Relative Host Resistance to Black Spot Disease in Field Pea (Pisum sativum) is Determined by Individual Pathogens

Black spot, also known as Ascochyta blight, is the most important disease on field pea (Pisum sativum). It is caused by a complex of pathogens, the most important of which in Australia include Didymella pinodes, Phoma pinodella, and P. koolunga. The relative proportions of these and other component pathogens of the complex fluctuate widely across time and geographic locations in Australia, limiting the ability of breeders to develop varieties with effective resistance to black spot. To address this, 40 field pea genotypes were tested under controlled environment conditions for their individual stem and leaf responses against these three pathogens. Disease severity was calculated as area under disease progress curve (AUDPC), and subsequently converted to mean rank (MR). The overall rank (OR) for each pathogen was used to compare response of genotypes under inoculation with each pathogen. The expressions of host resistance across the field pea genotypes were largely dependent upon the individual test pathogen and whether the test was on stem or leaf. Overall, P. koolunga caused most severe stem disease; significantly more severe than either D. pinodes or P. pinodella. This is the first report of the host resistance identified in field pea to P. koolunga; the five genotypes showing highest resistance on stem, viz. 05P778-BSR-701, ATC 5338, ATC 5345, Dundale, and ATC 866, had AUDPC MR values <250.4, while the AUDPC MR values of the 19 genotypes showing the best resistance on leaf was less than 296.8. Two genotypes, ATC 866 and Dundale, showed resistance against P. koolunga on both stem and leaf. Against D. pinodes, the four and 16 most resistant genotypes on stem and leaf had AUDPC MR values <111.2 and <136.6, respectively, with four genotypes showing resistance on both stem and leaf including 05P770-BSR-705, Austrian Winter Pea, 06P822-(F5)-BSR-6, and 98107-62E. Against P. pinodella, four and eight genotypes showing the best resistance on stem and leaf had AUDPC MR values <81.3 and <221.9, respectively; three genotypes, viz. 98107-62E, Dundale, and Austrian Winter Pea showed combined resistance on stem and leaf. A few genotypes identified with resistance against two major pathogens of the complex will be of particular significance to breeding programs. These findings explain why field pea varieties arising from breeding programs in Australia fail to display the level or consistency of resistance required against black spot and why there needs to be a wider focus than D. pinodes in breeding programs.

Download Full-text

Temporal and Spatial Changes in the Pea Black Spot Disease Complex in Western Australia

Plant Disease ◽

10.1094/pdis-08-13-0806-re ◽

2014 ◽

Vol 98 (6) ◽

pp. 790-796 ◽

Cited By ~ 10

Author(s):

Hieu Sy Tran ◽

Yu Pin Li ◽

Ming Pei You ◽

Tanveer N. Khan ◽

Ian Pritchard ◽

...

Keyword(s):

Western Australia ◽

Host Resistance ◽

Ascochyta Blight ◽

Black Spot ◽

Geographic Location ◽

Pathogenic Fungi ◽

Spot Disease ◽

Disease Complex ◽

Didymella Pinodes ◽

Black Spot Disease

Black spot (also referred to as Ascochyta blight, Ascochyta foot rot and black stem, and Ascochyta leaf and pod spot) is a devastating disease of pea (Pisum sativum) caused by one or more pathogenic fungi, including Didymella pinodes, Ascochyta pisi, and Phoma pinodella. Surveys were conducted across pea-growing regions of Western Australia in 1984, 1987, 1989, 1996, 2010, and 2012. In total, 1,872 fungal isolates were collected in association with pea black spot disease symptoms. Internal transcribed spacer regions from representative isolates, chosen based on morphology, were sequenced to aid in identification. In most years and locations, D. pinodes was the predominant pathogen in the black spot complex. From 1984 to 2012, four new pathogens associated with black spot symptoms on leaves or stems (P. koolunga, P. herbarum, Boeremia exigua var. exigua, and P. glomerata) were confirmed. This study is the first to confirm P. koolunga in association with pea black spot symptoms in field pea in Western Australia and show that, by 2012, it was widely present in new regions. In 2012, P. koolunga was more prevalent than D. pinodes in Northam and P. pinodella in Esperance. P. herbarum and B. exigua var. exigua were only recorded in 2010. Although A. pisi was reported in Western Australia in 1912 and again in 1968 and is commonly associated with pea black spot in other states of Australia and elsewhere, it was not recorded in Western Australia from 1984 to 2012. It is clear that the pathogen population associated with the pea black spot complex in Western Australia has been dynamic across time and geographic location. This poses a particular challenge to development of effective resistance against the black spot complex, because breeding programs are focused almost exclusively on resistance to D. pinodes, largely ignoring other major pathogens in the disease complex. Furthermore, development and deployment of effective host resistance or fungicides against just one or two of the pathogens in the disease complex could radically shift the make-up of the population toward pathogen species that are least challenged by the host resistance or fungicides, creating an evolving black spot complex that remains ahead of breeding and other management efforts.

Download Full-text

Comparison of cultural growth and in planta quantification of Didymella pinodes, Phoma koolunga and Phoma medicaginis var. pinodella, causal agents of ascochyta blight on field pea (Pisum sativum)

Mycologia ◽

10.3852/11-118 ◽

2012 ◽

Vol 104 (1) ◽

pp. 93-101 ◽

Cited By ~ 11

Author(s):

J.A. Davidson ◽

M. Krysinska-Kaczmarek ◽

Herdina A. McKay ◽

E.S. Scott

Keyword(s):

Pisum Sativum ◽

Ascochyta Blight ◽

Field Pea ◽

In Planta ◽

Didymella Pinodes ◽

Phoma Medicaginis ◽

Phoma Koolunga

Download Full-text

Variation in pathogenicity among and within Mycosphaerella pinodes populations collected from field pea in Australia

Canadian Journal of Botany ◽

10.1139/b98-164 ◽

1998 ◽

Vol 76 (11) ◽

pp. 1955-1966 ◽

Cited By ~ 4

Author(s):

J M Wroth

Keyword(s):

Cluster Analysis ◽

Pisum Sativum ◽

Host Resistance ◽

Ascochyta Blight ◽

Mycosphaerella Pinodes ◽

Environment Interaction ◽

Pathogen Population ◽

Host Genotype ◽

Host Pathogen Interaction ◽

The Relationship

Ninety-nine single ascospore isolates of Mycosphaerella pinodes (Berk. & Blox.) Vestergr. from widely separated locations in southern Australia varied greatly in their ability to cause disease in leaves and stems of 10 host genotypes when assayed at two inoculum pressures. There were highly significant differences between the infection pressures, isolates, and host genotypes that accounted for most of the variance. A small proportion of the variance included a highly significant host genotype beta isolate interactions in leaves and stems and a highly significant host genotype beta isolate beta environment interaction in leaves. The continuous variation in disease responses among isolates precluded classification into distinct pathotypes. A cluster analysis of the data revealed that many isolates were closely related irrespective of the host cultivar or location from which they were collected. The relationship between mean host resistance and the variation among isolates was assessed, and it was concluded that increasing host resistance was unlikely to increase variation in the pathogen population; therefore, resistance should be relatively stable.Key words: Ascochyta blight, Pisum sativum, host-pathogen interaction, cluster analysis.

Download Full-text

Fungicidal control of ascochyta blight of field pea

Canadian Journal of Plant Science ◽

10.4141/cjps96-011 ◽

1996 ◽

Vol 76 (1) ◽

pp. 67-71 ◽

Cited By ~ 19

Author(s):

T. D. Warkentin ◽

K. Y. Rashid ◽

A. G. Xue

Keyword(s):

Pisum Sativum ◽

Key Words ◽

Untreated Control ◽

Seed Weight ◽

Ascochyta Blight ◽

Field Pea ◽

Mycosphaerella Pinodes ◽

Yield Increase ◽

Pisum Sativum L

The use of fungicides for the control of ascochyta blight in field pea was investigated. Four fungicides were applied to the cultivars AC Tamor and Radley at two locations in Manitoba in 1993 and 1994. Fungicides were applied either once, twice, or three times at 10-d intervals, beginning at the initiation of flowering. Chlorothalonil and benomyl were effective m reducing the severity of ascochyta blight and increasing the yield and seed weight of field pea. The triple application of chlorothalonil resulted in a mean yield increase of 33% over that of the untreated control. Iprodione and propiconazole were relatively ineffective in controlling ascochyta blight. The percentage of seedborne ascochyta was not significantly affected by fungicide treatments. The severity of ascochyta blight was greater in 1993 that in 1994, resulting in greater benefits of chlorothalonil and benomyl applications in 1993. Key words: Field pea, Pisum sativum L., ascochyta blight, Mycosphaerella pinodes, fungicide

Download Full-text

Cool-season grain legume improvement in Australia—Use of genetic resources

Crop and Pasture Science ◽

10.1071/cp13071 ◽

2013 ◽

Vol 64 (4) ◽

pp. 347 ◽

Cited By ~ 20

Author(s):

K. H. M. Siddique ◽

W. Erskine ◽

K. Hobson ◽

E. J. Knights ◽

A. Leonforte ◽

...

Keyword(s):

Genetic Resources ◽

Cropping Systems ◽

Ascochyta Blight ◽

Black Spot ◽

Field Pea ◽

Direct Result ◽

Mycosphaerella Pinodes ◽

Grain Legume ◽

Cool Season ◽

The Past

The cool-season grain legume industry in Australia, comprising field pea (Pisum sativum L.), chickpea (Cicer arietinum L.), faba bean (Vicia faba L.), lentil (Lens culinaris ssp. culinaris Medik.), and narrow-leaf lupin (Lupinus angustifolius L.), has emerged in the last 40 years to occupy a significant place in cropping systems. The development of all major grain legume crops—including field pea, which has been grown for over 100 years—has been possible through large amounts of genetic resources acquired and utilised in breeding. Initially, several varieties were released directly from these imports, but the past 25 years of grain legume breeding has recombined traits for adaptation and yield for various growing regions. Many fungal disease threats have been addressed through resistant germplasm, with varying successes. Some threats, e.g. black spot in field pea caused by Mycosphaerella pinodes (Berk. and Blox.) Vestergr., require continued exploration of germplasm and new technology. The arrival of ascochyta blight in chickpea in Australia threatened to destroy the chickpea industry of southern Australia, but thanks to resistant germplasm, it is now on its way to recovery. Many abiotic stresses including drought, heat, salinity, and soil nutritional toxicities continue to challenge the expansion of the grain legume area, but recent research shows that genetic variation in the germplasm may offer new solutions. Just as the availability of genetic resources has been key to successfully addressing many challenges in the past two decades, so it will assist in the future, including adapting to climate change. The acquisition of grain legume germplasm from overseas is a direct result of several Australians who fostered collaborations leading to new collection missions enriching the germplasm base for posterity.

Download Full-text

Genetic variation in stem strength in field pea (Pisum sativum L.) and its association with compressed stem thickness

Australian Journal of Agricultural Research ◽

10.1071/ar05210 ◽

2006 ◽

Vol 57 (2) ◽

pp. 193 ◽

Cited By ~ 11

Author(s):

C. P. Beeck ◽

J. Wroth ◽

W. A. Cowling

Keyword(s):

Genetic Variation ◽

Pisum Sativum ◽

Ascochyta Blight ◽

Testing Machine ◽

Quantitative Measure ◽

Field Pea ◽

Stem Diameter ◽

Breaking Point ◽

Stem Strength ◽

Pisum Sativum L

We assessed genetic variation in stem strength in field pea (Pisum sativum L.) using physical and biological measures in order to develop selection criteria for breeding programs. A diverse group of 6 pea genotypes was subjected to 2 levels of disease (ascochyta leaf and stem blight), high and low. Stem samples were tested for physical stem strength (load at breaking point and flexion) using a universal testing machine. Stem diameter and compressed stem thickness were measured as biological indicators of stem strength. The genotypes varied significantly in physical and biological measures of stem strength, and in resistance to ascochyta blight. Load at breaking point was strongly associated with compressed stem thickness but only weakly associated with stem diameter. Significant variation in compressed stem thickness was present among pea genotypes, supporting this as an inexpensive, reliable, and quantitative measure for use in the field. There was no variation in stem lignin content among genotypes. Ascochyta blight resistance and stem strength, as assessed by load, flexion, or compressed stem thickness, were independent traits (the main effects of disease level and genotype × disease level interactions for load, flexion, and compressed stem thickness were non-significant). Therefore, concurrent genetic gains in both ascochyta resistance and stem strength should be possible in the same pea breeding population.

Download Full-text

Partial resistance to Mycosphaerella pinodes in field pea

Canadian Journal of Plant Science ◽

10.4141/p00-103 ◽

2001 ◽

Vol 81 (3) ◽

pp. 535-540 ◽

Cited By ~ 36

Author(s):

A. G. Xue ◽

T. D. Warkentin

Keyword(s):

Pisum Sativum ◽

Key Words ◽

Partial Resistance ◽

Field Pea ◽

Mycosphaerella Pinodes ◽

Seed Infection ◽

Low Area ◽

Stem Infection ◽

Progress Curve ◽

Field Plots

The responses of 335 field pea lines originating from more than 30 countries to mycosphaerella blight caused by Mycosphaerella pinodes were evaluated in inoculated field plots in 1994 and 1995. Seven lines (Baccara, Carneval, Danto, Majoret, Miko, PI273605, and Yellowhead) with low area under the disease progress curve (AUDPC) scores were identified. These seven lines, along with the resistant check, Radley, and the susceptible check, 89–195, were further examined for components of partial resistance to the disease in 1996 and 1998. Components evaluated were leaf area with symptoms (LAS), stem area with symptoms (SAS), pod area with symptoms (PAS), and percent seed infection (SI). Differences among pea lines were found in all components. Compared with the susceptible check, Carneval had significantly lower LAS, PAS, and SI in both years and was considered partially resistant to leaf, pod, and seed infection; Danto had significantly lower LAS, SAS, and PAS and was partially resistant to leaf, stem, and pod infection; Yellowhead had significantly lower SAS, PAS, and SI and was partially resistant to stem, pod, and seed infection; Majoret had significantly lower LAS and SAS and was partially resistant to leaf and stem infection; Miko had significantly lower SAS and PAS and was partially resistant to stem and pod infection; PI273605 had significantly lower PAS and SI and was partially resistant to pod and seed infection; and Baccara and Radley had significantly lower SAS and were partially resistant to stem infection only. Plots of Baccara and Yellowhead inoculated with M. pinodes-infected stubble had 10 and 17% reduction in yield, respectively, compared with non-inoculated and fungicide-treated plots and, thus, were considered tolerant to the disease. The remaining lines had yield reductions of 30 to 49%. Key words: Mycosphaerella blight, Mycosphaerella pinodes, Pisum sativum, field pea, partial resistance, disease tolerance

Download Full-text

First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia

Plant Disease ◽

10.1094/pdis-08-13-0809-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 427-427 ◽

Cited By ~ 15

Author(s):

H. S. Tran ◽

M. P. You ◽

V. Lanoiselet ◽

T. N. Khan ◽

M. J. Barbetti

Keyword(s):

Pisum Sativum ◽

Western Australia ◽

Ascochyta Blight ◽

Field Pea ◽

Post Inoculation ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Representative Isolate ◽

Eastern Australia

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to amplify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml–1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

Download Full-text