scholarly journals First report of Colletotrichum fructicola causing anthracnose on Phoebe sheareri in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiaoqiao Huang ◽  
Yan Wu ◽  
Yuan Li ◽  
Haiping Lin ◽  
Liangjin Ma ◽  
...  
Keyword(s):  
Sequence Data ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Nucleotide Sequences ◽  
Ethanol Solution ◽  
Sodium Hypochlorite Solution ◽  
Sterile Water ◽  
Potential Threat ◽  
First Report ◽  
Wide Range

Phoebe sheareri (Hemsl.) Gamble is a high-value timber tree species with a wide range of uses. It can also be applied for landscape afforestation considering its beautiful shape and luxuriant branches. Previous studies disclosed that Neofusicum parvum can cause ulceration and necrosis on the main stems of P. sheareri (Chen et al. 2019), and branch wilt of P. zhennan (Zhu et al. 2019). In September 2019, anthracnose was observed from P. sheareri leaves in Lishui, Zhejiang province, China. The diseased leaves are characterized by dark brown lesions. The infection usually starts from the leaf tip or edge, then the infected leaves turn yellow, wither and fall finally. The infection sometimes occurrs on the small twigs, causing the whole branch to wither. Plants from 15 plantations were surveyed, and the disease incidence was about 30%. A total number of 15 freshly infected leaves were collected and cut into small pieces (5×5 mm), sterilized in 75% ethanol solution for 30 s, and washed with sterile water three times. They were further sanitized in 2% sodium hypochlorite solution for 2 to 3 minutes and dried in sterile filter paper after being washed with sterile water another three times. Leaf pieces were transferred to potato dextrose agar (PDA) plates and incubated at 25℃ in the dark for 3 days. The fungal cultures were purified and the typical isolate (TJ01) was selected for further morphological characterization and DNA sequence comparison. The strain was initially grayish white, villous, and posteriorly grayish green, and produced orange red spore clumps. The spores are single celled after maturation, oblong, colorless, and the size ranges from 8.5-19.5 × 4.5-5.5 μm. Morphological characteristics of the obtained isolate are consistent with those in the genus of Colletotrichum. DNA of the isolate was extracted and sequence data obtained and compared with those downloaded from GenBank. The internal transcribed spacer (ITS), intronic glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), beta-tubulin (TUB2), and calmodulin (CAL) genes were partially amplified and sequenced using the primer pairs ITS-1 + ITS-4, GDF + GDR, ACT-512F + ACT-783R, T1 + Bt2b, CL1C + Cl2C, respectively (Fu et al. 2019). The resulted nucleotide sequences were individually subjected to BLAST searche in GenBank. The nucleotide sequences of ITS (MZ088144), GAPDH (MZ133607), ACT (MZ133608), TUB2 (MZ133609), CAL (MZ133610) of the isolate showed 99.83% similarity to ITS sequence (MN829453), 98.24% similarity to GAPDH sequence (MN525875), 98.94% similarity to ACT sequence (MK341539), 100% similarity to TUB2 sequence (MG657352), and 100% similarity to CAL sequence (MN525839). The phylogenetic tree was constructed using MEGA 7 based on the tandem of five genes (ITS-GAPDH-ACT-TUB2-CAL). The result revealed that the isolate resides in the clade of C. fructicola species. Inoculation was done on leaves of ten P. sheareri plants in the field to verify its pathogenicity. Three healthy leaves of each plant were surface sterilized with 75% ethanol and dried up. The leaves were punctured using a sterilized needle, inoculated with 5-mm-diameter PDA plugs excised from 7-day-old cultures, and wrapped with parafilm. Nine pieces of healthy leaves inoculated with sterilized PDA plugs were served as controls. Disease symptoms developed on all the C. fructicola-inoculated leaves 5 days after inoculation, and a yellow brown lesion became apparent 16 days later, whereas the control leaves remained asymptomatic. C. fructicola was reisolated from the lesions, but not from the control leaves, fulfilling the Koch’s postulates. This fungus is a well-known pathogen and has led to anthracnose on many plant species globally. However, our study represents the first report of C. fructicola causing anthracnose on P. sheareri worldwide and its potential threat should be evaluated.

scholarly journals First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China

Plant Disease ◽  
2020 ◽  
Author(s):  
Yue Lian Liu ◽  
Jian Rong Tang ◽  
Yu Han Zhou
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Pathogenicity Test ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Rdna Its ◽  
Colletotrichum Siamense ◽  
Monstera Deliciosa ◽  
Pure Cultures

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

scholarly journals First Report on Ovate-leaf Atractylodes Damping-off Caused by Fusarium oxysporum species Complex in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Oliul Hassan ◽  
Taehyun Chang
Keyword(s):  
South Korea ◽  
Fusarium Oxysporum ◽  
Species Complex ◽  
Disease Incidence ◽  
Fusarium Species ◽  
Morphological Characteristics ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Damping Off ◽  
First Report

In South Korea, ovate-leaf atractylodes (OLA) (Atractylodes ovata) is cultivated for herbal medicine. During May to June 2019, a disease with damping off symptoms on OLA seedlings were observed at three farmer fields in Mungyeong, South Korea. Disease incidence was estimated as approximately 20% based on calculating the proportion of symptomatic seedlings in three randomly selected fields. Six randomly selected seedlings (two from each field) showing damping off symptoms were collected. Small pieces (1 cm2) were cut from infected roots, surface-sterilized (1 minute in 0.5% sodium hypochlorite), rinsed twice with sterile water, air-dried and then plated on potato dextrose agar (PDA, Difco, and Becton Dickinson). Hyphal tips were excised and transferred to fresh PDA. Six morphologically similar isolates were obtained from six samples. Seven-day-old colonies, incubated at 25 °C in the dark on PDA, were whitish with light purple mycelia on the upper side and white with light purple at the center on the reverse side. Macroconidia were 3–5 septate, curved, both ends were pointed, and were 19.8–36.62 × 3.3–4.7 µm (n= 30). Microconidia were cylindrical or ellipsoid and 5.5–11.6 × 2.5–3.8 µm (n=30). Chlamydospores were globose and 9.6 –16.3 × 9.4 – 15.0 µm (n=30). The morphological characteristics of present isolates were comparable with that of Fusarium species (Maryani et al. 2019). Genomic DNA was extracted from 4 days old cultures of each isolate of SRRM 4.2, SRRH3, and SRRH5, EF-1α and rpb2 region were amplified using EF792 + EF829, and RPB2-5f2 + RPB2-7cr primer sets, respectively (Carbone and Kohn, 1999; O'Donnell et al. 2010) and sequenced (GenBank accession number: LC569791- LC569793 and LC600806- LC600808). BLAST query against Fusarium loci sampled and multilocus sequence typing database revealed that 99–100% identity to corresponding sequences of the F. oxysporum species complex (strain NRRL 28395 and 26379). Maximum likelihood phylogenetic analysis with MEGA v. 6.0 using the concatenated sequencing data for EF-1α and rpb2 showed that the isolates belonged to F. oxysporum species complex. Each three healthy seedlings with similar sized (big flower sabju) were grown for 20 days in a plastic pot containing autoclaved peat soil was used for pathogenicity tests. Conidial suspensions (106 conidia mL−1) of 20 days old colonies per isolate (two isolates) were prepared in sterile water. Three pots per strain were inoculated either by pouring 50 ml of the conidial suspension or by the same quantity of sterile distilled water as control. After inoculation, all pots were incubated at 25 °C with a 16-hour light/8-hour dark cycle in a growth chamber. This experiment repeated twice. Inoculated seedlings were watered twice a week. Approximately 60% of the inoculated seedlings per strain wilted after 15 days of inoculation and control seedlings remained asymptomatic. Fusarium oxysporum was successfully isolated from infected seedling and identified based on morphology and EF-1α sequences data to confirm Koch’s postulates. Fusarium oxysporum is responsible for damping-off of many plant species, including larch, tomato, melon, bean, banana, cotton, chickpea, and Arabidopsis thaliana (Fourie et al. 2011; Hassan et al.2019). To the best of our knowledge, this is the first report on damping-off of ovate-leaf atractylodes caused by F. oxysporum in South Korea. This finding provides a basis for studying the epidemic and management of the disease.

scholarly journals First Report of Colletotrichum siamense Causing Leaf Spot on Alocasia macrorrhiza in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rong Huang ◽  
Wenxiu Sun ◽  
Wei Li ◽  
Chunxiang Zhou ◽  
SuiPing Huang ◽  
...  
Keyword(s):  
Phylogenetic Tree ◽  
Leaf Spot ◽  
Morphological Characteristics ◽  
Tween 20 ◽  
Control Group ◽  
Sodium Hypochlorite Solution ◽  
Conidial Suspension ◽  
Disease Symptoms ◽  
First Report ◽  
Wide Range

Alocasia macrorrhiza (L.) Schott, known as Alocasia is found in the Araceae, and is widely planted in southern China for its ornamental and medicinal value. This plant has a wide range of pharmacological effects, and has potential anti-tumor activity (Lei et al. 2013). In July of 2019, leaf spots were observed on A. macrorrhiza in the Xixiangtang Area, Nanning, Guangxi, China. Disease symptoms began with water-soaked yellow-green spots and progressed to form brown, round or oval lesions with yellow halos. Under severe conditions, spots merged into larger irregular lesions. More than 60% of the plants in a 0.5 ha field showed disease symptoms. Symptomatic leaves were collected and cut into small pieces (3×3 mm). Leaf pieces from the margin of the necrotic tissue were surface sterilized in 75% alcohol for 10 s, followed by 2% sodium hypochlorite solution for 2 min, then rinsed three times in sterile distilled water. Tissues were plated on potato dextrose agar (PDA) and incubated at 28°C for 5 days in the dark. Among over 30 isolates, most shared a similar morphology, the isolation rate of these was 86.7% and three of these (GY1-1A, GY1-1B, and GY1-1C) were chosen for single-spore purification and used for fungal morphological characterization and identification. White feathery aerial mycelia with olivaceous gray mycelia below were observed in 7-day cultures. After 14 days, orange conidia were observed. Conidia were hyaline, guttulate, smooth, one-celled, and cylindrical, averaged 13.79 μm × 5.26 μm, 13.89 μm × 5.33 μm and 13.92 μm × 5.42 μm for GY1-1A, GY1-1B and GY1-1C, respectively. Appressoria were mostly irregular in outline, deeply lobed or lightly lobed, gray brown to dark brown, conidial appressoria were 7.93 to 8.74 μm × 5.26 to 5.42 μm, mycelial appressoria were 7.15 to 10.11 μm × 5.60 to 7.44 μm. These morphological characteristics were similar to the C. siamense as previously described (Weir et al. 2012). The partial internal transcribed spacer (ITS) regions, actin (ACT), chitin synthase (CHS-1), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), calmodulin (CAL), β-tubulin (TUB2), and the intergenic region of apn2 and MAT1-2-1 (ApMAT) were amplified from genomic DNA for the three isolates using primers ITS4/ITS1 (White et al. 1990), ACT-512F/ACT-783R, CHS-79F/CHS-354R, GDF1/GDR1, CL1C/CL2C, Bt2a/Bt2b (Weir et al. 2012), and AM-F/AM-R (Silva et al. 2012) and sequenced. All sequences showed over 99% identity with C. siamense and were deposited in GenBank (ITS, MW040179-MW040181; ACT, MW049220-MW049222; CHS-1, MW049229-MW049231; GAPDH, MW049232-MW049234; CAL, MW049226-MW049228; TUB, MW049235-MW049237; ApMAT, MW049223-MW049225). Maximum Likelihood (ML) phylogenetic tree was constructed with MEGA 5 using the concatenation of multiple sequences (ACT, CHS-1, GAPDH, ITS, TUB2, CAL). According to the phylogenetic tree, all three isolates were found with C. siamense with 95% bootstrap support. To confirm pathogenicity, three sets (three plants per set) of healthy leaves were slightly scratched with autoclaved toothpicks at each of eight locations. Each inoculation location was a cross (2 mm length) and inoculation location was at least 3 cm apart. Ten μl of conidial suspension (106 conidia /ml in 0.1% sterile Tween 20) was applied to the inoculation areas. A control group was mock inoculated with 0.1% sterile Tween 20. Plants were covered with plastic bags to maintain a high humidity environment and placed in a 28°C growth chamber with constant light for 7 days. Inoculated leaves showed yellowish brown spots (0.4 × 0.65 cm), but no symptoms were observed in the control group. The fungus was reisolated from inoculated leaves, and these isolates matched the molecular and morphological characteristics of the original isolates confirming Koch’s postulates. Reported hosts of this pathogen include Coffea arabica, Carica papaya, Melilotus indicus and Litchi chinensis (Weir et al. 2012; Qin et al. 2017; Ling et al. 2019) and so on. To our knowledge, this is the first report of C. siamense causing leaf spot on A. macrorrhiza in China. The identification of this pathogen provides a foundation for the management of leaf spot on this medicinal plant.

scholarly journals First report of leaf spot caused by Colletotrichum fructicola on Dalbergia hupeana in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yang Zhou ◽  
Rou Ye ◽  
Qin Ying ◽  
Yang Zhang ◽  
Linping Zhang
Keyword(s):  
Phylogenetic Tree ◽  
Leaf Spot ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Jiangxi Province ◽  
Leaf Spot Disease ◽  
Sterile Water ◽  
First Report ◽  
Spot Disease ◽  
Colletotrichum Fructicola

Dalbergia hupeana is a kind of wood and medicinal tree widely distributed in southern China. Since 2019, a leaf spot disease was observed on the leaves of D. hupeana in Gangxia village, Luoting town in Jiangxi Province, China (28°52′53″N, 115°44′58″E). The disease incidence was estimated to be above 50%. The symptoms began as small spots that gradually expanded, developing a brown central and dark brown to black margin. The spots ranged from 4 to 6 mm in diameter. Leaf pieces (5 × 5 mm) from lesion margins were surface sterilized in 70% ethanol for 30 s followed by 2% NaOCl for 1 min and then rinsed three times with sterile water. Tissues were placed on potato dextrose agar (PDA) and incubated at 25°C. Pure cultures were obtained by monosporic isolation. Fifteen strains with similar morphological characterizations were isolated, and three representative isolates (JHT-1, JHT-2, and JHT-3) were chosen and used for further study. Colonies on PDA of three isolates were grayish-green with white edges and dark green on the reverse side. Conidia were transparent, cylindrical with rounded ends, and measured 3.6-5.3 µm × 9.5-15.2 µm (3.7 ± 0.2 × 13.6 ± 1.1 µm, n = 100). Appressoria were dark brown, globose or subcylindrical, and ranged from 6.2-9.2 µm× 5.1-6.8 µm (7.9 ± 0.4 × 5.9 ± 0.3 µm, n=100). The morphological characteristics of the three strains were consistent with the description of species in the Colletotrichum gloeosporioides complex (Weir et al. 2012). The internal transcribed spacer (ITS) regions, actin (ACT), calmodulin (CAL), chitin synthase (CHS-1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta-tubulin 2 (TUB2) were amplified from genomic DNA for the three isolates using primers ITS1/ITS4, ACT-512F/ACT-783R, CL1/CL2, CHS-79F/CHS-345R, GDF/GDR and T1/Bt2b (Weir et al. 2012), respectively. The sequences were deposited in GenBank (Accession Nos. MZ482016 - MZ482018 for ITS; MZ463636 - MZ463638 for ACT; MZ463648- MZ463650 for CAL; MZ463639 - MZ463641 for CHS-1; MZ463642 - MZ463644 for GAPDH; MZ463645 - MZ463647 for TUB2). A neighbor-joining phylogenetic tree was constructed with MEGA 7.0 using the concatenation of multiple sequences (ITS, ACT, GAPDH, TUB2, CHS-1, CAL) (Kumar et al. 2016). According to the phylogenetic tree, three isolates fall within the Colletotrichum fructicola clade (boot support 99%). Based on morphological characteristics and phylogenetic analysis, three isolates were identified as C. fructicola. The pathogenicity of three isolates was conducted on two-yr-old seedlings (30 cm tall) of D. hupeana. Healthy leaves were wounded with a sterile needle and then inoculated with 10 μL spore suspension (106 conidia per mL). Controls were treated with sterile water. All plants were covered with transparent plastic bags and incubated in a greenhouse at 28°C with a 12 h photoperiod (relative humidity > 80%). Within five days, the inoculated leaves developed lesions similar to those observed in the field, whereas controls were asymptomatic. The experiments repeated three times showed similar results. The infection rate was 100%. C. fructicola was re-isolated from the lesions, whereas no fungus was isolated from control leaves. C. fructicola can cause leaf diseases in a variety of hosts, including Aesculus chinensis (Sun et al. 2020), Peucedanum praeruptorum (Ma et al. 2020), and Mandevilla × amabilis (Sun et al. 2020). C. brevisporum and C. gigasporum were also reported to infect Dalbergia odorifera (Chen et al. 2021; Wan et al. 2018). However, This is the first report of C. fructicola associated with leaf spot disease on D. hupeana in China. These results will help to develop effective strategies for appropriately managing this newly emerging disease.

scholarly journals First Report of Paraphoma chrysanthemicola Causing Crown and Leaf Rot of Atractylodes lancea in China

Plant Disease ◽  
2022 ◽  
Author(s):  
Hongyang Wang ◽  
Chuanzhi Kang ◽  
Wang Yue-Feng ◽  
Sheng Wang ◽  
Zhang Yan ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Crown Rot ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
First Report ◽  
Atractylodes Lancea ◽  
Detached Leaves ◽  
Leaf Rot

Atractylodes lancea is an important traditional Chinese medicinal plant whose rhizome is used for treating complaints such as rheumatic diseases, digestive disorders, night blindness and influenza. Jiangsu Province is the optimal cultivation location for high-quality A. lancea rhizome. Since June 2019, symptoms of crown rot and leaf rot were observed in about 10-20% of the A. lancea in a plantation (31° 36' 1" N, 119° 6' 40" W) in Lishui, Jiangsu, China. Lesions occurred on the stem near the soil line and on the leaves (Fig. 1A). Disease incidence reached approximately 80-90% by September, 2021 (Fig. 1B) and resulted in severe loss of rhizome and seed yields. For pathogen isolation, ten samples of symptomatic stem segments and ten diseased leaves were collected, surface-sterilized using 5% NaClO solution, rinsed with sterile water, cut into 0.5-2 cm segments, and plated to potato dextrose agar (PDA), and then incubated at 30°C in darkness. Pure cultures of four isolates showing morphological characteristics of Paraphoma spp. were obtained, identified as a single P. chrysanthemicola strain, and named LSL3f2. Newly formed colonies initially consisted of white mycelia; the five-day-old colonies developed a layer of whitish grey mycelia with a grey underside. 20-day-old colonies had white mycelium along the margin and with a faint yellow inner circular part with irregular radial furrows, and the reverse side looking caramel and russet (Fig. 1C). Pycnidia were subglobose (diameter: 5 to 15 μm; Fig. 1D). Unicellular, bicellular or strings of globose or subglobose chlamydospores developed from hyphal cells (Fig. 1E and 1F). The internal transcribed spacer (ITS) region and large subulin-28S of LSL3f2 were cloned using primers ITS1/ITS4 and LR0R/LR7 (Aveskamp et al. 2010, Li et al. 2013), and deposited in GenBank (OK559658 and OK598973, respectively). BLASTn search and phylogenetic analysis showed the highest identity between LSL3f2 and P. chrysanthemicola sequences (Fig. 1G) and confirmed LSL3f2 as P. chrysanthemicola. Koch’s postulates were completed using one-month-old vegetatively propagated A. lancea plantlets growing on autoclaved vermiculite/peat mixture at 26°C with a light/dark cycle of 12/12 hours. Each plantlet was inoculated with 5 ml of conidial suspension in water (1 × 108 cfu/ml) by applying to soil close to the plantlet, with sterile water used as a mock control (n = 10). By 20 days post-inoculation, inoculated plantlets showed a range of disease symptoms consistent to those observed in infested fields (Fig. 1H). Pathogenicity was additionally confirmed using detached leaves inoculated with a colonized agar plug of LSL3f2 or an uninoculated control comparison (diameter = 5 mm) and incubated at 26℃ in the dark. Five to seven days post-inoculation, detached leaves showed leaf rot symptoms including lesions, yellowing and withering consistent with those in infested fields, while control leaves remained healthy (n = 10, Fig. 1I). The pathogen was reisolated from the diseased plantlets and detached leaves, in both cases demonstrating the micromorphological characteristics of LSL3f2. P. chrysanthemicola has been reported to cause leaf and crown rot on other plants such as Tanacetum cinerariifolium (Moslemi et al. 2018), and leaf spot on A. japonicain (Ge et al. 2016). However, this is the first report of P. chrysanthemicola causing crown and leaf rot on A. lancea in China.

scholarly journals First Report of Flyspeck Caused by Zygophiala wisconsinensis on Sweet Persimmon Fruit in Korea

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 616-616 ◽  
Author(s):  
J. Kim ◽  
O. Choi ◽  
J.-H. Kwon
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Its Rdna ◽  
Control Treatment ◽  
Diospyros Kaki ◽  
Distilled Water ◽  
First Report ◽  
Persimmon Fruit ◽  
Fungal Isolates ◽  
Agar Disc

Sweet persimmon (Diospyros kaki L.), a fruit tree in the Ebenaceae, is cultivated widely in Korea and Japan, the leading producers worldwide (2). Sweet persimmon fruit with flyspeck symptoms were collected from orchards in the Jinju area of Korea in November 2010. The fruit had fungal clusters of black, round to ovoid, sclerotium-like fungal bodies with no visible evidence of a mycelial mat. Orchard inspections revealed that disease incidence ranged from 10 to 20% in the surveyed area (approximately 10 ha) in 2010. Flyspeck symptoms were observed on immature and mature fruit. Sweet persimmon fruit peels with flyspeck symptoms were removed, dried, and individual speck lesions transferred to potato dextrose agar (PDA) and cultured at 22°C in the dark. Fungal isolates were obtained from flyspeck colonies on 10 sweet persimmon fruit harvested from each of three orchards. Fungal isolates that grew from the lesions were identified based on a previous description (1). To confirm identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA sequence of a representative isolate was amplified and sequenced using primers ITS1 and ITS4 (4). The resulting 552-bp sequence was deposited in GenBank (Accession No. HQ698923). Comparison with ITS rDNA sequences showed 100% similarity with a sequence of Zygophiala wisconsinensis Batzer & Crous (GenBank Accession No. AY598855), which infects apple. To fulfill Koch's postulates, mature, intact sweet persimmon fruit were surface sterilized with 70% ethanol and dried. Three fungal isolates from this study were grown on PDA for 1 month. A colonized agar disc (5 mm in diameter) of each isolate was cut from the advancing margin of a colony with a sterilized cork borer, transferred to a 1.5-ml Eppendorf tube, and ground into a suspension of mycelial fragments and conidia in a blender with 1 ml of sterile, distilled water. The inoculum of each isolate was applied by swabbing a sweet persimmon fruit with the suspension. Three sweet persimmon fruit were inoculated per isolate. Three fruit were inoculated similarly with sterile, distilled water as the control treatment. After 1 month of incubation in a moist chamber at 22°C, the same fungal fruiting symptoms were reproduced as observed in the orchards, and the fungus was reisolated from these symptoms, but not from the control fruit, which were asymptomatic. On the basis of morphological characteristics of the fungal colonies, ITS sequence, and pathogenicity to persimmon fruit, the fungus was identified as Z. wisconsinensis (1). Flyspeck is readily isolated from sweet persimmon fruit in Korea and other sweet persimmon growing regions (3). The exposure of fruit to unusual weather conditions in Korea in recent years, including drought, and low-temperature and low-light situations in late spring, which are favorable for flyspeck, might be associated with an increase in occurrence of flyspeck on sweet persimmon fruit in Korea. To our knowledge, this is the first report of Z. wisconsinensis causing flyspeck on sweet persimmon in Korea. References: (1) J. C. Batzer et al. Mycologia 100:246, 2008. (2) FAOSTAT Database. Retrieved from http://faostat.fao.org/ , 2008. (3) H. Nasu and H. Kunoh. Plant Dis. 71:361, 1987. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

scholarly journals First Report of Leaf Spot caused by Bipolaris oryzae on Switchgrass in Tennessee

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1654-1654 ◽  
Author(s):  
A. L. Vu ◽  
M. M. Dee ◽  
J. Zale ◽  
K. D. Gwinn ◽  
B. H. Ownley
Keyword(s):  
Leaf Spot ◽  
Panicum Virgatum ◽  
Morphological Characteristics ◽  
Its Region ◽  
Spore Production ◽  
Post Inoculation ◽  
Sterile Water ◽  
Bipolaris Oryzae ◽  
First Report ◽  
Symptomatic Leaf

Knowledge of pathogens in switchgrass, a potential biofuels crop, is limited. In December 2007, dark brown to black irregularly shaped foliar spots were observed on ‘Alamo’ switchgrass (Panicum virgatum L.) on the campus of the University of Tennessee. Symptomatic leaf samples were surface-sterilized (95% ethanol, 1 min; 20% commercial bleach, 3 min; 95% ethanol, 1 min), rinsed in sterile water, air-dried, and plated on 2% water agar amended with 3.45 mg fenpropathrin/liter (Danitol 2.4 EC, Valent Chemical, Walnut Creek, CA) and 10 mg/liter rifampicin (Sigma-Aldrich, St. Louis, MO). A sparsely sporulating, dematiaceous mitosporic fungus was observed. Fungal plugs were transferred to surface-sterilized detached ‘Alamo’ leaves on sterile filter paper in a moist chamber to increase spore production. Conidia were ovate, oblong, mostly straight to slightly curved, and light to olive-brown with 3 to 10 septa. Conidial dimensions were 12.5 to 17 × 27.5 to 95 (average 14.5 × 72) μm. Conidiophores were light brown, single, multiseptate, and geniculate. Conidial production was polytretic. Morphological characteristics and disease symptoms were similar to those described for Bipolaris oryzae (Breda de Haan) Shoemaker (2). Disease assays were done with 6-week-old ‘Alamo’ switchgrass grown from seed scarified with 60% sulfuric acid and surface-sterilized in 50% bleach. Nine 9 × 9-cm square pots with approximately 20 plants per pot were inoculated with a mycelial slurry (due to low spore production) prepared from cultures grown on potato dextrose agar for 7 days. Cultures were flooded with sterile water and rubbed gently to loosen mycelium. Two additional pots were inoculated with sterile water and subjected to the same conditions to serve as controls. Plants were exposed to high humidity by enclosure in a plastic bag for 72 h. Bags were removed, and plants were incubated at 25/20°C with 50 to 60% relative humidity. During the disease assay, plants were kept in a growth chamber with a 12-h photoperiod of fluorescent and incandescent lighting. Foliar leaf spot symptoms appeared 5 to 14 days post-inoculation for eight of nine replicates. Control plants had no symptoms. Symptomatic leaf tissue was processed and plated as described above. The original fungal isolate and the pathogen recovered in the disease assay were identified using internal transcribed spacer (ITS) region sequences. The ITS region of rDNA was amplified with PCR and primer pairs ITS4 and ITS5 (4). PCR amplicons of 553 bp were sequenced, and sequences from the original isolate and the reisolated pathogen were identical (GenBank Accession No. JQ237248). The sequence had 100% nucleotide identity to B. oryzae from switchgrass in Mississippi (GU222690, GU222691, GU222692, and GU222693) and New York (JF693908). Leaf spot caused by B. oryzae on switchgrass has also been described in North Dakota (1) and was seedborne in Mississippi (3). To our knowledge, this is the first report of B. oryzae from switchgrass in Tennessee. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/, 28 June 2012. (2) J. M. Krupinsky et al. Can. J. Plant Pathol. 26:371, 2004. (3) M. Tomaso-Peterson and C. J. Balbalian. Plant Dis. 94:643, 2010. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: a Guide to Methods and Applications. M. A. Innis et al. (eds), Acad. Press, San Diego, 1990.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Damping-Off Caused by Rhizoctonia solani AG-4 on Mediterranean Fan Palm in Italy

Plant Disease ◽  
2010 ◽  
Vol 94 (1) ◽  
pp. 125-125 ◽  
Author(s):  
G. Polizzi ◽  
D. Aiello ◽  
I. Castello ◽  
V. Guarnaccia ◽  
A. Vitale
Keyword(s):  
Rhizoctonia Solani ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Mediterranean Area ◽  
Western Mediterranean ◽  
Fluorescent Light ◽  
Damping Off ◽  
Centraalbureau Voor ◽  
First Report ◽  
Stem Lesions

Mediterranean fan palm (Chamaerops humilis L.), one of just two autochthonous European palms, is native to the western Mediterranean Region in southwestern Europe and northwestern Africa. It can be found growing wild in the Mediterranean area. In Europe, this species is very popular as an ornamental plant. In March 2009, a widespread damping-off was observed in a stock of approximately 30,000 potted 1-month-old plants of C. humilis cv. Vulcano in a nursery in eastern Sicily. Disease incidence was approximately 20%. Disease symptoms consisted of lesions at the seedling shoot (plumule). Stem lesions were initially orange, turned brown, and followed by death of the entire plumule or eophyll. A fungus with mycelial and morphological characteristics of Rhizoctonia solani Kühn was consistently isolated from lesions when plated on potato dextrose agar (PDA) amended with streptomycin sulfate at 100 μg/ml. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Mycelium was branched at right angles with a septum near the branch and a slight constriction at the branch base. Hyphal cells removed from cultures grown at 25°C on 2% water agar were determined to be multinucleate when stained with 1% safranin O and 3% KOH solution (1) and examined at ×400. Anastomosis groups were determined by pairing isolates with tester strains AG-1 IA, AG-2-2-1, AG-2-2IIIB, AG-2-2IV, AG-3, AG-4, AG-5, AG-6, and AG-11 on 2% water agar in petri plates (3). Anastomosis was observed only with tester isolates of AG-4, giving both C2 and C3 reactions (2). One representative isolate obtained from symptomatic tissues was deposited at the Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures (CBS No. 125095). Pathogenicity tests were performed on container-grown, healthy, 1-month-old seedlings. Twenty plants of C. humilis cv. Vulcano were inoculated near the base of the stem with two 1-cm2 PDA plugs from 5-day-old mycelial cultures. The same number of plants served as uninoculated controls. Plants were incubated in a growth chamber and maintained at 25°C and 95% relative humidity on a 12-h fluorescent light/dark regimen. Symptoms identical to those observed in the nursery appeared 5 days after inoculation and all plants died within 20 days. No disease was observed on control plants. A fungus identical in culture morphology to R. solani AG-4 was consistently reisolated from symptomatic tissues, confirming its pathogenicity. To our knowledge, this is the first report in the world of R. solani causing damping-off on Mediterranean fan palm. References: (1) R. J. Bandoni. Mycologia 71:873, 1979. (2) D. E. Carling. Page 37 in: Grouping in Rhizoctonia solani by Hyphal Anastomosis Reactions. Kluwer Academic Publishers, the Netherlands, 1996. (3) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.

scholarly journals First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 843-843 ◽  
Author(s):  
N.-H. Lu ◽  
Q.-Z. Huang ◽  
H. He ◽  
K.-W. Li ◽  
Y.-B. Zhang
Keyword(s):  
Morphological Characteristics ◽  
Its Region ◽  
Avicennia Marina ◽  
Optical Microscope ◽  
Ethanol Solution ◽  
Morphological Observation ◽  
Fusarium Equiseti ◽  
First Report ◽  
Initial Symptoms ◽  
Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Sign in / Sign up

Export Citation Format

Share Document