First Report of Rhizoctonia solani AG-1-IB Causing Leaf Blight of Sorrel (Rumex acetosa) in Brazil

Rumex acetosa L., common name sorrel (in Brazil, azedinha), is an herb from Europe and Asia commonly used either as a vegetable or a medicinal plant (1). No pathogen has been recorded on this plant species in Brazil, where it has been promoted as an alternative vegetable crop. During a routine inspection of a vegetable garden in the campus of the Universidade Federal de Viçosa (Viçosa, state of Minas Gerais, Brazil) in July 2011, a group of sorrel plants were found bearing blight symptoms. Infected leaves had laminae with soaked irregular necrotic areas and infected petioles had reddish lesions. Healthy leaves touched by neighboring blighted leaves became diseased. A mycelial web was always associated with necrotic tissues. A representative specimen was collected, dried in a plant press, and deposited in the local herbarium (VIC 39063). Pure cultures were obtained through direct transfer of mycelium to PDA plates and deposited in the culture collection at the Universidade Federal de Viçosa – Coleção Oswaldo Almeida Drummond (COAD 1265). Slides containing fungal structures were mounted in lactophenol and observed under a microscope (Olympus BX 51). The fungus had the following morphology: mycelium superficial, either filiform or monilioid and constricted at septae, 6 to 10 μm diameter, often branching at right angles or nearly so, typically bearing a septum at branches near the branching point. Additionally, large, poorly differentiated, dirty white sclerotia were formed in older cultures. When mounted in DAPI, 7-day-old mycelium was seen to bear 5 to 13 nuclei per cell. These characteristics suggested that the fungus was Rhizoctonia solani Kuhn (RS). Anastomosis group (AG) was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS5 and ITS4 (4). A BLAST search revealed that the sequence (GenBank Accession No. KC887353) had 96% sequence identity with RS AG-1-IB GenBank accessions JN426850.1, GU596491.1, JQ692292.1, and JQ692291.1. Pathogenicity of the isolate obtained from sorrel was tested by inoculating four healthy individuals with culture plugs taken from the margin of actively growing cultures on V8 juice agar. Inoculated plants were placed in a dew chamber for 48 h and later transferred to the bench of a greenhouse. Necrosis appeared on all inoculated plants 2 days after inoculation, developing into severe blight after 7 days. RS was isolated from infected tissues. RS AG-1-IB is known as a broad host-range plant pathogen (3). This is its first report as a pathogen of sorrel in Brazil. The sole other published record of this disease on sorrel is from the United States (2). References: (1) N. R. Madeira et al. Hortic. Brasil. 26:428, 2008. (2) G. L. Peltier. Parasitic rhizoctonias in America. University of Illinois Agricultural Experiment Station, 1915. (3) B. Sneh, L. Burpee, and A. Ogoshi. Identification of Rhizoctonia species. APS Press, St Paul, MN, 1991. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

Download Full-text

First Report of Rhizoctonia solani AG2-2IIIB Infecting Potato Stems and Stolons in the United States

Plant Disease ◽

10.1094/pdis-10-11-0899 ◽

2012 ◽

Vol 96 (3) ◽

pp. 460-460 ◽

Cited By ~ 3

Author(s):

J. W. Woodhall ◽

A. R. Belcher ◽

J. C. Peters ◽

W. W. Kirk ◽

P. S. Wharton

Keyword(s):

United States ◽

New York ◽

Sugar Beet ◽

Rhizoctonia Solani ◽

Its Region ◽

Stem Canker ◽

The United States ◽

Potato Disease ◽

First Report ◽

Plant Pathol

Rhizoctonia solani is an important pathogen of potato (Solanum tuberosum) causing qualitative and quantitative losses. It has been associated with black scurf and stem canker. Isolates of the fungus are assigned to one of 13 known anastomosis groups (AGs), of which AG3 is most commonly associated with potato disease (2,4). In August 2011, diseased potato plants originating from Rupert, ID (cv. Western Russet) and Three Rivers, MI (cv. Russet Norkotah) were received for diagnosis. Both samples displayed stem and stolon lesions typically associated with Rhizoctonia stem canker. The presence of R. solani was confirmed through isolation as previously described (4) and the Idaho and Michigan isolates were designated J11 and J8, respectively. AG was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS5 and ITS4 (3). The resulting sequences of the rDNA ITS region of isolates J8 and J11 (GenBank Accession Nos. HE608839 and HE608840, respectively) were between 97 and 100% identical to that of other AG2-2IIIB isolates present in sequence databases (GenBank Accession Nos. FJ492075 and FJ492170, respectively). Koch's postulates were confirmed for each isolate by carrying out the following protocol. Each isolate was cultured on potato dextrose agar for 14 days. Five 10-mm agar plugs were then placed on top of seed tubers (cv. Maris Piper) in 1-liter pots containing John Innes Number 3 compost (John Innes Manufacturers Association, Reading, UK). Pots were held in a controlled environment room at 18°C with 50% relative humidity and watered as required. After 21 days, plants were removed and assessed for disease. Typical Rhizoctonia stem lesions were observed and R. solani was successfully reisolated from symptomatic material. To our knowledge, this is the first report of AG2-2IIIB causing disease on potatoes in the United States. In the United States, AGs 2-1, 3, 4, 5, and 9 have all been previously implicated in Rhizoctonia potato disease (2). AG2-2IIIB should now also be considered a potato pathogen in the United States. Knowledge of which AG is present is invaluable when considering a disease management strategy. AG2-2IIIB is a causal agent of sugar beet (Beta vulgaris) root rot in Idaho (1). Sugar beet is commonly grown in crop rotation with potato and such a rotation could increase the risk of soilborne infection to either crop by AG2-2IIIB. References: (1) C. A. Strausbaugh et al. Can. J. Plant Pathol. 33:210, 2011. (2) L. Tsror. J. Phytopatol. 158:649, 2010. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990. (4) J. W.Woodhall et al. Plant Pathol. 56:286, 2007.

Download Full-text

First Report of Leaf Blight and Stem Canker of Pachysandra terminalis Caused by Pseudonectria pachysandricola in Korea

Plant Disease ◽

10.1094/pdis-09-11-0813 ◽

2012 ◽

Vol 96 (2) ◽

pp. 287-287

Author(s):

K. S. Han ◽

J. H. Park ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

United States ◽

Its Region ◽

Stem Canker ◽

The United States ◽

Culture Collection ◽

Leaf Blight ◽

First Report ◽

Cornell University ◽

Plastic Bags ◽

Young Leaves

Pachysandra terminalis Siebold & Zucc., known as Japanese pachysandra, is a creeping evergreen perennial belonging to the family Buxaceae. In April 2011, hundreds of plants showing symptoms of leaf blight and stem canker with nearly 100% incidence were found in a private garden in Suwon, Korea. Plants with the same symptoms were found in Seoul in May and Hongcheon in August. Affected leaves contained tan-to-yellow brown blotches. Stem and stolon cankers first appeared as water soaked and developed into necrotic lesions. Sporodochia were solitary, erumpent, circular, 50 to 150 μm in diameter, salmon-colored, pink-orange when wet, and with or without setae. Setae were hyaline, acicular, 60 to 100 μm long, and had a base that was 4 to 6 μm wide. Conidiophores were in a dense fascicle, not branched, hyaline, aseptate or uniseptate, and 8 to 20 × 2 to 3.5 μm. Conidia were long, ellipsoid to cylindric, fusiform, rounded at the apex, subtruncate at the base, straight to slightly bent, guttulate, hyaline, aseptate, 11 to 26 × 2.5 to 4.0 μm. A single-conidial isolate formed cream-colored colonies that turned into salmon-colored colonies on potato dextrose agar (PDA). Morphological and cultural characteristics of the fungus were consistent with previous reports of Pseudonectria pachysandricola B.O. Dodge (1,3,4). Voucher specimens were housed at Korea University (KUS). Two isolates, KACC46110 (ex KUS-F25663) and KACC46111 (ex KUS-F25683), were accessioned in the Korean Agricultural Culture Collection. Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced using ABI Prism 337 automatic DNA sequencer (Applied Biosystems, Foster, CA). The resulting sequence of 487 bp was deposited in GenBank (Accession No. JN797821). This showed 100% similarity with a sequence of P. pachysandricola from the United States (HQ897807). Isolate KACC46110 was used in pathogenicity tests. Inoculum was prepared by harvesting conidia from 2-week-old cultures on PDA. Ten young leaves wounded with needles were sprayed with conidial suspensions (~1 × 106 conidia/ml). Ten young leaves that served as the control were treated with sterile distilled water. Plants were covered with plastic bags to maintain a relative humidity of 100% at 25 ± 2°C for 24 h. Typical symptoms of brown spots appeared on the inoculated leaves 4 days after inoculation and were identical to the ones observed in the field. P. pachysandricola was reisolated from 10 symptomatic leaf tissues, confirming Koch's postulates. No symptoms were observed on control plants. Previously, the disease was reported in the United States, Britain, Japan, and the Czech Republic (2,3), but not in Korea. To our knowledge, this is the first report of P. pachysandricola on Pachysandra terminalis in Korea. Since this plant is popular and widely planted in Korea, this disease could cause significant damage to nurseries and the landscape. References: (1) B. O. Dodge. Mycologia 36:532, 1944. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , September 24, 2011. (3) I. Safrankova. Plant Prot. Sci. 43:10, 2007. (4) W. A. Sinclair and H. H. Lyon. Disease of Trees and Shrubs. 2nd ed. Cornell University Press, Ithaca, NY, 2005.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Damping-Off on Basella rubra Caused by Rhizoctonia solani Anastomosis Group 4 in Florida

Plant Disease ◽

10.1094/pdis-08-11-0639 ◽

2012 ◽

Vol 96 (2) ◽

pp. 288-288 ◽

Cited By ~ 2

Author(s):

X. Liao ◽

Y. Fu ◽

S. Zhang ◽

Y. P. Duan

Keyword(s):

Rhizoctonia Solani ◽

The United States ◽

Anastomosis Group ◽

Pathogenicity Test ◽

Damping Off ◽

Ambient Conditions ◽

Microscopic Appearance ◽

Stem Base ◽

First Report ◽

Intergenic Spacer Region

Indian spinach (Basella rubra L.) is a red stem species of Basella that is cultivated worldwide as an ornamental and the aerial parts are also consumed as a vegetable. In May of 2011, symptoms of damping-off were observed on approximately 10% of the plants at the stem base around the soil line of seedlings in a greenhouse in Homestead, FL. Lesions were initially water soaked, grayish to dark brown, irregular in shape, and sunken in appearance on large plants, causing the infected seedlings to collapse and eventually die. Symptomatic stem tissue was surface sterilized with 0.6% sodium hypochlorite, rinsed in sterile distilled water, air dried, and plated on potato dextrose agar (PDA). Plates were incubated at 25°C in darkness for 3 to 5 days. A fungus was isolated in all six isolations from symptomatic tissues on PDA. Fungal colonies on PDA were light gray to brown with abundant growth of mycelia, and the hyphae tended to branch at right angles when examined under a microscope. A septum was always present in the branch of hyphae near the originating point and a slight constriction at the branch was observed. Neither conidia nor conidiophores were found from the cultures on PDA. The characteristics of hyphae, especially the right angle branching of mycelia, indicate close similarity to those of Rhizoctonia solani (2,3). The internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced (GenBank Accession No. JN545836). Subsequent database searches by the BLASTN program indicated that the resulting sequence had a 100% identity over 472 bp with the corresponding gene sequence of R. solani anastomosis group (AG) 4 (GenBank Accession No. JF701752.1), a fungal pathogen reported to cause damping-off on many crops. Pathogenicity was confirmed through inoculation of healthy India spinach plants with the hyphae of isolates. Four 4-week-old plants were inoculated with the isolates by placing a 5-mm PDA plug of mycelia at the stem base and covering with a thin layer of the soil. Another four plants treated with sterile PDA served as a control. After inoculation, the plants were covered with plastic bags for 24 h and maintained in a greenhouse with ambient conditions. Four days after inoculation, water-soaked, brown lesions, identical to the symptoms described above, were observed on the stem base of all inoculated plants, whereas no symptoms developed on the control plants. The fungus was isolated from affected stem samples, and the identity was confirmed by microscopic appearance of the hyphae and sequencing the ITS1/ITS4 intergenic spacer region, fulfilling Koch's postulates. This pathogenicity test was conducted twice. R. solani has been reported to cause damping-off of B. rubra in Ghana (1) and Malaysia (4). To our knowledge, this is the first report of damping-off caused by R. solani AG-4 on Indian spinach in Florida and the United States. With the increased interest in producing Asian vegetables for food and ornamental purposes, the occurrence of damping-off on Indian spinach needs to be taken into account when designing programs for disease management in Florida. References: (1) H. A. Dade. XXIX. Bull. Misc. Inform. 6:205, 1940. (2) J. R. Parmeter et al. Phytopathology 57:218, 1967. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St Paul, MN, 1991. (4) T. H. Williams and P. S. W. Liu. Phytopathol. Pap. 19:1, 1976.

Download Full-text

Characterization of AG-13, a Newly Reported Anastomosis Group of Rhizoctonia solani

Phytopathology ◽

10.1094/phyto.2002.92.8.893 ◽

2002 ◽

Vol 92 (8) ◽

pp. 893-899 ◽

Cited By ~ 102

Author(s):

D. E. Carling ◽

R. E. Baird ◽

R. D. Gitaitis ◽

K. A. Brainard ◽

S. Kuninaga

Keyword(s):

Rhizoctonia Solani ◽

Internal Transcribed Spacer ◽

Aerial Mycelium ◽

Its Region ◽

The United States ◽

Anastomosis Group ◽

Its Regions ◽

Cotton Plants ◽

Agar Surface

Rhizoctonia solani anastomosis group (AG)-13 was collected from diseased roots of field grown cotton plants in Georgia in the United States. Isolates of AG-13 did not anastomose with tester isolates of AG-1 through AG-12. Mycelium of all isolates of AG-13 were light brown but darkened as cultures aged. All isolates produced aerial mycelium. Concentric rings were visible after 3 to 4 days of growth but disappeared as cultures aged and darkened. Individual sclerotia were up to 1.5 mm in diameter, similar in color to the mycelium, and generally embedded in the agar. Clumps of sclerotia up to 5 mm in diameter were produced on the agar surface. All attempts to induce basidiospore production were unsuccessful. The 5.8S region of the rDNA from isolates of AG-13 was identical in length and sequence to isolates of all other AGs of R. solani. Length and sequence of the internal transcribed spacer (ITS) regions of rDNA from isolates of AG-13 were unique among AGs of R. solani. Similarity between AG-13 and other AGs of R. solani ranged from 68 to 85% for ITS region 1 and 85 to 95% for ITS region 2. Selected isolates of AG-13 caused minor or no damage to barley, cauliflower, cotton, lettuce, potato, and radish in laboratory or greenhouse studies.

Download Full-text

First Report of Web Blight on Rosemary (Rosmarinus officinalis) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-11-12-1012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Ground Cover ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Rosmarinus Officinalis ◽

Economic Losses ◽

Pathogenicity Test ◽

First Report ◽

Wheat Kernels

Rosmarinus officinalis L., family Labiatae, is an evergreen shrub used in gardens as an aromatic or ground cover plant. In the summer of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 20% of 150,000 70-day-old plants, grown in trays. Water soaked lesions appeared on leaves and stems. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. A light mycelium spread on the substrate. Disease progressed from infected plants to healthy ones and, eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered. Three isolates of R. solani obtained from affected plants were successfully paired with R. solani tester strains AG 1, 2, 3, 4, 6, 7, or 11 and examined microscopically. Three pairings were made for each recovered isolate. The isolates of R. solani from rosemary anastomosed only with tester strain AG 1 (ATCC 58946). Results were consistent with other reports on anastomosis reactions (2). Tests were repeated once. Mycelium of 10-day-old isolates from rosemary appeared light brown, compact, and radiate. Numerous dark brown sclerotia, 0.7 to 2.0 mm diameter (average 1.3), developed within 10 days at 20 to 26°C. The descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced (GenBank Accession No. KC005724). BLASTn analysis (1) of the 657-bp showed a 99% similarity with the sequence of R. solani GU596491. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks for 8 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Fifteen 90-day-old rosemary plants were grown in 15-liter pots in a steam disinfested peat:pomice:pine bark:clay mix (50:20:20:10) infested with 3 g/liter of infested wheat kernels, placed at the base of the stem. Fifteen plants inoculated with non-infested wheat kernels served as control treatments. Plants were covered with plastic bags and arranged in a growth chamber at 20 to 24°C with 12 h light/dark for 15 days. The first symptoms, similar to those observed in the farm, developed 10 days after inoculation. About 10 colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on R. officinalis in United States (3), India, and Brazil. This is, to our knowledge, the first report of blight of R. officinalis caused by R. solani in Italy. This disease could cause serious economic losses, because rosemary is one of the most cultivated aromatic plants in the Mediterranean region. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, 1996. (3) G. E. Holcomb. Plant Dis. 76:859, 1992. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Target Spot of Broadleaf Tobacco Caused by Rhizoctonia solani (AG-3) in Connecticut

Plant Disease ◽

10.1094/pdis-04-12-0335-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

Rhizoctonia Solani ◽

Sequence Data ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2011, 15 transplant beds of broadleaf cigar wrapper tobacco (Nicotiana tabacum L., cv. C9) plants in Hartford County, Connecticut, were observed with almost every plant diseased. Leaf lesion symptoms ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Disease was subsequently observed, also at nearly 100% incidence in a 10-hectare field on that farm and at additional broadleaf tobacco farms from two other towns in Hartford County and one town in Tolland County. Lesions exhibited a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A. B. Frank) was isolated from the margins of lesions that had been surface sterilized in 0.5% NaOCl for 30 s and then rinsed in sterile distilled water and placed on the surface of half-strength potato dextrose agar (PDA). Multiple isolations were made and the pathogen was identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm, and hyphal branches occurring at approximately right angles, constricted at the base (4). Eight-week-old potted tobacco plants were each inoculated by spraying with a mycelial suspension (1 × 105 CFU) of an isolate of R. solani recovered from tobacco onto leaves, or with water alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants placed in trays filled to a depth of 1 cm with water in the growth chamber. After 8 days, the pathogen was reisolated from all inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were asymptomatic. DNA was liberated from hyphae of the R. solani isolate by bead beating in STE buffer using 0.15 mm zirconium beads. Two microliters of the eluate was used to amplify the ITS region. Amplified DNA was purified in a Qiagen QIAquick PCR purification kit and submitted to the Yale science hill genomic facility for standard Sanger dideoxy sequencing. The sequence was exactly the same as an isolate from Massachusetts that we sequenced in 2010 (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease has been previously reported on tobacco from South America, South Africa, and the southern United States (1), Canada (3), and Massachusetts (2). Conditions were very conducive for disease because 2011 was a very wet year in Connecticut. To our knowledge, this is the first report of this disease in broadleaf cigar wrapper tobacco in Connecticut. The sequence data suggested that it may have been introduced to Connecticut from Massachusetts. We have found the target spot pathogen distributed across the tobacco producing area of Connecticut. This constitutes a serious threat as there are no systemic fungicides currently registered for control of this disease in broadleaf tobacco. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993. (2) J. A. LaMondia and C. R. Vossbrinck, Plant Dis. 95:496, 2010. (3) R. D. Reeleder et al., Plant Dis., 80:712. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Potato Stem Canker Caused by Rhizoctonia solani AG4 HGII in Gansu Province, China

Plant Disease ◽

10.1094/pdis-09-12-0896-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 840-840

Author(s):

Y. G. Yang ◽

X. H. Wu

Keyword(s):

Rhizoctonia Solani ◽

Solanum Tuberosum L ◽

Its Region ◽

Stem Canker ◽

The United States ◽

Gansu Province ◽

Molecular Characteristics ◽

Potato Seed ◽

First Report ◽

Wheat Seeds

Black scurf and stem canker on potato (Solanum tuberosum L.), caused by Rhizoctonia solani, is an important disease throughout the world. Isolates of R. solani AG3 are the principal cause of these diseases on potato (2). In August 2011, at the tuber bulking growth stage, symptoms typically associated stem canker, including dark brown stem lesions, were observed on 20% of potato plants collected from 23 locations (about 2,000 ha) in Gansu Province, northwest China. Stem pieces (each 5 mm long) taken from the margins of the healthy and diseased tissues were surface-disinfected with 0.5% NaOCl for 2 min, rinsed with sterilized water, dried, then placed on potato dextrose agar (PDA) at 25°C in the dark. Twenty-nine fungal isolates taken from single hyphal tips were identified as R. solani based on morphological traits, including mycelium branched at right angles with a septum near the branch and a slight constriction at the branch base. Hyphal cells were determined to be multinucleate (4 to 10 nuclei/cell) when stained with 4′-6-diamidino-2-phenylindole (DAPI). Anastomosis groups were determined by pairing with reference strains (kindly provided by N. Kondo, Hokkaido University, Japan), and three isolates (designed GS-15, GS-24, and GS-25) anastomosed with isolates of R. solani AG4. The internal transcribed spacer (ITS) region of rDNA was amplified from genomic DNA of each of the three isolates with primers ITS1 and ITS4. The resulting sequences (GenBank Accession Nos. JX843818, JX843819, and JX843820) were 100% identical to those of >10 R. solani AG4 HGII isolates (e.g., HQ629873.1; isolate ND13). Therefore, based on the anastomosis assay and molecular characteristics, the three isolates were identified as R. solani AG4 HGII. To determine pathogenicity of the AG4 HGII isolates, potato seed tubers (cv. Favorita) with 3 to 5 mm long sprouts were inoculated with wheat seeds (sterilized by autoclaving twice at 121°C for 1 h with a 24 h interval between autoclavings) colonized with each isolate (1). One sprouted tuber was planted in a sterilized plastic pot (1 liter) with a single colonized wheat seed placed 10 mm above the uppermost sprout tip in a sand/sawdust mixture (1:2 v/v, with dry heat sterilization at 161°C for 4 h before use). Plants were incubated in a glasshouse maintained at 25 to 27°C. The test was performed on 20 plants for each isolate, and the experiment was repeated. After 3 weeks, control plants inoculated with sterilized wheat seeds remained asymptomatic, and no Rhizoctonia spp. were isolated from these plants, whereas all inoculated plants showed symptoms of stem canker. R. solani AG4 HGII was reisolated consistently from symptomatic stems, and the identity of the reisolates confirmed by the morphological and molecular characteristics mentioned above, fulfilling Koch's postulates. Potato stem canker caused by R. solani AG4 HGII was reported previously in the United States (3). To our knowledge, this is the first report of R. solani AG4 HGII causing stem canker on potato in Gansu Province, the main potato-producing area of China. R. solani AG4 HGII can cause sheath blight on corn in China (4), which is commonly grown in rotation with potato. This rotation could increase the risk of soilborne infection to either crop by R. solani AG4 HGII. References: (1) M. J. Lehtonen et al. Plant Pathol. 57:141, 2008. (2) L. Tsror. J. Phytopathol. 158:649, 2010. (3) J. W. Woodhall et al. Plant Dis. 96:1701, 2012. (4) X. Zhou et al. J. Shenyang Agric. Univ. 43:33, 2012.

Download Full-text

First Report of Rhizoctonia solani AG-4 on Epipremnum aureum in Buenos Aires, Argentina

Plant Disease ◽

10.1094/pdis.2001.85.1.96c ◽

2001 ◽

Vol 85 (1) ◽

pp. 96-96 ◽

Cited By ~ 1

Author(s):

E. R. Wright ◽

P. E. Grijalba ◽

L. Gasoni

Keyword(s):

Rhizoctonia Solani ◽

Buenos Aires ◽

Its Region ◽

Anastomosis Group ◽

Causal Agent ◽

Basal Stem Rot ◽

First Report ◽

Brown Discoloration ◽

Epipremnum Aureum ◽

Petri Plate

Root and basal stem rot, blighting, and wilting have been observed on Epipremnum aureum (Linden ex André) plants in many nurseries in and near Buenos Aires since 1997. Infected stem tissues show an intense dark brown discoloration and water soaking near the stem base that eventually leads to plant death. To determine the causal agent of the disease, small pieces of diseased tissue were surface-sterilized for 2 min in 2% sodium hypochlorite and plated on potato-dextrose agar (PDA). Whitish colonies that eventually turned brown developed in 2 to 3 days at 22 to 24°C. Irregularly shaped sclerotia were observed. Isolates typical of Rhizoctonia solani Kuhn exhibited mycelia with branches inclined in the direction of growth, constricted at the point of union with the main hyphae, with a septum in the branch near the constriction. No telemorph was observed. Nuclei in living hyphal mats were stained directly on a microscope slide coated with water agar according to the method of Tu and Kimbrough (4) and were examined at 400× magnification. The cells were multinucleate. Anastomosis group was determined by using known tester isolates of Rhizoctonia spp. (3). Positive anastomosis was observed with tester strains of AG-4 HG-II. The polymerase chain reaction was performed according to the protocol of Boysen et al (1) in order to confirm the anastomosis group. Primers used for the amplification of the ITS region were ITSI and LROR. Amplification of the ITS region indicated lack of variation with AG-4 tester strain. The pathogenicity of the isolate was determined with the inoculum-layer technique (2), consisting of a 7-day-old petri plate culture of the pathogen in PDA that is removed from the dish and placed intact on the soil, 2 to 4 cm under the roots of 10 healthy plants. Some leaves of the plants were placed in contact with the inoculated substratum. For a control, PDA was placed under the roots of other plants. Plants were maintained at 22 to 24°C, with close-to-saturation humidity. After 6 to 10 days, symptoms were similar to those previously observed. Initially leaves that had been placed in contact with the substratum showed dark areas with a watersoaked area 2 to 3 cm in diameter. These lesions expanded over the entire leaf blade moving into the petioles and stems killing the plant. One hundred percent of inoculated plants were infected. Koch's postulates were satisfied after reisolating the fungus. The characteristics of the causal agent are those of multinucleate isolates of R. solani belonging to the anastomosis group AG-4 HG-II (3). This is the first report of R. solani causing disease on E. aureum in Argentina. References: (1) M. Boysen, M. Borja, C. Del Corral, O. Salazar, and V. Rubio. Curr. Genet. 29:174–181, 1996. (2) A. F. Schmitthenner and J. W. Hilty. Phytopathology 52:177–178, 1962. (3) B. Sneh, L. Burpee, and A. Ogoshi. 1991. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN. (4) C. C. Tu and J. W. Kimbrough. Mycologia 65:941–944, 1973.

Download Full-text