First Report of Dasheen Mosaic Virus Infecting Typhonium giganteum Engl. (Baifuzi) in Henan Province of China

Typhonium giganteum Engl. (Baifuzi ) is a perennial plant of the family Araceae. In China, its root is commonly used as an antispasmodic for stroke and cancer treatment (Chi et al. 2010; Gao et al. 2014; Khalivulla et al. 2019). Yuzhou city in Henan Province is the main producing area of T. giganteum Engl., and in July 2020, a survey of viral disease infecting T. giganteum Engl. was conducted in the city. In the surveyed fields (n =5), over 60% of plants displayed varying levels of virus-like symptoms, including mosaic, chlorotic and leaf distortion (Supplementary Figure S1) . To identify possible viral pathogens associated with the disease symptoms afflicting T. giganteum Engl., one leaf each from 25 symptomatic plants was collected and analyzed by high-throughput sequencing (HTS) as well as PCR. For HTS analysis, total RNA was extracted from one pooled sample containing a portion of all abovementioned leaves using RNAprep Pure Plant Plus Kit (TIANGEN Biotech, Beijing, China). After removing ribosomal RNA with Ribo-off rRNA depletion kit (Vazyme Biotech, Nanjing, China), a sequencing library was generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) and sequenced on an Illumina Novaseq6000 sequencing system at Berry Genomics Corporation (Beijing, China). A total of 6,899,143 high-quality clean reads were obtained after trimming and used for contig assembly. BLASTn and BLASTx analyses on the contigs (n = 128,400) showed that one contig (9,245 bp in length) exhibited a sequence identity of 84.0% with the reference sequence of dasheen mosaic virus (DsMV, NCBI reference seq. NC_003537, genus Potyvirus, family Potyviridae) , suggesting infection of the plants by DsMV. No other viral sequences were detected in the sample. To confirm these results, a near full-length genomic sequence of DsMV was obtained from one sample (sample no. 39) by reverse transcription polymerase chain reaction (RT-PCR) of three overlapping fragments with the following primer pairs: DsMV-1F (5′-AAATTAAAACATCTCAACAAAACCTACA-3′) /DsMV-4130R (5′-TTCATGGTCCTCGTGGAGTATA-3′), DsMV-3870F (5′-GAGGACGTGAGAATTCAAAGTCT-3′)/DsMV-8250R (5′-GTCCAACCTTGCTTGATGCATGC-3′), DsMV-7690F (5′-GGAGCGACTCCTCTTCCAAAGTTGTG-3′)/DsMV-10100R (5′-TGAACACCGTGCACGAAGCATCTC-3′). The PCR products were cloned into pMD19-T vector (TAKARA Biotech, Dalian, China) and sequenced. The near full-length genomic sequence of the isolate (DsMV-BF39) was 9,737 nt in length and deposited into GenBank under the accession no. MZ043618. BLASTn analysis of this sequence demonstrated that it shared an identity ranging from 78.6% (MG602234) to 85.6% (MG602227) with various DsMV isolates. To determine whether DsMV was closely associated with the symptoms observed in T. giganteum Engl., leaf tissues from 30 symptomatic plants and 22 asymptomatic plants were analyzed by RT-PCR using primer pairs DsMV-CPF (5′-TGTTCTGTGAACATGATGAAGTTG-3′, sense) and DsMV-CPR (5′-GTAACTGTGGCCTGTTTACCAG-3′, antisense) targeting a 916 bp fragment of the CP gene of DsMV. Amplicons with the expected size were detected from the 30 symptomatic plants but not from the 22 asymptomatic plants, suggesting a close association between DsMV infection and the observed symptoms. To our knowledge, this is the first report of DsMV infecting T. giganteum Engl.. Further study is needed to identify the specific symptoms induced by this virus in T. giganteum Engl. and to understand the biological characteristics, epidemiology, prevalence of this virus in China.

Download Full-text

First report of bean common mosaic virus infecting heavenly bamboo (Nandina domestica) in China

Plant Disease ◽

10.1094/pdis-07-21-1591-pdn ◽

2021 ◽

Author(s):

Xiu Su ◽

Xiang Zhou ◽

Yuan Li ◽

Liangjin Ma ◽

Xiaofei Cheng ◽

...

Keyword(s):

New England ◽

Mosaic Virus ◽

Small Rna ◽

Phylogenetic Trees ◽

Genomic Sequence ◽

Bean Common Mosaic Virus ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Plantago Asiatica

Heavenly bamboo (Nandina domestica) is an evergreen ornamental plant with worldwide distribution. In May 2018, seven out of twenty N. domestica plants showing virus-like symptoms, such as yellow mosaic and curling, were observed in Lin’an, Zhejiang province. To determine the causal agent, a small RNA library was constructed using the Small RNA v1.5 Sample Prep Kit (Illumina, San Diego, USA) with total RNA extracted from leaves of a symptomatic plant. The library was sequenced by the Solexa platform at BGI Genomics (Shenzhen, China). A total number of 21,071,675 high-quality reads of 17-28 nucleotides (nt) in length remained after trimming adapter sequences and quality control. Reads were assembled using Velvet 0.7.31 and Oases 0.2.07 with the k-mer value of 17 (Schulz et al. 2012). BlastN and BlastX search against the GenBank viral nonredundant sequence databases revealed fifty-six contigs homologous to bean common mosaic virus (BCMV; genus Potyvirus; family Potyviridae). No contig homologous to the genomic sequence of other plant-infecting viruses was identified. These contigs were further assembled into a 9,315-nt fragment by SeqMan Pro 7.1.0 in Lasergene package (DNASTAR, Madison, WI), which covered 92.68% of the genome of BCMV strain CT (BCMV-CT; GenBank accession no. KM076650). The genome of this BCMV isolate (BCMV-NTZ1) was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using primers designed based on assembled contigs with the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Beijing, China) and the FirstChoice® RLM-RACE Kit (Invitrogen, Carlsbad, USA), respectively. Amplicons were cloned and Sanger sequenced with three independent clones per amplicon. The genome is 10,052 nt in length excluding the poly-A tail (Genbank accession no. MZ670770) and shared the highest nt sequence identities with BCMV-CT (88.46%). The putative polyprotein shared 93.36% amino acid (aa) sequence identity with that of BCMV-CT. BCMV-NTZ1 also clustered with BCMV-CT in phylogenetic trees based on BCMV full genomes and aa sequences of coat protein. Five-leaf-stage seedlings of Nicotiana tabacum, N. benthamiana, Glycine max (Linn.) Merr., and Capsicum frutescens were mechanically inoculated with sap of BCMV-infected N. domestica leaves at fifteen plants per species. Seedlings of G. max developed virus-like (mosaic and leaf deformity) symptoms (7/15) at 15 days post-inoculation, while other plants remained symptomless throughout the experiment. Subsequent RT-PCR on all the plants using primers 27F1/14Rter and sequencing confirmed the presence and absence of BCMV-NTZ1 in all symptomatic G. max seedlings and other asymptomatic indicator plants, respectively. Subsequent RT-PCR survey further confirmed the association of BCMV with symptomatic heavenly bamboo samples but not asymptomatic plants (7/20). To the best of our knowledge, this is the first report of BCMV naturally infecting heavenly bamboo in China. N. domestica is susceptible to many viruses, e.g., cucumber mosaic virus, plantago asiatica mosaic virus, nandina stem pitting virus, apple stem grooving virus, and alternanthera mosaic virus (Barnett et al. 1973; Ahmed et al. 1983; Hughes et al. 2002, 2005; Tang et al. 2010; Wei et al. 2015). Our results indicate that N. domestica can also serve as an overwinter reservoir for BCMV and special attention should be paid to the damage it may cause.

Download Full-text

First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea L.) in China

Plant Disease ◽

10.1094/pdis-05-21-0997-pdn ◽

2021 ◽

Author(s):

Miaomiao Li ◽

Qi Lin ◽

Yi Chen ◽

Fei Xu ◽

Jiejun Peng ◽

...

Keyword(s):

Western Blot ◽

Mosaic Virus ◽

Arachis Hypogaea ◽

Rna Extraction ◽

Turnip Mosaic Virus ◽

Viral Agent ◽

Rt Pcr ◽

First Report ◽

Arachis Hypogaea L ◽

Beijing China

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer’s instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5’-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5’RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.

Download Full-text

Zucchini yellow mosaic virus Genomic Sequences from Papua New Guinea: Lack of Genetic Connectivity with Northern Australian or East Timorese Genomes, and New Recombination Findings

Plant Disease ◽

10.1094/pdis-09-18-1666-re ◽

2019 ◽

Vol 103 (6) ◽

pp. 1326-1336 ◽

Cited By ~ 1

Author(s):

Solomon Maina ◽

Martin J. Barbetti ◽

Owain R. Edwards ◽

David Minemba ◽

Michael W. Areke ◽

...

Keyword(s):

Mosaic Virus ◽

Papua New Guinea ◽

High Throughput Sequencing ◽

Genomic Sequence ◽

Zucchini Yellow Mosaic Virus ◽

New Guinea ◽

Yellow Mosaic Virus ◽

Genetic Connectivity ◽

Genomic Sequences ◽

Nucleotide Identity

Zucchini yellow mosaic virus (ZYMV) isolates were obtained in Papua New Guinea (PNG) from cucumber (Cucumis sativus) or pumpkin (Cucurbita spp.) plants showing mosaic symptoms growing at Kongop in the Mount Hagen District, Western Highlands Province, or Zage in the Goroka District, Eastern Highlands Province. The samples were blotted onto FTA cards, which were sent to Australia, where they were subjected to high-throughput sequencing. When the coding regions of the nine new ZYMV genomic sequences found were compared with those of 64 other ZYMV sequences from elsewhere, they grouped together, forming new minor phylogroup VII within ZYMV’s major phylogroup A. Genetic connectivity was lacking between ZYMV genomic sequences from PNG and its neighboring countries, Australia and East Timor; the closest match between a PNG and any other genomic sequence was a 92.8% nucleotide identity with a sequence in major phylogroup A’s minor phylogroup VI from Japan. When the RDP5.2 recombination analysis program was used to compare 66 ZYMV sequences, evidence was obtained of 30 firm recombination events involving 41 sequences, and all isolates from PNG were recombinants. There were 21 sequences without recombination events in major phylogroup A, whereas there were only 4 such sequences within major phylogroup B. ZYMV’s P1, Cl, N1a-Pro, P3, CP, and NIb regions contained the highest evidence of recombination breakpoints. Following removal of recombinant sequences, seven minor phylogroups were absent (I, III, IV, V, VI, VII, and VIII), leaving only minor phylogroups II and IX. By contrast, when a phylogenetic tree was constructed using recombinant sequences with their recombinationally derived tracts removed before analysis, five previous minor phylogroups remained unchanged within major phylogroup A (II, III, IV, V, and VII) while four formed two new merged phylogroups (I/VI and VIII/IX). Absence of genetic connectivity between PNG, Australian, and East Timorese ZYMV sequences, and the 92.8% nucleotide identity between a PNG sequence and the closest sequence from elsewhere, suggest that a single introduction may have occurred followed by subsequent evolution to adapt to the PNG environment. The need for enhanced biosecurity measures to protect against potentially damaging virus movements crossing the seas separating neighboring countries in this region of the world is discussed.

Download Full-text

First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽

10.1094/pdis-93-7-0762a ◽

2009 ◽

Vol 93 (7) ◽

pp. 762-762 ◽

Cited By ~ 1

Author(s):

R. K. Sampangi ◽

C. Almeyda ◽

K. L. Druffel ◽

S. Krishna Mohan ◽

C. C. Shock ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Great Basin ◽

Natural Infection ◽

The United States ◽

Native Plant ◽

Rt Pcr ◽

Cmv Infection ◽

Spot Virus ◽

First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽

10.1094/pdis-10-12-0933-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 561-561 ◽

Cited By ~ 2

Author(s):

S. Khankhum ◽

P. Bollich ◽

R. A. Valverde

Keyword(s):

Common Bean ◽

Mosaic Virus ◽

Seed Quality ◽

Soybean Mosaic Virus ◽

Ringspot Virus ◽

Wild Plants ◽

Rt Pcr ◽

Sequence Comparisons ◽

First Report ◽

Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Download Full-text

Updating the Quarantine Status of Prunus Infecting Viruses in Australia

Viruses ◽

10.3390/v12020246 ◽

2020 ◽

Vol 12 (2) ◽

pp. 246 ◽

Cited By ~ 1

Author(s):

Wycliff M. Kinoti ◽

Narelle Nancarrow ◽

Alison Dann ◽

Brendan C. Rodoni ◽

Fiona E. Constable

Keyword(s):

Polymerase Chain Reaction ◽

High Throughput Sequencing ◽

Mottle Virus ◽

Rt Pcr ◽

Chain Reaction ◽

Virus Family ◽

First Report ◽

Hop Stunt Viroid ◽

Polymerase Chain ◽

Stem Pitting

One hundred Prunus trees, including almond (P. dulcis), apricot (P. armeniaca), nectarine (P. persica var. nucipersica), peach (P. persica), plum (P. domestica), purple leaf plum (P. cerasifera) and sweet cherry (P. avium), were selected from growing regions Australia-wide and tested for the presence of 34 viruses and three viroids using species-specific reverse transcription-polymerase chain reaction (RT-PCR) or polymerase chain reaction (PCR) tests. In addition, the samples were tested using some virus family or genus-based RT-PCR tests. The following viruses were detected: Apple chlorotic leaf spot virus (ACLSV) (13/100), Apple mosaic virus (ApMV) (1/100), Cherry green ring mottle virus (CGRMV) (4/100), Cherry necrotic rusty mottle virus (CNRMV) (2/100), Cherry virus A (CVA) (14/100), Little cherry virus 2 (LChV2) (3/100), Plum bark necrosis stem pitting associated virus (PBNSPaV) (4/100), Prune dwarf virus (PDV) (3/100), Prunus necrotic ringspot virus (PNRSV) (52/100), Hop stunt viroid (HSVd) (9/100) and Peach latent mosaic viroid (PLMVd) (6/100). The results showed that PNRSV is widespread in Prunus trees in Australia. Metagenomic high-throughput sequencing (HTS) and bioinformatics analysis were used to characterise the genomes of some viruses that were detected by RT-PCR tests and Apricot latent virus (ApLV), Apricot vein clearing associated virus (AVCaV), Asian Prunus Virus 2 (APV2) and Nectarine stem pitting-associated virus (NSPaV) were also detected. This is the first report of ApLV, APV2, CGRMV, CNRNV, LChV1, LChV2, NSPaV and PBNSPaV occurring in Australia. It is also the first report of ASGV infecting Prunus species in Australia, although it is known to infect other plant species including pome fruit and citrus.

Download Full-text

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽

10.1094/pdis-10-14-1028-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 422-422 ◽

Cited By ~ 3

Author(s):

M. Mijit ◽

S. F. Li ◽

S. Zhang ◽

Z. X. Zhang

Keyword(s):

Mosaic Virus ◽

Blot Hybridization ◽

Ficus Carica ◽

Pcr Analysis ◽

Northern Blot Hybridization ◽

Rt Pcr ◽

Glycoprotein Precursor ◽

First Report ◽

Common Fig ◽

Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

Download Full-text

First Report of Tomato torrado virus Infecting Tomato in Colombia

Plant Disease ◽

10.1094/pdis-11-11-1000 ◽

2012 ◽

Vol 96 (4) ◽

pp. 592-592 ◽

Cited By ~ 9

Author(s):

M. Verbeek ◽

A. M. Dullemans

Keyword(s):

Mosaic Virus ◽

Potato Virus ◽

Polyclonal Antibodies ◽

Sandwich Elisa ◽

Potato Virus X ◽

Rt Pcr ◽

Leaf Extracts ◽

Serological Tests ◽

First Report ◽

Initial Symptoms

Tomato (Solanum lycopersicum L.) plants grown in plastic greenhouses near Villa de Leyva, northeast of Bogota, Colombia showed necrotic spots on the leaves in September 2008. Initial symptoms were necrosis beginning at the base of leaflets that were surrounded by yellow areas. These symptoms resembled those described for Tomato torrado virus (ToTV; family Secoviridae, genus Torradovirus), which was first found in Spain (2). Other (tentative) members of the genus Torradovirus, Tomato marchitez virus (ToMarV), Tomato chocolate spot virus (ToChSV), and Tomato chocolàte virus (ToChV) (3) induce similar symptoms on tomato plants. One sample, coded T418, was stored in the freezer and brought to our lab in 2011. Serological tests (double-antibody sandwich-ELISA) using polyclonal antibodies (Prime Diagnostics, Wageningen, The Netherlands) on leaf extracts showed the absence of Pepino mosaic virus (PepMV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Cucumber mosaic virus (CMV), Potato virus X (PVX), and Potato virus Y (PVY). Leaf extracts were mechanically inoculated onto the indicator plants Physalis floridana, Nicotiana hesperis ‘67A’, and N. occidentalis ‘P1’ (six plants in total) and were kept in a greenhouse at 20°C with 16 h of light. Necrotic symptoms appeared 4 to 5 days postinoculation and resembled those described for ToTV (2). Two dip preparations of systemically infected P. floridana and N. occidentalis leaves were examined by electron microscopy, which revealed the presence of spherical virus particles of approximately 30 nm. To confirm the presence of ToTV, total RNA was extracted from the original leaf material and an inoculated P. floridana and N. occidentalis plant using the Qiagen Plant Mini Kit (Qiagen, Hilden, Germany) following manufacturer's instructions. ToTV-specific primer sets ToTV-Dp33F/ToTV-Dp20R (5′-TGCTCAATGTTGGAAACCCC-3′/5′-AGCCCTTCATAGGCTAGCC-3′, amplifying a fragment of the RNA1 polyprotein with an expected size of 751 bp) and ToTV-Dp1F/ToTV-Dp2R (5′-ACAAGAGGAGCTTGACGAGG-3′/5′-AAAGGTAGTGTAATGGTCGG-3′, amplifying a fragment on the RNA2 movement protein region with an expected size of 568 bp) were used to amplify the indicated regions in a reverse transcription (RT)-PCR using the One-Step Access RT-PCR system (Promega, Madison, WI). Amplicons of the predicted size were obtained in all tested materials. The PCR products were purified with the Qiaquick PCR Purification Kit (Qiagen) and sequenced directly. BLAST analyses of the obtained sequences (GenBank Accession Nos. JQ314230 and JQ314229) confirmed the identity of isolate T418 as ToTV, with 99% identity to isolate PRI-ToTV0301 in both fragments (GenBank Accession Nos. DQ388879 and DQ388880 for RNA1 and RNA 2, respectively). To our knowledge, this is the first report of ToTV in Colombia, and interestingly, since ToTV has been found only in Europe and Australia (1) so far, this is the first report of ToTV on the American continent. References: (1) C. F. Gambley et al. Plant Dis. 94:486, 2010. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007. (3) M. Verbeek et al. Arch. Virol. 155:751, 2010.

Download Full-text