First Report of Botrytis cinerea Causing Gray Mold of Tobacco in Guizhou Province of China

Tobacco (Nicotiana tabacum L.) is a leafy, annual, solanaceous plant grown commercially for its leaves. Guizhou Province produces more than 30% of the total Chinese tobacco crop. In July 2010, a disease was observed in a commercial field of 5-month-old N. tabacum plants in Bijie, Guizhou in southwestern China. Symptoms first appeared on the leaves as small spots that later increased in size and developed into expanded, dark brown lesions covered with green-gray spore masses. Lesions expanded rapidly under cool, humid conditions. Isolates of Botrytis cinerea were collected from diseased leaves with typical symptoms. Diseased leaf samples were washed with distilled water three times, placed in a moist chamber, and incubated at 25°C in darkness for 48 h to encourage sporulation. Spores produced on leaves were transferred to individual agar discs (5 mm in diameter) with an inoculating needle and then the agar discs were transferred to potato dextrose agar (PDA) and incubated at 25°C for 7 days. Fungal colonies were at first colorless and later became gray to brown when the conidia differentiated. The size of conidia ranged from 5.0 to 9.5 × 6.5 to 12.5 μm (average 7.3 × 8.7 μm) based on 50 spore measurements. Microsclerotia produced in the culture were round or irregular and ranged from 1.2 to 3.0 × 1.0 to 2.5 mm (average 2.1 × 2.0 mm). The pathogen was identified as B. cinerea Pers.:Fr on the basis of morphology and sequence of ITS1-5.8s-ITS2 region of rDNA amplified by PCR using universal primers ITS-1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS-4 (5′-TCCTCCGCTTATTGATATGC-3′). The sequence (GenBank Accession No. HQ902163) exactly matched the sequences of two Botryotinia fuckeliana (anamorph B. cinerea) accessions, (e.g., GenBank Accession Nos. HM849615.1 and HM849047.1). Koch's postulates were conducted by wound inoculating five tobacco leaves (cv. K326) after surface disinfesting them with 5% NaOCl. Plugs of the fungus (5 mm in diameter) obtained from the colony margins were transferred onto 3 × 3 mm wounds made with a needle on the surface of five sterilized leaves. Inoculated leaves were incubated at 25°C, 100 to 120 μE·m–2·s–1, relative humidity >80%, and 16 h light per day for disease development. Typical symptoms developed on leaves within 7 days after inoculation. The pathogen was reisolated from affected leaves but not from the noninoculated control leaves. Botrytis gray mold blight has been recorded on N. tabacum in New Zealand, the United Kingdom, and northern China (1–3). However, to our knowledge, this is the first report of Botrytis blight on N. tabacum in Guizhou Province of China and the disease must be considered in existing disease management practices. References: (1) W. Brian et al. Mol. Plant Pathol. 8:561, 2007. (2) A. G. Mcleod et al. N. Z. J. Crop Hortic. Sci/Exp. Agric. 12:866, 1958. (3) Z. Y. Zhang. Page 37 in: Flora Fungorum Sinicorum. Vol. 26. Science Press, Beijing, 2006.

Download Full-text

First Report of Fenhexamid-Resistant Botrytis cinerea Causing Gray Mold on Heurchera in a North American Greenhouse

Plant Disease ◽

10.1094/pdis-08-11-0721 ◽

2012 ◽

Vol 96 (1) ◽

pp. 147-147 ◽

Cited By ~ 10

Author(s):

G. W. Moorman ◽

A.-S. Walker ◽

S. May

Keyword(s):

Botrytis Cinerea ◽

Mode Of Action ◽

Gray Mold ◽

North Central ◽

First Report ◽

Group I ◽

Central Pennsylvania ◽

Commercial Operation ◽

Penn State ◽

Botryotinia Fuckeliana

Greenhouse-grown Heuchera plants, treated with fenhexamid (Decree, SePRO, Carmel, IN; FRAC group 17 hydroxyanilide), with active gray mold were submitted to the Penn State Plant Disease Clinic in December 2010 from a commercial operation in north-central Pennsylvania. Genetic and phenotypic analyses identified the isolate as Botrytis cinerea Pers. (teleomorph Botryotinia fuckeliana (de Bary) Whetzel), HydR3 phenotype (2) and not B. pseudocinerea (previously Botrytis group I) (4), naturally resistant to fenhexamid (phenotype HydR1) (1). While 0.2 μg of fenhexamid per ml or less is required to slow mycelial growth and germ tube elongation of sensitive isolates by 50% (EC50), the radial growth EC50 of the Heuchera isolate was approximately 2,000 μg of fenhexamid per ml in culture. Five cucumber seedlings receiving 25 μl of 0.1 M dextrose containing the label rate of Decree (1,800 μg/ml) on the growing tip were inoculated with colonized agar in the drop. Five check plants received 25 μl of 0.1 M dextrose. B. cinerea from silica gel storage since 1988 was also tested. This experiment was repeated three times. The 1988 isolate killed all fungicide-free but no fenhexamid-treated plants. The Heuchera isolate killed all fungicide-free and fenhexamid-treated plants within 4 days. To our knowledge, this is the first report of B. cinerea from a greenhouse in North America with fenhexamid resistance. Resistance occurs in U.S. fields (3). The Heuchera isolate's HydR3 resistance phenotype (2) has been detected in Germany, Japan, and France and has mutations affecting the 3-keto reductase protein, encoded by the erg27 gene, the specific target of fenhexamid and involved in Botrytis sterol biosynthesis. The Decree label states that it is to be used only twice on a crop before switching to a different mode of action. Greenhouses have resident Botrytis populations that are likely to be exposed to any fungicide applied in the structure. Growers should consider using fenhexamid only twice in a particular greenhouse, rather than on a particular crop, before switching to a different mode of action. References: (1) P. Leroux et al. Crop Prot. 18:687, 1999.(2) P. Leroux et al. Pest Manag. Sci. 58:876, 2002. (3) Z. Ma and T. J. Michailides. Plant Dis. 89:1083, 2005. (4) A.-S. Walker et al. Phytopathology 101:1433, 2011.

Download Full-text

First Report of Botrytis cinerea Causing Fruit Rot of Pyrus sinkiangensis in China

Plant Disease ◽

10.1094/pdis-06-13-0639-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 281-281 ◽

Cited By ~ 1

Author(s):

M. Zhang ◽

H. Y. Wu ◽

X. J. Wang ◽

B. Sun

Keyword(s):

Botrytis Cinerea ◽

Management Practices ◽

Economic Value ◽

Northern China ◽

Agricultural Science ◽

Fruit Rot ◽

Its Sequencing ◽

Commonwealth Mycological Institute ◽

Harvest Management ◽

Botryotinia Fuckeliana

Fragrant pear, Pyrus sinkiangensis Yu, is widely cultured in northern China, and is typically sweeter and of higher economic value than other pears. (2,3). In early October 2012, a fruit rot affecting approximately 30% of 300 kg of P. sinkiangersis produced in Korla orchards of Xinjiang was observed in a market of Zhengzhou, Henan Province, China. Early symptoms appeared as small, round, pale yellow-brown lesions on the fruit, which expanded from 10 to 20 mm diameter in 7 days. Later, affected fruit completely rotted and were covered with grey-white mycelium after 20 days. On the surface of mycelium, branched, septate conidiophores (2.0 mm tall and 13 to 15 μm thick) were produced. These were melanized at the base and hyaline near the apex. Conidia were hyaline, aseptate, ellipsoidal to obovoid, with a slightly protuberant hilum and ranged from 7 to 13.5 × 5.5 to 8.5 μm. One isolate of the pathogen (zm120286) was made by dispersing conidia on the potato dextrose agar (PDA) medium, directly removed from the sporulating tissue with thin needle. The colony was gray to white and produced blackish sclerotia at the edge of the colonies, which was 3.0 to 4.0 × 2.0 to 3.0 mm after 2 weeks of incubation at 22°C. The pathogen was identified as Botrytis cinerea Pers.:Fr on the basis of the morphology and ITS sequencing of rDNA (1,4). The sequence (GenBank Accession No. KF010847) was 100% identical to the sequences of two Botryotinia fuckeliana (anamorph: Botrytis cinerea) (e.g., GenBank Accession Nos. KC683713, HM849615). Koch's postulates were performed by placing a 5 mm diameter mycelia plug removed from the periphery of a 7-day-old colony of zm120286 on 10 surface-sterilized fresh fragrant pears collected from Korla orchards. An equal number of fresh fragrant pears were inoculated with 5 mm diameter plugs of PDA medium to serve as controls. All fragrant pears were incubated in clear plastic boxes with a dish of sterile distilled water at 25°C under ambient light. Symptoms identical to those described in the outbreak above were observed after 3 days. From each of the symptomatic pears, B. cinerea was recovered, whereas controls remained symptom-free. To our knowledge, this is the first outbreak of B. cinerea on P. sinkiangersis in China, which may necessitate the development of pre-harvest management practices. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, 1971. (2) X.W. Li et al. Chinese Agricultural Science Bulletin, 26(15):100-102, 2010. (3) T. Yu and K. Kuan. Acta Phytotaxon. Sin. 8: 202, 1963. (4) Z. Y. Zhang. Flora Fungorum Sinicorum. Vol. 26. Botrytis, Ramularia. Science Press, Beijing, 2006.

Download Full-text

First Report of Gray Mold of Blackberry Caused by Botrytis cinerea in South Carolina

Plant Disease ◽

10.1094/pdis-06-11-0530 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1592-1592 ◽

Cited By ~ 1

Author(s):

X. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Signs And Symptoms ◽

Gray Mold ◽

Fluorescent Light ◽

Its2 Region ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

First Report ◽

Control Fruit

Botrytis cinerea Pers.: Fr. is a causal agent of gray mold of blackberry but may also affect grapevine, tomato, bulb flowers, and ornamental crops (2). In August 2010, blackberries (Rubus fruticosus and other species) showing gray mold symptoms were found in Longcreek, Six Mile, and Cheddar, SC. Symptomatic blackberry fruit exhibited patterns of brown-to-gray mycelia and conidiophores. Upon isolation, the mycelium grew at a rate of 12.3 mm per day at 22°C on potato dextrose agar, forming pale white-to-gray colonies with concentric rings and conidiophores (less than 12 h of fluorescent light per day). Some isolates formed dark brown sclerotia in the dark after 18 days. The lemon-shaped spores averaged 12 × 9 μm and were consistent with descriptions of B. cinerea. (1) The ribosomal internal transcribed spacer (ITS) ITS1-5.8S-ITS2 region was amplified via PCR from genomic DNA obtained from mycelia using primers ITS1 and ITS4. A BLAST search in GenBank revealed highest similarity (99 to 100%) to sequences from various Botrytis spp. collected in China, Canada, and Spain (GenBank Accession Nos. FJ169666.1, GU934505.1, and EF207414.1). The ITS sequence amplified from the blackberry isolate was submitted to GenBank (Accession No. JN164269). The pathogen was further identified to the species level as B. cinerea using glyceraldehyde-3-phosphate dehydrogenase, heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) gene sequences (2) (GenBank Accession Nos. JN164270, JN164271, JN164272). Pathogenicity was confirmed by inoculating three surface-sterilized (soaked in 5% bleach for 15 min), mature blackberry fruit (R. fruticosus) with a conidial suspension (105 spores/ml) of the blackberry isolate. A 20-μl droplet was placed on the fruit; control fruit received sterile water without conidia. After 5 days of incubation at room temperature in an air-tight Magenta box, the inoculated fruit developed typical signs and symptoms of gray mold. The developing spores on inoculated fruit were confirmed to be B. cinerea. All control fruit remained healthy. To our knowledge, this is the first report of B. cinerea on blackberry in South Carolina. The disease must be managed with fungicides to obtain high quality fruit with market-requested shelf life. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 17, 2011. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold Disease on Peach from Pakistan

International Journal of Phytopathology ◽

10.33687/phytopath.007.03.2668 ◽

2018 ◽

Vol 7 (3) ◽

pp. 131-131

Author(s):

Raees Ahmed ◽

Amjad S. Gondal ◽

Muhammad Tariq Khan ◽

Shazia Shahzaman ◽

Sajjad Hyder

Keyword(s):

Botrytis Cinerea ◽

Mycelial Growth ◽

Agar Medium ◽

Management Strategies ◽

Gray Mold ◽

First Report ◽

Average Production ◽

Conducive Environment ◽

Hyphal Tip ◽

Important Disease

Gray mold caused by Botrytis cinerea is an important disease that attacks fruits, leaves and twigs of peach. Peach is grown on an area of 18,008 ha with an average production of 72,085 tons per year in Pakistan (FAO, 2017). During May 2017, brown spots on 33% of the peach fruits examined were observed in Swat district of KPK province of Pakistan. Infected fruits were incubated at 25±2 °C in a humid chamber resulted in greyish mycelial growth with light brown lesions. Hyphal growths on infected fruits were cultured on PDA media and purified by hyphal tip method. Morphologically whitish grey growth was observed on PDA and later on dark sclerotia were observed after 6-7 days of incubation. Hyphae were found septate with branched hyaline conidiophores having a bunch of ovoid conidia at their tips. Further confirmations were done by amplifying internal transcribed spacer regions (Andrew et al., 2009) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) region of the isolates (Li et al., 2012). Amplicons sequenced from Macrogen Korea were blasted and submitted in NCBI showed that ITS sequences (Accessions MH049690 and MH049691) were 99% identical with already reported (MG878388 and MG654661) sequences and the G3PDH gene sequences (Accessions MH560352 and MH560353) were 99 % identical with already reported (Accessions MG204876) sequences of B. cinerea. Pathogenicity was confirmed on healthy peach fruits disinfected with 50% ethanol, inoculated by placing a plug of about 1cm2 taken from the edge of actively growing B. cinerea isolate (BTS-16). Fruits were incubated at 25±2 °C in a humid chamber (Abata et al., 2016). A set of healthy fruits mock-inoculated with a plug of agar medium were used as control. Three days after inoculation, inoculated fruits showed sunken lesions with cottony greyish mycelial growth on their surface. Fungus isolated from these infections was re-confirmed as B. cinerea. Conducive environment for the disease progression in nearby areas can result into a huge loss in peach produce so there is a need to devise management strategies to cope with the pathogen. This is the first report of gray mold disease of peach caused by B. cinerea from Pakistan.

Download Full-text

First Report of Gray Mold on Allium victorialis var. platyphyllum Caused by Botrytis cinerea in Korea

Plant Disease ◽

10.1094/pdis-07-16-1051-pdn ◽

2017 ◽

Vol 101 (1) ◽

pp. 256-256

Author(s):

M. Aktaruzzaman ◽

Y. G. Lee ◽

T. Afroz ◽

B. S. Kim ◽

H. D. Shin

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

First Report

Download Full-text

First Report of Pythium aphanidermatum Causing Stalk Rot on Abelmoschus manihot (L. ) Medic in China

Plant Disease ◽

10.1094/pdis-06-21-1133-pdn ◽

2021 ◽

Author(s):

Qing Qu ◽

Liu Shiwei ◽

Ning Liu ◽

Yunxia Liu ◽

Jia Hui ◽

...

Keyword(s):

Management Practices ◽

Vascular System ◽

Morphological Characteristics ◽

Pythium Aphanidermatum ◽

Negative Control ◽

Perennial Herb ◽

Universal Primers ◽

First Report ◽

Stalk Rot ◽

Aerial Hyphae

Abelmoschus manihot (Linn. ) Medicus (A. manihot) is an annual to perennial herb of the Malvaceae okra, mainly distributed in Guangdong, Guangxi, Fujian, Hunan, Hubei provinces. It can not only be used as an ornamental flower, but also has important economic and medicinal value. Last year, 10% A. manihot in 1,000 acres were observed with stalk rot in the Zhongshang Agricultural Industrial Park, 50 meters east of Provincial Highway 235 in Gaoyang County of Hebei province. Internal discoloration of the stem began brown to black discoloration of the vascular system and became hollow, with the mycelium growing on the surface. Stems from symptomatic plants (approximately 5 mm2) were dissected, washed free of soil, then soaked in 75% ethanol for 16 s to surface-sterilize, and 40 s in HgCl2, then rinsed three times in sterile water. After being dried with blotting paper, five pieces were placed on potato dextrose agar (PDA). After cultured 2 or 3 days, five isolates were purified and re-cultured on PDA in the dark at 25°C. The color of the colony was white. The hyphae were radial in PDA, and the aerial hyphae were flocculent, well-developed with luxuriant branches. The colonies were white and floccus, and the aerial hyphae were well developed, branched and without septum on corn meal agar (CMA). The sporangia were large or petal shaped, composed of irregular hyphae, terminal or intermediate , with the size of (31.6-88.4) μm ×(12.7- 14.6) μm. Vesicles were spherical, terminal or intermediate, ranging from 14.6 to 18.5μm. Oogonia were globose, terminal and smooth which stipe was straight. Antheridia were clavate or baggy and mostly intercalary, sometimes terminal. Oospores were aplerotic, 21.5 to 30.0 μm in diameter, 1.6 to 3.1 μm in wall thickness. The isolates morphological characteristics were consistent with P. aphanidermatum (van der Plaats-Niterink 1981, Wu et al. 2021 ). To identify the isolates, universal primers ITS1/ITS4 (White et al. 1993) were used for polymerase chain reaction–based molecular identification. The amplification region was sequenced by Sangon Biotech (Shanghai, China) and submitted to GenBank (MW819983). BLAST analysis showed that the sequence was 100% identical to Pythium aphanidermatum. Pathogenicity tests were conducted 3 times, with 4 treatments and 2 controls each time. The plants treated were 6 months old. Then the hyphae growing on PDA for 7 days were cut into four pieces. Next, they were inoculated into the soil of the A. manihot. Negative control was inoculated only with PDA for 7 days ( Zhang et al. 2000). The plants were then placed in a greenhouse under 28°C, 90% relative humidity. After inoculated 20 to 30 days, the infected plants showed stalk rot, the same symptoms as observed on the original plants. The control plants didn’t display symptoms. Pythium aphanidermatum was re-isolated from infected stems and showed the same characteristics as described above and was identical in appearance to the isolates used to inoculate the plants. To our knowledge, this is the first report of Pythium aphanidermatum infecting A. manihot stem and causing stalk rot in China. It may become a significant problem for A. manihot. Preliminary management practices are needed for reducing the cost and losses of production.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

Characterization of Botrytis cinerea From Commercial Cut Flower Roses

Plant Disease ◽

10.1094/pdis-09-18-1623-re ◽

2019 ◽

Vol 103 (7) ◽

pp. 1577-1583 ◽

Cited By ~ 7

Author(s):

M. Muñoz ◽

J. E. Faust ◽

G. Schnabel

Keyword(s):

Botrytis Cinerea ◽

Fungicide Resistance ◽

Management Practices ◽

Cultural Practices ◽

Disease Incidence ◽

Resistance Management ◽

Gray Mold ◽

Economic Losses ◽

Cut Flower ◽

Aspergillus Brasiliensis

Botrytis cinerea Pers. infects cut flower roses (Rosa × hybrida L.) during greenhouse production and gray mold symptoms are often expressed in the postharvest environment, resulting in significant economic losses. Disease management is based on cultural practices and preventative chemical treatments; however, gray mold outbreaks continue to occur. Rose tissues from six commercial shipments from two greenhouses in Colombia were evaluated to determine the Botrytis species composition as well as identify other pathogens present, gray mold incidence and severity, and fungicide resistance profiles. Botrytis isolates (49 total) were grouped into six morphological phenotypes, and all were identified to be B. cinerea sensu stricto. Disease incidence was higher in the petals than in the stem, stamen, ovary, sepal, or leaf tissues. Other fungi were isolated infrequently and included Alternaria alternata, Cladosporium cladosporioides, Epicoccum nigrum, Penicillium citrinum, Aspergillus brasiliensis, and Diplodia sp. Fungicide resistance profiles were determined using previously established discriminatory doses. Isolates resistant to thiophanate-methyl, iprodione, boscalid, and cyprodinil were found frequently in all shipments and in both greenhouses. The frequency of resistance to penthiopyrad, fenhexamid, fluopyram, isofetamid, and fludioxonil varied between shipments and greenhouses. No resistance to pydiflumetofen was observed at the discriminatory doses tested. Isolates with resistance to multiple chemical classes were commonly found. These results indicate that fungicide resistance management practices may improve preharvest and postharvest gray mold control of cut flower roses.

Download Full-text