scholarly journals First Report of the Root-Knot Nematode, Meloidogyne enterolobii, on Sweet potato in Guangxi Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Luming Jia ◽  
H.Y. Wu
Keyword(s):  
Population Density ◽  
Species Identification ◽  
Sweet Potato ◽  
Potato Variety ◽  
Rrna Genes ◽  
Food Crop ◽  
Guangxi Province ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii

Sweet potato (Ipomoea batatas Lam.) is the seventh most widely cultivated food crop in the world and the sixth most widely cultivated food crop in China. In June 2021, sweet potato plants were found to be displaying nutrient deficiencies with red leaves in a sweet potato field in Hepu County, Beihai City, Guangxi Province (21°37′43.41"N，109°10′58.74"E). Black irregular protuberant scars on tubers and nodular galls on roots were found. Thirty-five sweet potato ‘Variety Guiziweishu No. 1’ tubers were randomly collected and 97% were infected with root-knot nematodes. Females (n = 20) had perineal patterns that were oval, with moderate to high dorsal arches, the lateral field was not obvious or absent. Morphological measurement of females (n = 20) were made from micrographs taken with a microscope (Axio Imager, Z2, ZEISS). Measurements (mean + standard error) were: body length (BL) = 932.8 ± 18.4 μm; maximum body width (BW) = 588.8 ± 22.0 μm; vulval slit length = 19.6 ± 0.6 μm; and, vulval slit to anus distance = 22.3±0.8 μm. Morphological measurements of second-stage juveniles (J2; n = 20) were: BL =512.0± 5.9 μm; BW = 17.4 ± 0.6 μm; Stylet length = 13.4 ± 0.2 μm; dorsal pharyngeal gland orifice to stylet base (DGO) =3.4 ± 0.0 μm; and, hyaline tail length = 17.6 ± 0.5 μm. These morphological characteristics fit those of the original description for Meloidogyne enterolobii (Yang and Eisenback 1983). Molecular analyses were conducted to confirm species identification. Genomic DNA was extracted from 12 single J2 (Luo et al. 2020). The rDNA-internal transcribed spacer (ITS) region was sequenced using primers V5367/26S (5′-TTGATTACGTCCCTGCCCTTT-3′/5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al. 1992), and the D2–D3 fragment of the 28S rRNA genes using primers D2A/D3B (5′-GTACCGTGAGGGAAAGTTG-3′/5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al. 1999). The target gene sequences were 733 bp (GenBank accession no. MZ413814) and 733 bp (MZ411468), respectively; they were all 99-100% similar to those of M. enterolobii sequences available in the GenBank. Species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (5′-AACTTTTGTGAAAGTGCCGCTG-3′/5′-TCAGTTCAGGCAGGATCAACC-3′). The electrophoresis results showed a bright band (∼200 bp) only in the lane with the M. enterolobii-specific primers, similar in size to that previously reported for M. enterolobii (Long et al. 2006). Therefore, this Meloidogyne sp. population on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. To verify the pathogenicity of nematodes, sweet potato ‘Variety Guiziweishu No. 1’ seedlings were individually planted in 18 cm diameter, 11 cm deep plastic pots containing 1000 cm3 autoclaved sandy soil (sand/soil = 3:1). A total of 15 seedlings were inoculated with 10,000 eggs (the population was same with nematode population in soil the field) and 5 seedlings without eggs were used as a control. Plants were maintained at 25-28°C in a greenhouse. After 2 months, root of inoculated plants exhibited elongated swellings similar to symptoms observed in the field. The noninoculated plants did not have any galls or swelling. A reproduction factor (nematode final population density/initial population density) value of 18.6 was obtained. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in Guangxi Province. In 2014, the nematode on sweet potato was reported in Guangdong Province (Gao et al. 2014). Guangxi Province is the largest producer of sweet potato in south China and is the third top producing region in the whole country. Meloidogyne enterolobii is a potential risk to the production of sweet potato in this region, and control measures are needed to prevent any further spread.

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Analisis Nutrisi Umbi Ubi Jalar (Ipomoea batatas (L.) Lam.) untuk Konsumsi Bayo dan Anak-anak Suku Dani di Distrik Kurulu Kabupaten Jayawijaya

Agrotek ◽  
2018 ◽  
Vol 3 (2) ◽  
Author(s):  
Andrew B. Pattikawa ◽  
Antonius Suparno ◽  
Saraswati Prabawardani
Keyword(s):  
Sweet Potato ◽  
Ipomoea Batatas ◽  
Nutritional Value ◽  
Animal Feed ◽  
Ash Content ◽  
Infants And Children ◽  
Chemical Analyses ◽  
Food Crop ◽  
Sweet Potatoes ◽  
Development Center

<em>Sweet potato is an important staple food crop especially for the local people of Central Highlands Jayawijaya. There are many accessions that have always been maintained its existence to enrich their various uses. Traditionally, sweet potato accessions were grouped based on the utilization, such as for animal feed, cultural ceremonies, consumption for adults, as well as for infants and children. This study was aimed to analyze the nutritional value of sweet potatoes consumed by infants and children of the Dani tribe. Chemical analyses were conducted at the Laboratory of Post-Harvest Research and Development Center, Cimanggu, Bogor. The results showed that each of 4 (four) sweet potato accessions which were consumed by infants and children had good nutrient levels. Accession Sabe showed the highest water content (72.56%), vitamin C (72.71 mg/100 g), Fe (11.85 mg/100 g), and K levels (130.41 mg / 100 grams). The highest levels of protein (1.44%), fat (1.00%), energy (154.43 kkal/100 gram), carbohydrate (35.47%), starch (30.26%), reducing sugar (3.44%), riboflavin (0.18 mg/100 g), and vitamin A (574.40 grams IU/100 were produced by accession Manis. On the other hand, accession Saborok produced the highest value for ash content (1.32%), vitamin E (28.30 mg/100 g), and ?-carotene (64.69 ppm). The highest level of crude fiber (1.81 %) and thiamin (0.36 mg/100 g) was produced by accession Yuaiken.</em>

scholarly journals First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 698-698 ◽  
Author(s):  
Y. Tomitaka ◽  
T. Usugi ◽  
R. Kozuka ◽  
S. Tsuda
Keyword(s):  
Nucleotide Sequence ◽  
Solanum Lycopersicum ◽  
Mosaic Disease ◽  
Causal Agent ◽  
Cultivated Plants ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
Tomato Plants ◽  
First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

scholarly journals Preference of red mite Tetranychus ludeni Zacher (Acari: Tetranychidae) to sweet potato genotypes

2019 ◽  
Vol 79 (2) ◽  
pp. 208-212 ◽  
Author(s):  
B. M. C. Castro ◽  
M. A. Soares ◽  
V. C Andrade Júnior ◽  
V. C. Santos Júnior ◽  
P. C. R. Fontes ◽  
...  
Keyword(s):  
Population Density ◽  
Sweet Potato ◽  
Ipomoea Batatas ◽  
Germplasm Bank ◽  
Tetranychus Ludeni ◽  
Density Rate

Abstract Tetranychus ludeni damages the sweet potato. Pest development can vary between plant genotypes. The objective was to identify the preference of Tetranychus ludeni for Ipomoea batatas genotypes, from the germplasm bank at the Universidade Federal dos Vales do Jequitinhonha e Mucuri (UFVJM). Natural infestations of this mite were observed on 54 sweet potato genotypes in potted, in a greenhouse. Three mite-infested leafs of each genotype were collected and analyzed. The red mite showed different population density rate in genotypes. The BD 29 genotype was found to be highly susceptible, the BD 08, BD 57, BD 17 and Espanhola genotypes were moderately susceptible, and the others forty-nine genotypes showed low susceptibility to the mite.

scholarly journals First report of Cherry virus F infecting Japanese plum in Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Yeonhwa Jo ◽  
Hoseong Choi ◽  
Jin Kyong Cho ◽  
Won Kyong Cho
Keyword(s):  
Czech Republic ◽  
High Throughput Sequencing ◽  
Prunus Avium ◽  
De Novo ◽  
Protein Database ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Japanese Plum ◽  
Leaf Spots

Cherry virus F (CVF) is a tentative member of the genus Fabavirus in the family Secoviridae, consisting of two RNA segments (Koloniuk et al. 2018). To date, CVF has been documented in only sweet cherry (Prunus avium) in the Czech Republic (Koloniuk et al. 2018), Canada, and Greece. In May 2014, we collected leaf samples from four symptomatic (leaf spots and dapple fruits) and two asymptomatic Japanese plum cultivars (Sun and Gadam) grown in an orchard in Hoengseong, South Korea, to identify viruses and viroids infecting plum trees. Total RNA from individual plum trees was extracted using two commercial kits: Fruit-mate for RNA Purification Kit (Takara, Shiga, Japan) and RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). We generated six mRNA libraries from the six different plum cultivars for RNA-sequencing using the TruSeq RNA Library Preparation Kit v2 (Illumina, CA, U.S.A.) as described previously (Jo et al. 2017). The mRNA libraries were paired-end (2 X 100 bp) sequenced with a HiSeq 2000 system (Macrogen, Seoul, Korea). The raw sequence reads were de novo assembled by Trinity program v. 2.8.6, with default parameters (Haas et al. 2013). The assembled contigs were subjected to BLASTX search against the non-redundant protein database in NCBI. Of the two asymptomatic cultivars, the transcriptome of asymptomatic plum cv. Gadam contained five contigs specific to CVF. Two and three contigs were specific to CVF RNA1 (2,571 reads, coverage 42.15%) and RNA2 (2,025 reads, coverage 53.04%), respectively. The size of these five contigs ranged from 241 to 5,986 bp. Contigs of 5,986 and 3,867 bp in length, referred to as CVF isolate Gadam RNA1 (GenBank MN896996) and RNA2 (GenBank MN896995), respectively, were subjected to BLASTP search against NCBI’s non-redundant protein database. The results showed that the polyprotein sequences of RNA1 and RNA2 shared 95.3% and 93.11% amino acid identities with isolates SwC-H_1a from the Czech Republic (GenBank acc. no. AWB36326) and Stac-3B_c8 from Canada (AZZ10055), respectively. To confirm the infection of CVF in cv. Gadam, RT-PCR was conducted using CVF RNA1-specific primers designed based on the CVF reference genome sequences (MH998210 and MH998216), including 5’-CCACCAAATAGGCAAGAGGTCAC-3’ (position 3190–3212) and 5’-CACAATCACCATCAATGGTCTCTGC-3’ (position 3742–3766), and CVF RNA2-specific primers, including 5’-CTGCTTTATGATGCTAGACATCAAGATG-3’ (position 1015–1042) and 5’-ACAATAGGCATGCTCATCTCAACCTC-3’ (position 1594–1619). We amplified 577-bp RNA1-specific and 605-bp RNA2-specific amplicons that were cloned and then performed Sanger sequencing. Sequencing of the cloned amplicons for isolate Gadam RNA1 (GenBank MN896993) and RNA2 (GenBank MN896994) revealed values of 99.48% and 99.17% nucleotide identity to that of RNA1 and RNA2 determined by high-throughput sequencing, respectively. Additionally, we tested five plants for each of the six plum cultivars grown in the same orchard. The detection of CVF was carried out through PCR using the primers and protocol described above. Of the 30 trees, CVF was detected in three trees of cv. Gadam by both primer pairs. To our knowledge, this is the first report of CVF infecting Japanese plum and the first report of the virus in Korea. However, its prevalence in other Prunus species, including apricot, European plum, and peach, should be further elucidated.

scholarly journals First Report of Cucurbit yellow stunting disorder virus in Morocco

Plant Disease ◽  
2000 ◽  
Vol 84 (5) ◽  
pp. 596-596 ◽  
Author(s):  
C. Desbiez ◽  
H. Lecoq ◽  
S. Aboulama ◽  
M. Peterschmitt
Keyword(s):  
Important Change ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yellow Leaf ◽  
Vegetable Crops ◽  
Specific Primers ◽  
First Report ◽  
Large Populations ◽  
Healthy Control ◽  
Symptomless Plant ◽  
Beet Pseudo Yellows Virus

In October, 1999, severe yellowing symptoms were observed in a melon (Cucumis melo L.) crop grown under plastic tunnels in the region of Agadir, Morocco. Large populations of whiteflies (Bemisia tabaci) were noticed during the early stages of the crop. At harvest, leaf samples were collected from two symptomatic plants and one symptomless plant. A mature yellow leaf was assayed from each symptomatic plant and for one of these two plants a younger leaf exhibiting only yellow spots. Cucurbit aphid-borne yellows virus, which causes similar symptoms in melons, was not detected by double-antibody sandwich enzyme-linked immunosorbent assay tests. Total RNA was extracted from fresh leaf tissues and submitted to reverse transcription and polymerase chain reaction with primers specific to two whitefly-transmissible viruses: Beet pseudo-yellows virus (BPYV) and Cucurbit yellow stunting disorder virus (CYSDV) (2). No amplification was obtained with BPYV-specific primers. In contrast, an expected 465-bp product was amplified in all samples from symptomatic plants with CYSDV-specific primers. No amplification was detected in samples from the symptomless plant nor from healthy control plants. B. tabaci-transmitted CYSDV has been reported in the Middle East, southwestern Europe, and North America (1,4). This is the first report of CYSDV in Morocco, and it follows the first report of another B. tabaci-transmitted virus, Tomato yellow leaf curl virus, in tomato (3), suggesting an important change in the viral pathosystem affecting vegetable crops in Morocco. References: (1) Kao et al. Plant Dis. 84:101, 2000. (2) Livieratos et al. Plant Pathol. 47:362, 1998. (3) Peterschmitt et al. Plant Dis. 83:1074, 1999. (4) Wisler et al. Plant Dis. 82:270, 1998.

scholarly journals First Report of Colletotrichum acutatum on Tomato and Apple Fruits in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (5) ◽  
pp. 769-769 ◽  
Author(s):  
J. Víchová ◽  
B. Staňková ◽  
R. Pokorný
Keyword(s):  
Czech Republic ◽  
Tomato Fruit ◽  
Colletotrichum Acutatum ◽  
Distilled Water ◽  
Species Determination ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Pcr Products ◽  
Apple Fruits

Apple (Malus domestica Borkh.) is a fruit traditionally grown in the Czech Republic, and tomatoes (Solanum lycopersicum Mill.), too, are widely raised in this region. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. Earlier, this pathogen caused disease on strawberry in the Czech Republic (2), and now it has become an important pathogen on safflower (4). During the 2010 harvest, anthracnose symptoms were noticed on the fruits of apple and tomato. Infected apples fruits (localities Velká Bíteš and Znojmo) and tomatoes (localities Velká Bíteš and Žabčice) were collected. Typical symptoms on fruit surfaces were round, brown, shriveled and sunken spots, 1.2 to 2.0 cm, with orange conidial masses appearing on the spots. A fungus was isolated from each host on potato dextrose agar and cultured at 25 ± 2°C for 10 days. Mycelium was superficial, partly immersed, and white to gray with occurrence of orange conidial masses. Conidia of the tomato and apple isolates were colorless and fusiform. The size of conidia from the apple and tomato isolates, respectively, ranged from 11 to 15 × 2.5 to 3.5 μm and 11 to 16 × 2.5 to 4 μm. Morphological characteristics suggested that the isolated fungi was a Colletotrichum sp. To fulfill Koch's postulates, healthy tomato and apple fruits were disinfected with 3% sodium hypochlorite for 2 min and rinsed in sterile distilled water. Fruits were pinpricked with a sterile needle and 10 μl of a spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity of 70 ± 5%, and a photoperiod of 12 h. Similar disease symptoms as in the collected fruits were observed on tomato fruits at 7 days and apple fruits at 20 days after inoculation, while no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded a PCR product (450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the tomato fruit isolate (Accession No. JN676199) and apple fruit isolate (Accession No. JN676198) matched with 100% similarity to the C. acutatum sequences in GenBank. The control isolate of C. gloeosporioides matched 100% to sequences AJ749682 and AJ749692. To our knowledge, this is the first report of C. acutatum on tomato and apple fruits in the Czech Republic. This pathogen can endanger the production and storage of apples and tomatoes in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 95:79, 2011.

Sign in / Sign up

Export Citation Format

Share Document