First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

Download Full-text

First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Plant Disease ◽

10.1094/pdis-05-20-0932-pdn ◽

2021 ◽

Author(s):

Xiaohui Sun ◽

Ning Qiao ◽

Xianping Zhang ◽

Lianyi Zang ◽

Dan Zhao ◽

...

Keyword(s):

Natural Infection ◽

Pcr Analysis ◽

Control Group ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Tomato Chlorosis Virus ◽

Cucurbit Chlorotic Yellows Virus

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

Download Full-text

First Report of Tomato yellow leaf curl virus in China

Plant Disease ◽

10.1094/pd-90-1359c ◽

2006 ◽

Vol 90 (10) ◽

pp. 1359-1359 ◽

Cited By ~ 39

Author(s):

J. B. Wu ◽

F. M. Dai ◽

X. P. Zhou

Keyword(s):

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Mosaic Disease ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Yellow Mosaic Disease ◽

Tomato Plants ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus

Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (2). In China, however, there has as yet been no report of this virus, although other begomoviruses have been reported infecting tomato (1,3). A yellow mosaic disease was observed on tomato with 90% disease incidence during March 2006 in fields of Sunqiao, Shanghai Province, China. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) tests indicated that tomato plants were not infected by Tomato mosaic virus or Cucumber mosaic virus. Tomato plants were found to be infested with Bemisia tabaci, suggesting a begomovirus etiology. The disease agent was transmitted to tomato by whiteflies and produced yellow mosaic and stunting symptoms that were identical to those observed in the field. Total DNA was isolated from eight collected leaf samples. Polymerase chain reaction (PCR) was performed with begomovirus degenerate primers PA and PB (3), and an amplicon of the expected size (~500 bp) was obtained in all eight samples but not from healthy leaf samples. The PCR products from two samples (SH1 and SH2) were cloned and sequenced. All residues in the sequences were confirmed by comparison of duplicate clones. Alignment of the sequences showed that they shared 97.4% nucleotide sequence identity (GenBank Accession No. AM282874–75), suggesting that they were infected by an identical virus. Overlapping primers Full/F (5′-AGCCCAATACATTGGGCC ACGA-3′) and Full/R (5′-CGTAAGTTTCCTCAACGGACTGC-3′) were then designed to amplify the full length DNA-A of SH2. The sequence was determined to be 2,781 nucleotides long (GenBank Accession No. AM282874). A comparison with other begomoviruses shows SH2 DNA-A has the highest nucleotide sequence identity (99.8%) with TYLCV isolate Tosa from Japan (GenBank Accession No. AB192966). The above results indicate that the virus associated with yellow mosaic disease of tomato in Shanghai is an isolate of TYLCV. To our knowledge, this is the first report of TYLCV in China and the first report of a begomovirus in Shanghai. References: (1) X. F. Cui et al. J. Virol. 78:13966, 2004. (2) E. Moriones and J. Navas-Castillo. Virus Res. 71:123, 2000. (3) Z. H. Li et al. Arch. Virol. 149:1721, 2004.

Download Full-text

First Report of Cucumber mosaic virus on Jatropha curcas in India

Plant Disease ◽

10.1094/pdis-92-1-0171c ◽

2008 ◽

Vol 92 (1) ◽

pp. 171-171 ◽

Cited By ~ 16

Author(s):

S. K. Raj ◽

S. Kumar ◽

S. K. Snehi ◽

U. Pathre

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Jatropha Curcas ◽

Leaf Tissue ◽

Mosaic Disease ◽

Biodiesel Fuel ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Gel Diffusion

Jatropha curcas L. is a major commercial biodiesel fuel crop grown on 98 million acres (39.66 million ha) in India. Severe mosaic disease accompanied by yellow spots was noticed on 15% of J. curcas growing in the experimental plots of NBRI, Lucknow, India, during October of 2006. Inoculations with sap from symptomatic plants resulted in systemic mosaic on three of seven J. curcas seedlings. Gel diffusion tests were performed with antiserum to Cucumber mosaic virus (CMV), Tobacco ringspot virus, and Chrysanthemum virus B (PVAS-242a, PVAS-157, and PVAS-349, respectively; ATCC, Manassas, VA). Leaf sap of infected plants reacted only with PVAS-242a, indicating the presence of CMV. Reverse transcription (RT)-PCR assays with CMV coat protein gene specific primers (Genbank Accession Nos. AM180922 and AM180923) and total nucleic acid extracted from symptomatic J. curcas leaf tissue yielded the expected ~650-bp amplicon, which was cloned and sequenced (GenBank Accession No. EF153739). BLAST analysis indicated 98 to 99% nucleotide identity with CMV isolates (GenBank Accession Nos. DQ914877, DQ640743, AF350450, AF281864, X89652, AF198622, DQ152254, DQ141675, and DQ028777). Phylogenetic analysis showed that the J. curcas isolate was more closely related to Indian isolates of CMV belonging to subgroup Ib. Literature surveys revealed records of Jatropha mosaic virus on J. gossypiifolia in Puerto Rico (1) and on J. curcas in India (2). To our knowledge, this is the first report of CMV on J. curcas. References: (1) J. K. Brown et al. Arch. Virol. 146:1581, 2001. (2) D. S. A. Narayana et al. Curr. Sci. 91:584, 2006.

Download Full-text

First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Plant Disease ◽

10.1094/pdis-92-4-0648a ◽

2008 ◽

Vol 92 (4) ◽

pp. 648-648 ◽

Cited By ~ 3

Author(s):

R. L. Jordan ◽

M. A. Guaragna ◽

T. Van Buren ◽

M. L. Putnam

Keyword(s):

United States ◽

Amino Acid ◽

Mosaic Virus ◽

The United States ◽

Cdna Clones ◽

Gene Products ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

First Report

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

Download Full-text

First Report of Garlic virus X in Garlic Plants in Brazil

Plant Disease ◽

10.1094/pdis-08-13-0845-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1013-1013 ◽

Cited By ~ 4

Author(s):

M. L. Oliveira ◽

M. I. M. Hoffmann ◽

T. Mituti ◽

M. A. Pavan ◽

R. Krause-Sakate

Keyword(s):

Nucleotide Sequence ◽

Minas Gerais ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr ◽

Specific Primers ◽

Capsid Protein Gene ◽

First Report ◽

Cp Gene ◽

Garlic Virus

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5′ CTACCACAAYGGNTCVTC 3′) and Cpallexi-anti1 (5′ CACNGCGTTRAAGAARTC 3′) specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5′ GCAGAATAARCCCCCYTC 3′) and CPBA1 (5′ RAAGGGTTTATTCTGTTG 3′) obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5′ GCCTTCTGAAAATGACTTAG 3′) and CPXA1 (5′ CTAGGATTTGCTGTTGGG 3′) designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Download Full-text

First Report of Capsicum chlorosis virus Infecting Tomato in Taiwan

Plant Disease ◽

10.1094/pdis-04-10-0275 ◽

2010 ◽

Vol 94 (10) ◽

pp. 1263-1263 ◽

Cited By ~ 7

Author(s):

C.-H. Huang ◽

Y.-X. Zheng ◽

Y.-H. Cheng ◽

W.-S. Lee ◽

F.-J. Jan

Keyword(s):

Amino Acid ◽

Amino Acid Identity ◽

N Gene ◽

Rt Pcr ◽

Degenerate Primers ◽

Tomato Plants ◽

Acid Identity ◽

First Report ◽

Conserved Region ◽

Capsicum Chlorosis Virus

In December 2009, two samples from tomato plants (Solanum lycopersicum cv. Known-you 301) showing symptoms of chlorosis and necrosis on leaves were collected from two different fields that exhibited 5% disease incidence in Wufeng Township, Taichung County. Reverse transcription (RT)-PCR was applied to detect the presence of potential viruses in collected samples using three degenerate primers (3), gL3637/gL4435c for tospoviruses, Tob-Uni1/Tob-Uni2 for tobamoviruses, and Hrp5/Pot1 for potyviruses, and one specific primer, FJJ2001-7/FJJ2001-8, for the coat protein gene of Cucumber mosaic virus (3). An 816-nt DNA fragment was amplified from each of these two field samples by RT-PCR with the tospovirus degenerate primers, gL3637/gL4435c, designed from the conserved region of L RNA. One of the amplified fragments was cloned and sequenced. A homology search indicated that the new tomato-infecting virus in Taiwan might belong to Capsicum chlorosis virus (CaCV) since the partial L RNA shared more than 87% nucleotide and 99.6% amino acid identity with two CaCV isolates from Thailand (GenBank Accession Nos. DQ256124 and NC_008302). A virus culture isolated from the symptomatic tomato was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwTom1. The partial L RNA and full-length nucleocapsid (N) gene of TwTom1 were obtained by RT-PCR with primer pairs gL3637/gL4435c and FJJ 2010-2 (5′-TTAAAT(C/T)ACAC(C/T)TCTATAGA)/N3534c (1), respectively. The 816-nt L RNA conserved region of TwTom1 (Accession No. HM021140) also shared 87% nucleotide and 99.6% amino acid identity with those of the above mentioned two CaCV isolates available in GenBank. The 828-nt N gene of TwTom1 (Accession No. HM021139) shared 85 to 98.1% nucleotide and 92 to 100% amino acid identity with those of 26 CaCV isolates available in GenBank. TwTom1 shared the highest N gene nucleotide and amino acid identity, 98.1 and 100%, respectively, with a gloxinia isolate (Accession No. AY312061). Sequence analysis results indicated that TwTom1 is an isolate of CaCV. The TwTom1 isolate was back inoculated onto three tomato (cv. Known-you 301) plants for pathogenicity test. The inoculated tomato plants showed symptoms of chlorosis at 13 days postinoculation (dpi) and symptoms of chlorosis plus necrosis on leaves at 20 dpi, which were similar to that observed in the field. A protein band measuring approximately 30 kDa in the crude sap of the TwTom1-infected tomato was observed in western blotting using the antiserum against the N protein of CaCV. In addition, CaCV was later detected by RT-PCR in two symptomatic tomato samples collected from another field. CaCV was first found in Australia, then Thailand, Taiwan, China, and India (2). Although CaCV was found to infect several species of ornamental crops in Taiwan, to our knowledge, this is the first report of CaCV that could naturally infect tomato, a nonornamental plant in Taiwan. References: (1) Y. H. Lin et al. Phytopathology 95:1482, 2005. (2) H. R. Pappu et al. Virus Res. 141:219, 2009. (3) Y.-X. Zheng et al. Plant Dis. 94:920, 2010.

Download Full-text

Yellow Net of Triumffeta Is Caused by a Geminivirus: A First Report

Plant Disease ◽

10.1094/pdis.1998.82.1.127a ◽

1998 ◽

Vol 82 (1) ◽

pp. 127-127 ◽

Cited By ~ 2

Author(s):

Vipin Hallan ◽

Sangeeta Saxena ◽

B. P. Singh

Keyword(s):

Rainy Season ◽

Blot Hybridization ◽

Southern Blot Hybridization ◽

Viral Disease ◽

Hybridization Experiment ◽

Dorsal Side ◽

Causal Agent ◽

Degenerate Primers ◽

First Report ◽

Initial Symptoms

Triumffeta rhomboidiaceae Jacq. (Tiliaceae family) is an annual rainy season weed that is commonly found throughout India. For the last 3 years, during the rainy season, several plants of T. rhomboidiaceae in and around the gardens of the National Botanical Research Institute have been found with vein yellowing symptoms. The initial symptoms were vein clearing but in later stages the veins became yellow and thickened. In severe cases, the chlorosis extends into interveinal areas, resulting in complete yellowing of the leaves. In a few cases, green leafy or thorny enations could be seen on the dorsal side of the leaf. The disease was investigated to identify the causal agent. Vector transmission studies showed that the causal agent is transmitted by the whitefly, Bemisia tabaci, from infected to healthy seedlings of T. rhomdoidiaceae. Since whitefly transmission of the disease is consistent with a geminivirus as the causal agent, the role of such a virus was investigated. DNA isolated from Triumffeta plants (both from the infected plants in the field as well as from those inoculated experimentally in the greenhouse) showing above mentioned symptoms was amplified with two sets of degenerate primers, PAL1v1978/PAR1c496 (set 1) and PAL1v1978/PCRc1 (set 2), that have been shown to be specific for DNA-A of whitefly transmitted geminiviruses (WTGs), in polymerase chain reaction (1). We could amplify DNA-A fragments of approximately 1.2 kb from set 1 and 0.7 kb from set 2, as expected (1). DNA isolated from healthy seedlings gave no amplification of such fragments. Identification of the amplified DNA fragments (from infected samples) to be of geminiviral in nature was confirmed by Southern blot hybridization carried out under high stringency conditions. DNA-A of Indian tomato leaf curl virus (2) was used as a general probe for WTGs for the above hybridization experiment. Therefore, Triumffeta yellow net disease is caused by a geminivirus. A review of literature revealed that there is no record of a viral disease affecting this weed and, therefore, this is the first report of a viral disease affecting this plant. References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) K. M. Srivastava et al. J. Virol. Methods 51:297, 1995.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky

Plant Disease ◽

10.1094/pdis-09-14-0946-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 421-421 ◽

Cited By ~ 1

Author(s):

N. W. Gauthier ◽

J. Polashock ◽

T. T. Veetil ◽

R. R. Martin ◽

J. Beale

Keyword(s):

Nucleic Acid ◽

Mosaic Disease ◽

Rt Pcr ◽

First Report ◽

Ctab Method ◽

Symptomatic Tissue ◽

Polymerase Chain ◽

Primer Sets ◽

Negative Controls ◽

Dtcs Quick Start

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5′-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

Download Full-text