽

10.1094/pdis-08-13-0875-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 692-692 ◽

Cited By ~ 8

Author(s):

D. Fernández-Ortuño ◽

A. Grabke ◽

P. K. Bryson ◽

R. J. Rouse ◽

P. Rollins ◽

...

Keyword(s):

United States ◽

South Carolina ◽

Botrytis Cinerea ◽

Crop Protection ◽

The United States ◽

Gray Mold ◽

Causal Agent ◽

First Report ◽

Lesion Diameter

Botrytis cinerea Pers. is the causal agent of gray mold and one of the most economically important plant-pathogenic fungi affecting strawberry (Fragaria × ananassa). Control of gray mold mainly depends on the use of site-specific fungicides, including the phenylpyrrole fludioxonil. This fungicide is currently registered in combination with cyprodinil in form of Switch 62.5WG (Syngenta Crop Protection, Greensboro, NC) for gray mold control of small fruits in the United States. In June 2013, strawberries affected with symptoms resembling gray mold were observed despite the application of Switch in one field located in Federalsburg, MD, and one located near Chesnee, SC. Ten single-spore isolates, each from a different fruit, were obtained from each location and confirmed to be B. cinerea using cultural and molecular tools as described previously (3). In vitro sensitivity to fludioxonil (Scholar SC, 20.4% [v/v] active ingredient, Syngenta Crop Protection, Greensboro, NC) was determined using a conidial germination assay as previously described (4). Eight of the 20 isolates (six from Maryland and two from South Carolina) were moderately resistant to fludioxonil, i.e., they grew on medium amended with 0.1 μg/ml fludixonil and showed residual growth at 10 μg/ml (4). The in vitro assay was repeated obtaining the same results. To assess in vivo sensitivity on fungicide-treated fruit, commercially grown strawberries were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of either two sensitive or four resistant isolates (two isolates from Maryland and two isolates from South Carolina). Each isolate/treatment combination consisted of 24 mature but still firm strawberry fruit with three 8-fruit replicates. The fruit were kept at 22°C and lesion diameters were measured after 4 days of inoculation. The sensitive isolates developed gray mold symptoms on nontreated (2.5 cm lesion diameter) but not on Scholar SC-treated fruit. The resistant isolates developed gray mold on both, the water-treated control (2.3 cm lesion diameter), and the fungicide-treated fruit (1.8 cm lesion diameter). The experiment was performed twice. To our knowledge this is the first report of fludioxonil resistance in B. cinerea from strawberry fields in Maryland and South Carolina. Resistance to fludioxonil is still rare in the United States and has only been reported in B. cinerea isolates from a Virginia strawberry field (1). The increase in occurrence of resistance to fludioxonil may be a result of increased use of Switch following reports of resistance to other chemical classes in this pathogen in southern strawberry fields (2). References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 96:1198, 2012. (3) D. Fernández-Ortuño et al. Plant Dis. 95:1482, 2011. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Gray Mold in Tomato Caused by Botrytis cinerea in Baja California, Mexico

Plant Disease ◽

10.1094/pd-89-0528b ◽

2005 ◽

Vol 89 (5) ◽

pp. 528-528 ◽

Cited By ~ 1

Author(s):

R. J. Holguín-Peña ◽

F. G. Arcos

Keyword(s):

Botrytis Cinerea ◽

Baja California ◽

Polymerase Chain Reaction Amplification ◽

Random Amplified Polymorphic Dna ◽

Gray Mold ◽

Malt Extract ◽

Conidial Suspension ◽

Sterile Water ◽

Tomato Production ◽

First Report

San Quintin Valley, a 60-mile-long coastal plain (30°30′N, 116°W) in the Baja California Peninsula, is one of the major fresh tomato (Lycopersicon esculentum Mill.) production areas in Mexico with more than 8,000 ha. During the last 10 years, the valley's tomato production has declined because of gray mold and stem canker diseases. Flower rot, reddish brown margins on the leaves and stems, and fruit with a gray mold were observed on field-grown tomato plants (Roma type cv. Tequila) in the autumn of 2003. Severity ranging from 55 to 60% was observed at harvest. Infected tissues were sampled and disinfested by immersion in 1% NaOCl for 1 min, rinsed in sterile water, and placed on malt extract agar at 22°C. Fungal conidia were then transferred to 2% potato dextrose agar (PDA). The resulting fungal colonies were definitively identified as Botrytis cinerea Pers.:Fr. The colonies of B. cinerea were first hyaline and white and became dark gray after 96 h. Mycelia were septate with dark branched conidiophores. Conidia were unicellular, ellipsoid, and ranged from 5 to 8 × 8 to 14 μm. Profuse black sclerotia developed in 7-day-old cultures. Infection site analyses in diseased flowers at different stages during the bloom were done with scanning electron microscopy. Fungal hyphae were located predominantly on the receptacle areas, whereas conidia were located in the ovaries as described previously (3). The identity of B. cinerea was confirmed by a restriction digest with ApoI of the 413-kb polymerase chain reaction amplification product obtained with BA2f/BA1r primers (1) and random amplified polymorphic DNA banding patterns (2). Pathogenicity tests were done by spray inoculation of 1-ml aqueous conidial suspension (106 CFU/ml) on 20 healthy plants during the blossom stage. An equal number of plants sprayed with sterile water was used as the control. Plants were incubated at 20 ± 2°C for 5 days. The fungus was reisolated from diseased flowers and peduncles after surface disinfestation (2.5% NaOCl) and plating on PDA. No symptoms were observed in the noninoculated controls. To our knowledge, this is the first report of B. cinerea causing gray mold disease on tomato in Baja California. References: (1) K. Nielsen et al. Plant Dis. 86:682, 2002. (2) S. Rigotti et al. FEMS Microbiol. Lett. 209:169, 2002. (3) O. Viret et al. Phytopathology 94:850, 2004.

Download Full-text