scholarly journals Gray Mold Caused by Botryotinia fuckeliana on Edible Pods of Pea in Brazil

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 569-569 ◽  
Author(s):  
L. J. Dallagnol ◽  
L. V. Ferreira ◽  
J. A. Araujo-Filho ◽  
L. E. A. Camargo ◽  
F. R. de Castro-Moretti
Keyword(s):  
Morphological Characteristics ◽  
Gray Mold ◽  
Fungal Mycelium ◽  
Its2 Region ◽  
Pathogenicity Test ◽  
Academic Press ◽  
Surrounding Water ◽  
Botryotinia Fuckeliana ◽  
And Control ◽  
Β Tubulin

Gray mold on edible pods of snow pea (Pisum sativum Lam. [Fabaceae]) was observed in greenhouse-cultivated pea (cvs. Luana Gigante and Gigante Flor Roxa) in the city of Pelotas (Rio Grande do Sul, Brazil) in September and October 2012. The incidence of diseased pods was high (∼25% of immature pods) after up to 3 cloudy and rainy days that hindered the ventilation inside the greenhouse resulting in high relative humidity. Infection occurred first on senescing petals adhered to the forming pods, leading to pod abortion or rotting that began at the contact site with the infected petal. The first symptoms on pods included water soaked tissue that quickly turned light brown and progressed to necrosis. Conidia and conidiophores produced on profuse gray mycelium could be easily seen on infected tissue 2 to 3 days after the appearance of symptoms. Conidiophores were smooth-walled, 400 μm to over 1.5 mm long, hyaline to pale brown, and branched in their upper part; each branch ended with a hemispherical or spherical swelling, 5 to 9 μm in diameter with minute sterigmata. Macroconidia were globose, ellipsoidal, smooth, hyaline to pale brown, usually with protuberant hila, 7 to 15 × 5 to 9 μm. Microconidia were not observed. On potato dextrose agar (PDA), colonies were fast-growing, white, low, covering entire 10 cm petri plates in 4 to 5 days when they turned gray to brownish-gray. Conidiophores and conidia were often formed in sectors. Shield-like, elliptical, lenticular to irregular, black, 1.5 to 6.0 × 1.0 to 4.0 mm sclerotia developed in 10-day-old colonies incubated at room temperature. Genomic DNA was extracted from conidia, conidiophores, and mycelium and used to amplify both the internal transcribed spacer (ITS) (ITS1-5.8s-ITS2) region and the β-tubulin gene using the ITS1/4 and Bt2a/b primers, respectively (1,4). The ITS (541 bp) and β-tubulin (467 bp) sequences were deposited in GenBank under accessions KC683713 and KC683712, respectively. BLASTn searches revealed similarity of 100% (EF207415) and 99% (FQ790278) with Botryotinia fuckeliana (De Bary) Whetzel for the ITS and β- tubulin sequences, respectively. Based on morphological characteristics and sequence analysis, the pathogen causing pod rot of peas was identified as B. fuckeliana. To fulfill Koch's postulates, 10 unwounded pods of P. sativum ‘Luana Gigante’ were inoculated by depositing PDA plugs (5 mm) colonized with fungal mycelium on their surface. Non-inoculated and mock-inoculated pods with sterile PDA plugs served as control. Inoculated and control pods were incubated inside a clear plastic box (11 × 11 × 3.5 cm) and over moistened filter paper under 12-h photoperiod at 25 ± 1°C. A surrounding water-soaked halo was visible only on pods inoculated with the fungus 48 h after inoculation (hai). Intense sporulation and necrosis were visible 96 hai. Botrytis spp. was previously detected, through standard blotter test, on seeds of P. sativum in Brazil, but without pathogenicity test nor its transmission through seeds (2,3). To our knowledge, this is the first report of B. fuckeliana causing epidemics on pea pods in Brazil. The high incidence of the disease in a protected environment has the potential to cause significant economic impact due to its damage to the pods, rendering them unmarketable. References: (1) N. L. Glass and G. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (2) M. A. S. Mendes et al. Fungos em Plantas no Brasil. Embrapa-Cenargen, Brasília, 1998. (3) W. M. Nascimento and S. M. Cícero. Rev. Bras. Sementes 13:5, 1991. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

scholarly journals First Report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum Associated with Canker and Dieback of Grapevines in Tunisia

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 420-420 ◽  
Author(s):  
S. Chebil ◽  
R. Fersi ◽  
A. Yakoub ◽  
S. Chenenaoui ◽  
M. Chattaoui ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Its2 Region ◽  
Pathogenicity Test ◽  
Botryosphaeria Dothidea ◽  
Diplodia Seriata ◽  
First Report ◽  
Grapevine Dieback ◽  
Pinus Spp ◽  
Neofusicoccum Luteum

In 2011, common symptoms of grapevine dieback were frequently observed in 2- to 5-year-old table grape (Vitis vinifera L.) cvs. in four vineyards located in northern Tunisia. The symptoms included dead spur and cordons, shoot dieback, and sunken necrotic bark lesions, which progressed into the trunk resulting in the death of large sections of the vine. Longitudinal and transversal sections of cordons and spurs from symptomatic vines revealed brown wedge-shaped cankers of hard consistency. Twelve symptomatic samples from spur and cordons were collected, surface disinfected by dipping into 5% (v/v) sodium hypochlorite for 2 min, and small pieces from the edge of necrotic and healthy tissue were removed and plated onto potato dextrose agar (PDA) at 25°C in the dark. Based on colony and conidia morphological characteristics, isolates were divided in three species, named Diplodia seriata, Botryosphaeria dothidea, and Neofusicoccum luteum. D. seriata colonies were gray-brown with dense aerial mycelium producing brown cylindric to ellipsoid conidia rounded at both ends and averaged 22.4 × 11.7 μm (n = 50). B. dothidea colonies were initially white with abundant aerial mycelium, gradually becoming dark green olivaceous. Conidia were fusiform to fusiform elliptical with a subobtuse apex and averaged 24.8 × 4.7 μm (n = 50). N. luteum colonies were initially pale to colorless, gradually darkening with age and becoming gray to dark gray producing a yellow pigment that diffuses into the agar. Conidia were hyaline, thin-walled, aseptate, fusiform to fusiform elliptical, and averaged 19.8 × 5.5 μm (n = 50). Identity of the different taxa was confirmed by sequence analyses of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA and part of the elongation factor 1-alpha (EF1-α) gene. BLAST analysis of sequences indicated that six isolates were identified as D. seriata (GenBank: AY259094, AY343353), one isolate as B. dothidea (AY236949, AY786319) and one isolate as N. luteum (AY259091, AY573217). Sequences were deposited in GenBank under accessions from KC178817 to KC178824 and from KF546829 to KF546836 for ITS region and EF1-α gene, respectively. A pathogenicity test was conducted on detached green shoots cv. Italia for the eight Botryosphaeriaceae isolates. Shoots were inoculated by placing a colonized agar plug (5 mm diameter) from the margin of a 7-day-old colony on fresh wound sites made with a sterilized scalpel. Each wound was covered with moisturized cotton and sealed with Parafilm. Control shoots were inoculated using non-colonized PDA plugs. After 6 weeks, discoloration of xylem and phloem and necrosis with average length of 38.8, 17.6, and 11.2 mm were observed from inoculated shoots with D. seriata, N. luteum, and B. dothidea, respectively, and all three fungi were re-isolated from necrotic tissue, satisfying Koch's postulates. Control shoots showed no symptoms of the disease and no fungus was re-isolated. In Tunisia, Botryosphaeria-related dieback was reported only on citrus tree caused by B. ribis (2), on Pinus spp. caused by D. pinea (4), on Quercus spp. caused by D. corticola (3), and on olive tree (Olea europea) caused by D. seriata (1). To our knowledge, this is the first report of D. seriata, B. dothidea, and N. luteum associated with grapevine dieback in Tunisia. References: (1) M. Chattaoui et al. Plant Dis. 96:905, 2012. (2) H. S. Fawcett. Calif. Citrogr. 16:208, 1931. (3) B. T. Linaldeddu et al. J. Plant Pathol. 91:234. 2009. (4) B. T. Linaldeddu et al. Phytopathol. Mediterr. 47:258, 2008.

scholarly journals First Report of Cladobotryum protrusum causing Cobweb Disease on the Edible Mushroom Coprinus comatus

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 287-287 ◽  
Author(s):  
G. Z. Wang ◽  
M. P. Guo ◽  
Y. B. Bian
Keyword(s):  
Fruiting Body ◽  
Morphological Characteristics ◽  
Edible Mushroom ◽  
Its2 Region ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Fruiting Bodies ◽  
Coprinus Comatus ◽  
First Report ◽  
Medicinal Value

Coprinus comatus is one of the most commercially important mushrooms in China. Its fruiting body possesses rich nutritional and medicinal value. In November 2013, unusual symptoms were observed on C. comatus on a mushroom farm in Wuhan, Hubei, China. At first, fruiting bodies were covered by white and cobweb-like mycelia. Later, the cap and stipe turned brown or dark before rotting and cracking. The pathogen was isolated from infected tissue of C. comatus. Colonies of the pathogen on potato dextrose agar (PDA) medium first appeared yellowish, followed by an obvious ochraceous or pinkish color. Aerial mycelia grew along the plate wall, cottony, 1 to 4 mm high. Conidiophores were borne on the tops of hyphae, had two to four branches, and were cylindrical, long clavate, or fusiform. Conidia were borne on the tops of the branches of conidiophores, had one to two separates, and were long and clavate. The spores ranged from 15.3 to 22.1 μm long and were 5.1 to 8.3 μm wide, which was consistent with the characteristics of Cladobotryum protrusum (1). The species was identified by ribosomal internal transcribed spacer sequencing. The ribosomal ITS1-5.8S-ITS2 region was amplified from the isolated strain using primers ITS1 and ITS4. A BLAST search in GenBank revealed the highest similarity (99%) to C. protrusum (GenBank Accession Nos. FN859408.1 and FN859413.1). The pathogen was grown on PDA at 25°C for 3 days, and the inoculation suspension was prepared by flooding the agar surface with sterilized double-distilled water for spore suspension (1 × 105 conidia/ml). In one treatment, the suspension was sprayed on casing soil (106 conidia/m2) and mixed thoroughly with it, then cased with treated soil for 2 to 3 cm thickness on the surface of compost in cultivation pots (35 × 25× 12 cm), with sterile distilled water as a control (2). Eight biological replicates were included in this treatment. In the second treatment, mycelia plugs (0.3 × 0.3 cm) without spore production were added to 20 fruiting bodies. Mushrooms treated with blank agar plugs (0.3 × 0.3 cm) were used as a control. The plugs were covered with sterilized cotton balls to avoid loss of moisture. Tested cultivation pots were maintained at 18°C and 85 to 95% relative humidity. In the samples where casing soil was sprayed with conidia suspension, white mildew developed on the pileus, and a young fruiting body grew out from the casing soil. Eventually, the surface of the mushroom was overwhelmed by the mycelia of the pathogen and the pileus turned brown or black. For the other group inoculated with mycelia plugs, only the stipe and pileus inoculated with mycelia turned brown or dark; it rotted and cracked 2 to 3 days later. The symptoms were similar to those observed on the C. comatus cultivation farm. Pathogens re-isolated from pathogenic fruiting bodies were confirmed to be C. protrusum based on morphological characteristics and ITS sequence. To our knowledge, this is the first report of the occurrence of C. protrusum on the edible mushroom C. comatus (3). Based on the pathogenicity test results, C. protrusum has the ability to severely infect the fruiting body of C. comatus. References: (1) K. Põldmaa. Stud. Mycol. 68:1, 2011. (2) F. J. Gea et al. Plant Dis. 96:1067, 2012. (3) W. H. Dong et al. Plant Dis. 97:1507, 2013.

scholarly journals First Report of Colletotrichum siamense Causing Anthracnose of Chili Pepper Fruit in Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Moe Oo May ◽  
Mi-Reu Kim ◽  
Dae-Gyu Kim ◽  
Tae-Seok Kwak ◽  
Sang-Keun Oh
Keyword(s):  
Morphological Characteristics ◽  
Chili Pepper ◽  
Pathogenicity Test ◽  
Disease Symptoms ◽  
First Report ◽  
Pepper Fruit ◽  
Genes Encoding ◽  
Reference Sequences ◽  
And Control ◽  
Morphology Characteristics

In October 2015, typical anthracnose symptoms were observed on approximately 15 to 20% of the chili fruits (cv. Manita) growing in Goesan County, Chungcheong Province, South Korea. Infection of fruits were characterized by the presence of circular, sunken lesions with concentric rings of orange conidial acervuli. Fresh samples were collected from the infected fruits and lesions from seven symptomatic fruits were cut into small pieces (5 mm2) and surface sterilized by soaking them in 1% sodium hypochlorite for 3 min, followed by rinsing thrice using sterilized water, and drying on sterilized filter paper. The tissue pieces were then placed on potato dextrose agar (PDA) and incubated at 25 ± 2°C with 12hrs photoperiod. After 2 to 3 days, single hyphal tips were transferred to fresh PDA and a total of seven isolates were selected from typical single hyphae. The upper surfaces of the colonies formed on PDA were white to gray in color with cottony mycelia, in which salmon-colored acervuli were clearly visible (Supplementary 1). Thirty conidia were examined; all were hyaline, smooth-walled, aseptate, straight, mainly cylindrical with round ends, 12 to 17 µm long, and 3 to 4.5 µm wide. Appressoria were oval to irregular inshape, dark brown in color, and range from 9.5 to 11.5 µm × 6.5 to 7.5 µm in sizes. Morphological characteristics of the seven isolates were identical and resembled those of C. siamense (Weir et al. 2012). To confirm the identification of the fungal isolates, DNA from seven isolates were extracted (Cenis et al. 1992) and the genes encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), internal transcribed spacer (ITS) rDNA regions, and β-Tublin-2 (TUB2) were partially amplified and sequenced. Sequences from all seven isolates were identical each other. Nucleotide sequences of ITS, GAPDH, and TUB2 from representative isolates CNU180002 and CNU180012 were deposited in GenBank under accession numbers MH085103, MH085105, and MH085107 for CNU180002 and MK033503, MK033504, and MK033505 for CNU180012, respectively. The sequences for all three genes exhibited 99 to 100% identity with C. siamense, GenBank accession nos. FJ972613 (ITS), FJ972575 (GAPDH), and FJ907438 (TUB2) for both isolates. A multi-locus phylogenetic tree with closely related reference sequences downloaded from the GenBank database demonstrated that these two isolates were aligned with C. siamense. Pathogenicity of isolates CNU180002 and CNU180012 was confirmed on healthy fruits (Manita) by using a pin-pricked wound/drop (1 mm depth) and non-wound/drop inoculation method (Oo et al. 2017) and control fruits were mock-inoculated with sterilized distilled water. Three fruits were inoculated for each isolate and pathogenicity test were repeated thrice. After inoculation, the fruits were placed on a sterilized paper tissue in moistened clean boxes with a relative humidity of approximately 90% and incubated for 7 days at 25°C in the dark. Disease symptoms were appeared 5 to 7 days after inoculation on wounded fruits whereas non-wounded fruits were observed after 10 days. The two isolates showed identical symptoms and control fruits remained symptomless. Both isolates were re-isolated from infected fruits and were identical to the original isolates in morphology characteristics as well as on molecular sequences of ITS, GAPDH and TUB2 genes. To our knowledge, this is the first report of anthracnose caused by C. siamense on chili pepper fruit in Korea.

scholarly journals First Report of Anthracnose of Gossypium indicum Lam. caused by Colletotrichum theobromicola in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Donghun Kang ◽  
Jungyeon Kim ◽  
Youn Mi Lee ◽  
Balaraju Kotnala ◽  
Yongho Jeon
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Bootstrap Support ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
First Report ◽  
Spray Method ◽  
Cotton Plants ◽  
Leaf Surface Area ◽  
And Control

In September 2020, typical anthracnose symptoms were observed on cotton (Gossypium indicum Lam.) leaves growing in Hahoe village, Andong, Gyeongbuk Province, Korea. The leaves of the infected plants initially showed spots with halo-lesions which became enlarged and spread to the entire leaf surface area. The infected leaves later became yellowish and chlorotic (Fig. 1A). The disease incidence was at least 90% in the field. For pathogen isolation, fresh samples collected from symptomatic leaves were cut into small pieces (4 to 5 mm2), surface-sterilized in 1% sodium hypochlorite for 1 min, rinsed three times, and macerated in sterile distilled water (SDW). They were spread onto potato dextrose agar (PDA) plates and incubated at 25 °C for 5 days under a 12-h photoperiod. Five isolates were recovered from the infected leaves. Purified fungal colonies were initially white, later turned yellow on PDA medium. Conidia were yellow-colored, smooth-walled, aseptate, straight or slightly distorted, and cylindrical with one end slightly acute or with broadly rounded ends, and with size ranges from 15.3 to 17.5 µm (length) × 4.5 to 5.2 µm (width) (Fig. 1B). The morphological characteristics of the present isolates were consistent with those of Colletotrichum gloeosporioides (Weir et al. 2012). A single isolate, ANUK97, was selected for identification. The multilocus sequence analysis (MLSA) of the actin (ACT), calmodulin (CAL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), internal transcribed spacer (ITS) rDNA, and β-tubulin (Tub2) were amplified by PCR with the primer pairs of ACT-521F/ACT-783R, CL1C/CL2C, GDF/GDR, ITS1/ITS4, and T1/T2, respectively (White et al. 1990). The resulting sequences were deposited in GenBank under accession numbers MW580367 (ACT), MW580368 (CAL), MW580369 (GAPDH), MW580370 (ITS), and MW580371 (TUB2). A nucleotide BLAST search revealed that ACT, CAL, GAPDH, ITS, and TUB2 sequences be 99% similar to accession numbers MN307380.1, MH155176.1, MK796226.1, MW580370.1, and JX010377.1, respectively of C. theobromicola. Maximum likelihood (ML) phylogenetic analysis was conducted based on a combined dataset of ACT, CAL, GAPDH, ITS, and TUB2 sequences using MEGA-X 10.1.8. The isolate ANUK97 was clustered with a representative strain C. theobromicola CBS124945 100% bootstrap support (Fig. 2). For the pathogenicity test, two-month-old cotton seedlings (n = 10) were inoculated with conidial suspensions (10⁶ spore/mL) of C. theobromicola obtained from 7-day-old PDA cultures at 25 °C by spray method. Seedlings treated with sterile distilled water served as controls. Inoculated and control cotton plants were incubated in the greenhouse at 25 °C under a 12-h photoperiod. After 7 days, necrotic lesions were observed on the artificially inoculated cotton plants, while control plants did not develop any disease symptoms. The pathogen was re-isolated from infected cotton leaves, but not from control plants to fulfill Koch’s postulates. To our knowledge, this is the first report of anthracnose of cotton caused by Colletotrichum theobromicola in Korea.

scholarly journals First report of late blight caused by Phytophthora infestans in potato in Tibet Autonomous Region of China

Plant Disease ◽  
2021 ◽  
Author(s):  
Dongfeng Guo ◽  
Linhan Li ◽  
Zhen Lei ◽  
Yue Zhang ◽  
Lixuan Meng ◽  
...  
Keyword(s):  
Late Blight ◽  
Phytophthora Infestans ◽  
Dna Sequence ◽  
Morphological Characteristics ◽  
Its2 Region ◽  
Pathogenicity Test ◽  
Potato Field ◽  
Autonomous Region ◽  
First Report ◽  
Tibet Autonomous Region

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world’s highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar ‘Longshu 10’ with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5’GGCCTTGACGACATCCAGAA3’; EF_R: 5’TAGCAGCTCAACCCGAAGTG3’), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5’TTCCCTTTGTCCTCTACCGAT3’; P2R: 5’TTACGGCGGTTTAGCACATACA3’) (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. ‘Favorita’ for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. ‘Favorita’ with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

scholarly journals First Report of Leaf Spot of Saponaria officinalis Caused by Alternaria nobilis in Italy

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 424-424 ◽  
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
A. Poli ◽  
M. L. Gullino
Keyword(s):  
Morphological Characteristics ◽  
Pathogenicity Test ◽  
Academic Press ◽  
First Report ◽  
Perennial Plant ◽  
Plastic Bags ◽  
Pcr Product ◽  
Pathogenicity Tests ◽  
Alternaria Sp ◽  
Saponaria Officinalis

Saponaria officinalis (Vize) Simmons (common name bouncingbet) is a low maintenance perennial plant belonging to the Caryophyllaceae family, typically grown in parks and gardens. During the summers of 2011 and 2012, extensive necrosis were observed on leaves of plants grown in private gardens, near Biella (northern Italy). The disease affected 90% of 1- to 2-year-old plants. The first symptoms were usually pale brown lesions 1 to 5 mm in diameter and sometimes coalesced. Lesions were circular to irregular with a dark purple halo, with infected leaves eventually turning chlorotic. The conidia observed on infected leaves were olivaceous brown and obclavate, with a beak. Conidia showed 8 to 15 (average 12) transverse and 4 to 14 (average 11) longitudinal septa, with slight constrictions connected with septa, and were 78.3 to 177.7 (average 135.5) × 19.0 to 34.3 (average 26.5) μm. The beak was 20.0 to 62.2 (average 33.7) μm in length, with 0 to 6 (average 3) transverse septa and no longitudinal septa. The fungus was consistently isolated from infected leaves on potato dextrose agar (PDA). The isolate, grown for 14 days at 20 to 24°C with 10 h of darkness and 14 h of light on sterilized host leaves plated on PDA, produced conidiophores single, unbranched, flexuous, septate with conidia in short chains, similar to those observed on the leaves and previously described. On the basis of its morphological characteristics, the pathogen was identified as Alternaria sp. (3). DNA was extracted using Nucleospin Plant Kit (Macherey Nagel) and PCR carried out using ITS 1/ITS 4 primer (4). A 542-bp PCR product was sequenced and a BLASTn search confirmed that the sequence corresponded to A. dianthi (AY154702), recently renamed A. nobilis (2). The nucleotide sequence has been assigned the GenBank Accession No. JX647848. Pathogenicity tests were performed by spraying leaves of healthy 3-month-old plants of S. officinalis with an aqueous 2 × 105 spore/ml suspension. The inoculum was obtained from cultures of the fungus grown on PDA amended with host leaves for 14 days, in light-dark, at 22 ± 1°C. Plants sprayed only with water served as controls. Four pots (1 plant/pot) were used for each treatment. Plants were covered with plastic bags for 4 days after inoculation and maintained in a glasshouse at 21 ± 1 °C. Lesions developed on leaves 9 days after inoculation with the spore suspension, whereas control plants remained healthy. A. nobilis was consistently reisolated from these lesions. The pathogenicity test was carried out twice. The presence of A. dianthi was reported on S. officinalis in Denmark (1) and Turkey. This is, to our knowledge, the first report of A. nobilis on S. officinalis in Italy. The presence and importance of this disease is, at present, limited. References: (1) P. Neergaard. Danish species of Alternaria and Stemphylium. Oxford University Press, 1945. (2) E. G. Simmons. Mycotaxon 82:7, 2002. (3) E. G. Simmons. Alternaria: An Identification Manual. CBS Biodiversity Series 6, Utrecht, The Netherlands, 2007. (4) T. J. White et al. In: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

scholarly journals First report of Botryosphaeria dothidea as a causal agent to stem rot disease on plumcot trees in Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Chang-Gi Back ◽  
Walftor Dumin ◽  
You-Kyoung Han ◽  
Yeong-Seok Bae ◽  
Jong-Han Park
Keyword(s):  
Causal Agent ◽  
Stem Rot ◽  
Fungal Mycelium ◽  
Pathogenicity Test ◽  
Total Production ◽  
Botryosphaeria Dothidea ◽  
Disease Symptoms ◽  
Rot Disease ◽  
Stem Colour ◽  
Β Tubulin

Botryosphaeria dothidea (B. dothidea) is a fungal pathogen commonly associated with stem canker, dieback, and rot disease in a variety of woody plants worldwide (Dong and Guo, 2020). In Korea, B. dothidea was reported to cause a disease problem to serval crops such as apple and blueberry (Kim, 1995; Choi, 2011). In early 2020, a typical symptom resembling the stem rot disease was spotted to occur at a plumcot cultivation area around Wanju (35.827870, 127.030380) province, Korea. At the early stage of infection, a small blister appeared on the plumcot branch and stem. However, as the blister extended, a light brown canker was observed appeared on the infected area and in some cases a sticky sap oozed from the branch bark crack. If not managed or treated properly, all leaves beyond the infection site will turn brown, wilt, and the whole plumcot tree eventually dies. A survey in the affected area showed that approximately 5% of the plumcot trees were infected which cause up to 10% reduction in total production. To identify the causal agent, symptomatic tissues were excised and surface sterilized with 70% ethanol for 30 sec followed by 1% NaClO for 30 sec before rinsing with sterile water, thrice. The samples were then dried with a piece of filter paper and later air-dried before being placed on a potato dextrose agar (PDA). The PDA plates were then incubated at 25°C for 5 days with 12 hours light/dark cycles period. Among several fungal isolates obtained, four were selected for further analyses. Morphological identification revealed that the fungal conidia were hyaline, ovoid, fusiform (type that rarely form a septum) and unicellular with an average size of 18 - 20 μm × 4.5 -5.5 μm (n = 50). These morphological characters have a strong resemblance to B. dothidea that described by Slipper et al., (2004). For molecular identification, Internal transcribed spacer (ITS), beta-tubulin (β-tubulin) and elongation factor 1 alpha (EF-1α) were amplified and sequenced using universal primer pairs ITS1/ITS4 (White et al., 1990), Bt2a/Bt2b (Glass and Donaldson, 1995) and EF1/EF2 (O’Donnell et al. 1998) respectively. Alignment analysis showed that ITS (LC602817), β-tubulin (LC602820) and EF-1α (LC602821) sequences were 99-100% identical to the orthologous genes identified in B. dothidea infecting soybean in China [MW130133 (identity 537/536 bp), MW147482 (identity 394/394 bp) and MW147481 (identify 250/250 bp) respectively] (Chen et al. 2021). However, phylogenetic analysis of concatenated ITS, β-tubulin and EF-1α genes sequence established the identity of these isolate as B. dothidea. Due to the 100% identical at the molecular level, isolate NIHHS 20-262 was selected as a representative for further analysis. For the pathogenicity test, fungal mycelium (via PDA plug) was used as a source of inoculum for both intact and detached plumcot stems trials. For the intact trial, mycelium was inoculated on the wounded spots of ten plumcot stems that grew at the NIHHS trial farm. Ten days post-inoculation (dpi), disease symptoms i.e. stem colour turn from greenish to dark brown was observed at the inoculated sites. For the detached trial, mycelium was inoculated on the wounded spots of ten detached plumcot stems. The inoculated stems were kept in a closed container to maintain 90% humidity before incubated at 25ºC in the dark. Interestingly, on the detached stems, disease symptoms (greenish colour turn to dark brown) were observed to appear seven days early compare to intact stems. A sterile PDA plug replacing fungal mycelium served as a negative control and the result shows no symptoms were observed on either intact or detached control stems. For consistency purposes, pathogenicity tests on intact stems were performed on three different plumcot trees, whereas three biological replicates for detached stems. Isolation and re-identification of two colonies from the infected sites (intact and detached stems) were attempted and the results obtained were identical to the original isolate, thus fulfilling Koch’s postulates. Local farmers described this disease as a “certain death disease” in plumcot. Therefore, accurate identification of B. dothidea as the causal agent is critical for effective disease management to minimise qualitative and quantitative losses in the plumcot industry. Although has been reported to cause dieback disease in blueberry in Korea (Choi, 2011), to our knowledge, this is the first study to report B. dothidea causing stem rot diseases on the plumcot trees in Korea.

scholarly journals First Report of Diplodia Cane Dieback of Grapevine in Bolivia

Plant Disease ◽  
2009 ◽  
Vol 93 (3) ◽  
pp. 320-320 ◽  
Author(s):  
W. J. Kaiser ◽  
G. M. Rivero V. ◽  
E. Valverde B.
Keyword(s):  
Morphological Characteristics ◽  
Pathogenic Fungi ◽  
Fungal Mycelium ◽  
Vitis Vinifera L ◽  
Potential Threat ◽  
Moist Chamber ◽  
First Report ◽  
Grape Berries ◽  
Median Septum ◽  
And Control

Grape (Vitis vinifera L.) is an important commercial crop in the temperate regions of Bolivia where it has been grown for hundreds of years. In October of 2001, diseased canes of grape (cv. Muscat of Alexandria) were collected in a vineyard in Yotala, Department of Chuquisaca in southern Bolivia. In this planting of more than 1,000 plants, more than 75% were exhibiting cane dieback symptoms and many were dead or dying. No disease was observed on grape berries. Symptoms of the disease were similar to those reported for Diplodia cane dieback (1). Cankers ranging from 2 to 10 cm long and 0.5 to 3 cm wide were observed. When diseased canes were placed in a moist chamber, conidia oozed from pycnidia in black cirri. Immature conidia were hyaline and one-celled, but mature conidia were dark brown (20 to 30 × 10 to 15 μm) with one median septum and longitudinal striations. The pathogen was tentatively identified as Lasiodiplodia theobromae (Pat.) Griffon & Maubl. (synonyms Diplodia natalensis Pole-Evans and Botryodiplodia theobromae Pat.), teleomorph Botryosphaeria rhodina (Cooke) Arx) (2). Fungi were isolated from cankers on diseased canes by surface disinfestation in 0.25% NaOCl for 5 min and placing small pieces of tissue on 2% water agar or potato dextrose agar (PDA). L. theobromae was isolated from these tissues. Koch's postulates were fulfilled by inoculating grape berries and canes with the pathogen. Five grape berries were surface disinfested and inoculated by wounding with a sterile scalpel and inserting a piece of fungal mycelium on PDA in the wounded sites. The same number of control berries was similarly treated with sterile PDA. Inoculated and control berries were placed in plastic, moist chambers in the laboratory at ambient temperature (15 to 28°C) in the dark. Five canes on two potted plants were inoculated with the same isolate of the pathogen in a similar manner as the berries. The inoculated and control sites on canes were wrapped with masking tape. Plants were placed in a moist chamber for 5 days. After 8 days, inoculated berries were rotting and the inoculated sites were covered with grayish mycelium. Within 12 days, cankers as much as 3 cm long developed on the inoculated canes, and in some lesions, black pycnidia were observed. No lesions developed in the wounded control canes. The pathogen was reisolated from inoculated berries and canes, but not from control berries or canes. The teleomorph was not observed on any naturally infected canes or on those inoculated with the anamorph. The pathogen was identified as L. theobromae based on symptoms (1), cultural and morphological characteristics (2), and pathogenicity tests. The disease poses a potential threat to the cultivation of grapevine in southern Bolivia. To our knowledge, this is the first report of Diplodia cane dieback of grapevine in Bolivia. References: R. C. Pearson and A. C. Goheen. Compendium of Grape Diseases. The American Phytopathological Society, St. Paul, MN, 1988. (2). E. Punithalingam. No. 519 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, England, 1976.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold of Tobacco in Guizhou Province of China

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 612-612 ◽  
Author(s):  
H.-C. Wang ◽  
W.-H. Li ◽  
M.-S. Wang ◽  
Q.-Y. Chen ◽  
Y.-G. Feng ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Management Practices ◽  
Northern China ◽  
Gray Mold ◽  
Guizhou Province ◽  
Universal Primers ◽  
Its2 Region ◽  
First Report ◽  
Nicotiana Tabacum L ◽  
Botryotinia Fuckeliana

Tobacco (Nicotiana tabacum L.) is a leafy, annual, solanaceous plant grown commercially for its leaves. Guizhou Province produces more than 30% of the total Chinese tobacco crop. In July 2010, a disease was observed in a commercial field of 5-month-old N. tabacum plants in Bijie, Guizhou in southwestern China. Symptoms first appeared on the leaves as small spots that later increased in size and developed into expanded, dark brown lesions covered with green-gray spore masses. Lesions expanded rapidly under cool, humid conditions. Isolates of Botrytis cinerea were collected from diseased leaves with typical symptoms. Diseased leaf samples were washed with distilled water three times, placed in a moist chamber, and incubated at 25°C in darkness for 48 h to encourage sporulation. Spores produced on leaves were transferred to individual agar discs (5 mm in diameter) with an inoculating needle and then the agar discs were transferred to potato dextrose agar (PDA) and incubated at 25°C for 7 days. Fungal colonies were at first colorless and later became gray to brown when the conidia differentiated. The size of conidia ranged from 5.0 to 9.5 × 6.5 to 12.5 μm (average 7.3 × 8.7 μm) based on 50 spore measurements. Microsclerotia produced in the culture were round or irregular and ranged from 1.2 to 3.0 × 1.0 to 2.5 mm (average 2.1 × 2.0 mm). The pathogen was identified as B. cinerea Pers.:Fr on the basis of morphology and sequence of ITS1-5.8s-ITS2 region of rDNA amplified by PCR using universal primers ITS-1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS-4 (5′-TCCTCCGCTTATTGATATGC-3′). The sequence (GenBank Accession No. HQ902163) exactly matched the sequences of two Botryotinia fuckeliana (anamorph B. cinerea) accessions, (e.g., GenBank Accession Nos. HM849615.1 and HM849047.1). Koch's postulates were conducted by wound inoculating five tobacco leaves (cv. K326) after surface disinfesting them with 5% NaOCl. Plugs of the fungus (5 mm in diameter) obtained from the colony margins were transferred onto 3 × 3 mm wounds made with a needle on the surface of five sterilized leaves. Inoculated leaves were incubated at 25°C, 100 to 120 μE·m–2·s–1, relative humidity >80%, and 16 h light per day for disease development. Typical symptoms developed on leaves within 7 days after inoculation. The pathogen was reisolated from affected leaves but not from the noninoculated control leaves. Botrytis gray mold blight has been recorded on N. tabacum in New Zealand, the United Kingdom, and northern China (1–3). However, to our knowledge, this is the first report of Botrytis blight on N. tabacum in Guizhou Province of China and the disease must be considered in existing disease management practices. References: (1) W. Brian et al. Mol. Plant Pathol. 8:561, 2007. (2) A. G. Mcleod et al. N. Z. J. Crop Hortic. Sci/Exp. Agric. 12:866, 1958. (3) Z. Y. Zhang. Page 37 in: Flora Fungorum Sinicorum. Vol. 26. Science Press, Beijing, 2006.

scholarly journals First Report of a Leaf Spot on Goldthread (Coptis chinensis) Caused by Phoma aquilegiicola in China

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1428-1428 ◽  
Author(s):  
Y. Yu ◽  
Z. C. Su ◽  
W. Z. Tan ◽  
C. W. Bi
Keyword(s):  
Leaf Spot ◽  
Pathogenic Fungus ◽  
Morphological Characteristics ◽  
Its Sequences ◽  
Leaf Margin ◽  
Herbaceous Plant ◽  
Pathogenicity Test ◽  
Coptis Chinensis ◽  
First Report ◽  
And Control

Goldthread (Coptis chinensis) is an important herbaceous plant in traditional Chinese medicine (3). Annual production of goldthread root is ~3,000 tons (dry weight) in China. The plant is cultivated extensively in Shizhu Co., Chongqing (29.98°E, 108.13°N), where goldthread yields account for more than 60% of total world production. A foliar disease was first observed on goldthread plants in 2008 in Shizhu County (5). In 2011 and 2012, about 10 ha of goldthread fields in different townships of Shizhu Co. were surveyed. The results demonstrated that the disease present in the fields was widespread at incidences of 30 to 100%, with yield losses of 15 to 75%. Typical symptoms included irregular, purple brown lesions on leaves, beginning usually at the leaf margin and extending to the central leaf blade. The lesions coalesced and turned deep purple. Black pycnidia were visible on the lesions, and severely diseased plants were usually wholly blighted. To identify the pathogen, infected leaves were collected from goldthread fields in different townships of Shizhu Co. and small pieces of symptomatic tissue were cut from each leaf. The leaf pieces were surface-disinfected for 1 min in 1.5% sodium hypochlorite, rinsed in sterilized water, air-dried, and transferred onto potato dextrose agar (PDA) plates with 0.5 g/liter of streptomycin sulfate. Thirty-three fungal isolates with similar colony morphology were obtained. On oatmeal agar plates, each colony was circular with a smooth edge, initially cream, and then pale-brown. Pycnidia were dark brown, spherical, with or without papillae, and 100 to 112 × 189 to 222 μm. Conidia were produced on short, straight, and aseptate conidiophores in the pycnidia; they were monocellular, hyaline, ellipsoidal or clavate, and 2.01 to 2.50 × 4.20 to 5.55 μm. Three isolates (SZ-9, SZ-10, and SZ-13) were selected randomly from all 33 isolates, and genomic DNA of each isolate was extracted following the CTAB method (4). The rDNA ITS region of each isolate was amplified with V9G/ITS4 primers and sequenced (1). The ITS sequences of the three isolates (GenBank Accession Nos. KF692355.2 [SZ-9], KF985236.1 [SZ-10], and KF985237.1 [SZ-13]) were identical, and BLAST revealed 100% identity with the ITS sequence of an isolate of Phoma aquilegiicola (CBS 107.96, GU237735.1). Based on the morphological characteristics and ITS sequences, all three isolates were identified as P. aquilegiicola. Pathogenicity test of 10 isolates was conducted by placing a 5-mm-diameter mycelial agar plug (from the margin of a 5-day-old PDA culture) on each of 10 fully-expanded leaves of healthy goldthread plants/isolate. Ten leaves were treated similarly with sterilized PDA plugs as a control. Inoculated and control plants were incubated in the dark for 24 h at 25 ± 2°C and >90% RH, and then maintained in a growth chamber at 25 ± 2°C, 3,100 lux, and >90% RH. The pathogenicity test was carried out three times. Symptoms developed on all inoculated leaves for all 10 isolates, but not on the control plants. Lesions were first visible 48 h after inoculation, and typical irregular lesions similar to those observed on field plants were seen after 6 days. The same pathogenic fungus was re-isolated from the infected leaves but not from the non-inoculated leaves. A disease caused by P. aquilegiicola was first reported on Aquilegia flabellata plants of the cv. Fan Columbine in a perennial garden in Italy (2). This is the first report of leaf spot on goldthread caused by P. aquilegiicola in China. Studies on the epidemiology and control of the disease are necessary owing to the economic significance of the host and destructiveness of the disease. References: (1) M. M. Aveskamp et al. Mycologia 101:363, 2009. (2) A. Garibaldi et al. Plant Dis. 95:880, 2011. (3) B. Liu et al. J. Pharmaceut. Biomed. 41:1056, 2006. (4) M. A. Saghai-Maaroof et al. Proc. Natl. Acad. Sci. USA. 81:8014, 1984. (5) X. R. Zhou et al. J. Shizhen Medicine Res. 23:471, 2012.

Sign in / Sign up

Export Citation Format

Share Document