First Report of Rhizoctonia solani AG2-1 on roots of wheat in Kazakhstan

In June 2019, approximately 20 tillers of wheat (Triticum aestivum L.) were sampled at the ripening stage (Feekes scale 11) from four different fields in Almaty, Kazakhstan. Brown lesions (3-5 mm in length) were present on the roots of sampled plants, with 20% incidence. To determine the causal agent, diseased roots were surface disinfected in sodium hypochlorite solution (1%) for 3 min, rinsed triple with sterile distilled water, air-dried in a laminar flow hood, and plated onto one-fifth strength potato dextrose agar (PDA) supplemented with 50 ppm chloramphenicol. After three days, the hyphal fragments that developed from the sections were transferred to fresh PDA and incubated at 23°C with 12-h photoperiod for 7 days to obtain pure cultures. Brown pigmented fungal colonies with a constriction at the base of hyphal branches, septa near the branching point, and right-angled branching resembling Rhizoctonia solani were observed. The identification anastomosis group (AG) of a representative isolate for each field was conducted by sequencing the internal transcribed spacer (ITS) region of rDNA with the universal primers ITS4 and ITS5 (White et al. 1990). The resulting sequences of 693 bp length were deposited in GenBank (accession nos. MW898143:MW898146). These sequences were 100% identical to the isolate 8Rs of R. solani AG2-1 (accession no. AF354063). To confirm the pathogenicity of the four isolates, the colonized wheat kernels method described by Demirci (1998) was used to inoculate a sterile potting mix containing peat, vermiculite, and soil (1:1:1 by v/v/v) into which wheat (cv. Seri) was planted. Control pots were inoculated with sterile wheat kernels using the same procedure. Wheat plants were left to grow for four weeks under controlled environmental conditions with a 23°C temperature regime. During the period that the plants remained in the glasshouse, the typical light regime was 16 h. Brown lesions were observed on the roots of plants in the inoculated pots whereas no symptoms were observed on plants grown in the control pots. R. solani was consistently reisolated from symptomatic plants, thereby confirming Koch’s postulates. To our knowledge, this is the first report of R. solani AG2-1 on roots of wheat in Kazakhstan. R. solani AG2-1 isolates have been previously reported to be a weak pathogen to wheat (Roberts and Sivasithamparam 1986; Sturrock et al. 2015; Jaaffar et al. 2016; Özer et al. 2019). We suggest further studies are required to characterize the impact of R. solani AG2-1 in wheat. Considering crop rotation, the selection of non-host crops to this AG group is important to pathogen management, by reducing the amount of inoculum in the soil.

Download Full-text

First Report of Web Blight on Rosemary (Rosmarinus officinalis) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-11-12-1012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Ground Cover ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Rosmarinus Officinalis ◽

Economic Losses ◽

Pathogenicity Test ◽

First Report ◽

Wheat Kernels

Rosmarinus officinalis L., family Labiatae, is an evergreen shrub used in gardens as an aromatic or ground cover plant. In the summer of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 20% of 150,000 70-day-old plants, grown in trays. Water soaked lesions appeared on leaves and stems. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. A light mycelium spread on the substrate. Disease progressed from infected plants to healthy ones and, eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered. Three isolates of R. solani obtained from affected plants were successfully paired with R. solani tester strains AG 1, 2, 3, 4, 6, 7, or 11 and examined microscopically. Three pairings were made for each recovered isolate. The isolates of R. solani from rosemary anastomosed only with tester strain AG 1 (ATCC 58946). Results were consistent with other reports on anastomosis reactions (2). Tests were repeated once. Mycelium of 10-day-old isolates from rosemary appeared light brown, compact, and radiate. Numerous dark brown sclerotia, 0.7 to 2.0 mm diameter (average 1.3), developed within 10 days at 20 to 26°C. The descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced (GenBank Accession No. KC005724). BLASTn analysis (1) of the 657-bp showed a 99% similarity with the sequence of R. solani GU596491. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks for 8 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Fifteen 90-day-old rosemary plants were grown in 15-liter pots in a steam disinfested peat:pomice:pine bark:clay mix (50:20:20:10) infested with 3 g/liter of infested wheat kernels, placed at the base of the stem. Fifteen plants inoculated with non-infested wheat kernels served as control treatments. Plants were covered with plastic bags and arranged in a growth chamber at 20 to 24°C with 12 h light/dark for 15 days. The first symptoms, similar to those observed in the farm, developed 10 days after inoculation. About 10 colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on R. officinalis in United States (3), India, and Brazil. This is, to our knowledge, the first report of blight of R. officinalis caused by R. solani in Italy. This disease could cause serious economic losses, because rosemary is one of the most cultivated aromatic plants in the Mediterranean region. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, 1996. (3) G. E. Holcomb. Plant Dis. 76:859, 1992. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Web Blight on Winter Savory (Satureja Montana “Repandens”) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-12-11-1075-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 585-585 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

M. T. Amatulli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Late Summer ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Pathogenicity Test ◽

First Report ◽

Hyphal Diameter ◽

Wheat Kernels ◽

Satureja Montana

Satureja montana L. (winter savory “Repandens”) is an evergreen shrub. In late summer 2010, blight was observed on a farm near Albenga (northern Italy) on 3% of 500 potted 2-month-old plants. Semicircular, water-soaked lesions appeared first on stems then on leaves. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage within 5 to 6 days. Stem fragments taken from the margin of the diseased tissues of 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 100 μg/liter streptomycin sulfate. A fungus with morphological characters of Rhizoctonia solani was consistently isolated. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tested strain. Hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from winter savory were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were repeated once. Mycelium of 10-day-old isolates from winter savory appeared light brown, compact, and radiate. Numerous, dark brown sclerotia, 1 to 4 mm in diameter (average 1.7), developed within 20 days after transfer of mycelia to PDA in 90-mm-diameter petri dishes and incubated (11-h daylight, 13-h dark) at 21 to 24°C. Descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (3). The internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 696 bp showed a 99% homology with the sequence of R. solani. The nucleotide sequence has been assigned GenBank No. JQ313811. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks (30 min at 121°C and 1 atm) for 15 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Five 90-day-old plants of S. montana were inoculated. Each plant grown in 2-liter pots in a steam disinfested peat/pumice/pine bark/clay mix (50:20:20:20:10) was inoculated with 10 g of infested wheat kernels placed at the base of the stem. Five plants inoculated with noninfested wheat kernels served as the control. Plants covered with plastic bags were arranged randomly in a growth chamber at 20 ± 1°C with 12-h light/dark for 5 days. Symptoms, similar to those observed in the farm, developed 4 days after inoculation. Ten colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice. Symptoms caused by R. solani have been recently observed on S. hortensis in Poland (4). This is, to our knowledge, the first report of blight of S. montana caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (3) R. T. Sherwood. Phytopathology 59:1924, 1969. (4) B. Zimowska. Herba Polonica 56:29, 2010.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First report of collar and root rot of faba bean caused by Rhizoctonia solani AG-2-2 IIIB in Bangladesh

Plant Disease ◽

10.1094/pdis-08-21-1603-pdn ◽

2021 ◽

Author(s):

S. K. Paul ◽

Dipali Rani Gupta ◽

Nur Uddin Mahmud ◽

A.N.M. Muzahid ◽

Tofazzal Islam

Keyword(s):

Rhizoctonia Solani ◽

Faba Bean ◽

Root Rot ◽

Disease Incidence ◽

Management Strategies ◽

Its Region ◽

Anastomosis Group ◽

Grain Legume ◽

Collar And Root Rot ◽

Wheat Kernels

Faba bean (Vicia faba L.) is an underutilized promising grain legume commercially grown in central and northern part of Bangladesh (Yasmin et al. 2020). In January 2021, faba bean plants exhibiting symptoms of collar and root rot and yellowing of leaves were observed in thirty plots of an experimental field at the Bangladesh Agricultural University (24.75° N, 90.50° E), Mymensingh, Bangladesh. Infected plants had dark brown to black lesions on the roots, extending above the collar region. An average disease incidence and severity was 7.16% and 6.91%, respectively. Eight diseased plants were collected from the field by uprooting one plant from each of eight randomly selected experimental plots and surface disinfected with sodium hypochlorite (0.2%) for 3 min followed by 1 min in ethanol (70%), and then rinsed three times with distilled water and dried on sterile paper towels. Collar and root pieces (5×5 mm) of symptomatic tissues were placed on Potato Dextrose Agar (PDA). Plates were incubated at 25°C for three days and isolates were purified from single-tip culture. The isolates produced brown colored mycelia often with brown sclerotia. Under microscope, fungal colonies exhibited right–angled branching with constriction at the base of hyphal branches and a septum near the originating point of hyphal branch consistent with the description of Rhizoctonia solani Kuhn (Sneh et al. 1991). The isolates grew at 35°C on PDA (5 mm/24). Molecular identification of the isolates BTRFB1 and BTRFB7 was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS1 and ITS4 (White et al. 1990). A BLAST search showed that the sequences (GenBank Accession nos. MZ158299.1 and MZ158298.1) had 99.28% similarity with R. solani isolates Y1063 and SX-RSD1 (GenBank Accession nos. JX913811.1 and KC413984.1, respectively). Phylogenetic analysis revealed that the present isolates grouped with R. solani anastomosis group AG-2-2 IIIB. To confirm pathogenicity, both isolates were grown individually on sterile wheat kernels at 28°C for 6 days (D’aes et al. 2011). Faba bean seedlings were grown in plastic pots containing sterile potting mix (field soil/composted manure/sand 2:2:1 [v/v]). Two-week-old plants were inoculated by placing five infested wheat seeds adjacent to the roots. Control pots were inoculated with sterile wheat kernels using the same procedure. Plants were placed in a growth room with a 16 h/8 h light/dark photoperiod at 25 ± 2°C after inoculation. Fifteen days after inoculation, typical collar and root rot symptoms were developed on inoculated plants, similar to symptoms observed in the field. Control plants remained non-symptomatic. Finally, six isolates of R. solani were isolated from the symptomatic plants and identified by morphological and molecular analysis. Rhizoctonia solani is the causal agent of seed and root rot, hypocotyl canker, and seedling damping-off diseases of faba bean in many other countries (Rashid and Bernier 1993; Assunção et al. 2011). To our knowledge, this is the first confirmed report of Rhizoctonia solani causing collar and root rot of faba bean in Bangladesh. This finding will be helpful for the development of management strategies to control this disease and to expand the production of faba bean in Bangladesh.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Target Spot of Broadleaf Tobacco Caused by Rhizoctonia solani (AG-3) in Connecticut

Plant Disease ◽

10.1094/pdis-04-12-0335-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

Rhizoctonia Solani ◽

Sequence Data ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2011, 15 transplant beds of broadleaf cigar wrapper tobacco (Nicotiana tabacum L., cv. C9) plants in Hartford County, Connecticut, were observed with almost every plant diseased. Leaf lesion symptoms ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Disease was subsequently observed, also at nearly 100% incidence in a 10-hectare field on that farm and at additional broadleaf tobacco farms from two other towns in Hartford County and one town in Tolland County. Lesions exhibited a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A. B. Frank) was isolated from the margins of lesions that had been surface sterilized in 0.5% NaOCl for 30 s and then rinsed in sterile distilled water and placed on the surface of half-strength potato dextrose agar (PDA). Multiple isolations were made and the pathogen was identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm, and hyphal branches occurring at approximately right angles, constricted at the base (4). Eight-week-old potted tobacco plants were each inoculated by spraying with a mycelial suspension (1 × 105 CFU) of an isolate of R. solani recovered from tobacco onto leaves, or with water alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants placed in trays filled to a depth of 1 cm with water in the growth chamber. After 8 days, the pathogen was reisolated from all inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were asymptomatic. DNA was liberated from hyphae of the R. solani isolate by bead beating in STE buffer using 0.15 mm zirconium beads. Two microliters of the eluate was used to amplify the ITS region. Amplified DNA was purified in a Qiagen QIAquick PCR purification kit and submitted to the Yale science hill genomic facility for standard Sanger dideoxy sequencing. The sequence was exactly the same as an isolate from Massachusetts that we sequenced in 2010 (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease has been previously reported on tobacco from South America, South Africa, and the southern United States (1), Canada (3), and Massachusetts (2). Conditions were very conducive for disease because 2011 was a very wet year in Connecticut. To our knowledge, this is the first report of this disease in broadleaf cigar wrapper tobacco in Connecticut. The sequence data suggested that it may have been introduced to Connecticut from Massachusetts. We have found the target spot pathogen distributed across the tobacco producing area of Connecticut. This constitutes a serious threat as there are no systemic fungicides currently registered for control of this disease in broadleaf tobacco. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993. (2) J. A. LaMondia and C. R. Vossbrinck, Plant Dis. 95:496, 2010. (3) R. D. Reeleder et al., Plant Dis., 80:712. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Rhizoctonia solani AG-4 on Epipremnum aureum in Buenos Aires, Argentina

Plant Disease ◽

10.1094/pdis.2001.85.1.96c ◽

2001 ◽

Vol 85 (1) ◽

pp. 96-96 ◽

Cited By ~ 1

Author(s):

E. R. Wright ◽

P. E. Grijalba ◽

L. Gasoni

Keyword(s):

Rhizoctonia Solani ◽

Buenos Aires ◽

Its Region ◽

Anastomosis Group ◽

Causal Agent ◽

Basal Stem Rot ◽

First Report ◽

Brown Discoloration ◽

Epipremnum Aureum ◽

Petri Plate

Root and basal stem rot, blighting, and wilting have been observed on Epipremnum aureum (Linden ex André) plants in many nurseries in and near Buenos Aires since 1997. Infected stem tissues show an intense dark brown discoloration and water soaking near the stem base that eventually leads to plant death. To determine the causal agent of the disease, small pieces of diseased tissue were surface-sterilized for 2 min in 2% sodium hypochlorite and plated on potato-dextrose agar (PDA). Whitish colonies that eventually turned brown developed in 2 to 3 days at 22 to 24°C. Irregularly shaped sclerotia were observed. Isolates typical of Rhizoctonia solani Kuhn exhibited mycelia with branches inclined in the direction of growth, constricted at the point of union with the main hyphae, with a septum in the branch near the constriction. No telemorph was observed. Nuclei in living hyphal mats were stained directly on a microscope slide coated with water agar according to the method of Tu and Kimbrough (4) and were examined at 400× magnification. The cells were multinucleate. Anastomosis group was determined by using known tester isolates of Rhizoctonia spp. (3). Positive anastomosis was observed with tester strains of AG-4 HG-II. The polymerase chain reaction was performed according to the protocol of Boysen et al (1) in order to confirm the anastomosis group. Primers used for the amplification of the ITS region were ITSI and LROR. Amplification of the ITS region indicated lack of variation with AG-4 tester strain. The pathogenicity of the isolate was determined with the inoculum-layer technique (2), consisting of a 7-day-old petri plate culture of the pathogen in PDA that is removed from the dish and placed intact on the soil, 2 to 4 cm under the roots of 10 healthy plants. Some leaves of the plants were placed in contact with the inoculated substratum. For a control, PDA was placed under the roots of other plants. Plants were maintained at 22 to 24°C, with close-to-saturation humidity. After 6 to 10 days, symptoms were similar to those previously observed. Initially leaves that had been placed in contact with the substratum showed dark areas with a watersoaked area 2 to 3 cm in diameter. These lesions expanded over the entire leaf blade moving into the petioles and stems killing the plant. One hundred percent of inoculated plants were infected. Koch's postulates were satisfied after reisolating the fungus. The characteristics of the causal agent are those of multinucleate isolates of R. solani belonging to the anastomosis group AG-4 HG-II (3). This is the first report of R. solani causing disease on E. aureum in Argentina. References: (1) M. Boysen, M. Borja, C. Del Corral, O. Salazar, and V. Rubio. Curr. Genet. 29:174–181, 1996. (2) A. F. Schmitthenner and J. W. Hilty. Phytopathology 52:177–178, 1962. (3) B. Sneh, L. Burpee, and A. Ogoshi. 1991. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN. (4) C. C. Tu and J. W. Kimbrough. Mycologia 65:941–944, 1973.

Download Full-text

First Report of Web Blight on Rebutia perplexa Caused by Rhizoctonia solani AG 2-2-IIIB in Italy

Plant Disease ◽

10.1094/pdis-10-13-1063-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 697-697 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

G. Ortu ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Aerial Mycelium ◽

Its Region ◽

Molecular Characteristics ◽

Fluorescent Light ◽

Pathogenicity Test ◽

Mycelium Growth ◽

Daily Growth ◽

First Report ◽

Wheat Kernels

Rebutia perplexa, Cactaceae family, is a clumping fine thorny cactus, producing several flushes of pink flowers. In the spring of 2013, a blight was observed in a farm located near Imperia (northern Italy) on 2% of 2,000 3-year-old plants, grown in plastic pots. Affected plants showed pale brown discoloration of stems, starting from the base, and eventually collapsed. Flowers also rotted and wilted. In the presence of high relative humidity, a rare, whitish mycelium developed on the surface of the substrate. Eventually, infected plants died. Symptomatic tissues of the stem were taken from 10 plants and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani (3) was consistently recovered. Three representative isolates obtained from affected plants were successfully paired with tester strains of R. solani (AG 1, AG 2-2-IIIB, AG 2-2-IV, AG 4, AG 7, AG 11) (2) and examined microscopically. Three replicated pairings were made for each tester strain. The Rebutia isolates anastomosed only with AG 2-2-IIIB tester strain with high hyphal fusion frequency. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed, indicating anastomosis reactions (1). Tests were performed twice. Mycelium of 15-day-old isolates maintained at 27 to 30°C, appeared whitish or pale buff in color, coarse, with a concentric zonation, scarce aerial mycelium, and without sclerotia. The optimum temperature for mycelium growth was 30°C (daily growth rate: 24.6 mm) and isolates grew also at 35°C. The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis of the 523-bp amplicon (GenBank Accession No. KF719318) showed a 99% homology with the sequence of the R. solani AG 2-2-IIIB isolate GU811672. The nucleotide sequence has been assigned the GenBank Accession No. KF719318. Therefore, on the basis of molecular characteristics, anastomosis tests, temperature growth, and cultural characteristics, the isolates from R. perplexa were identified as R. solani AG 2-2-IIIB. For pathogenicity tests, 3 g of colonized wheat kernel from 10-day-old cultures of a representative isolate of the fungus was added per 1 l of substrate in 12 potted healthy plants of R. perplexa. The inoculum was prepared by inoculating wheat kernels with the mycelium of 10-day-old cultures of the fungus and incubating at 25 ± 1°C (12 h fluorescent light, 12 h dark). Twelve plants inoculated with non-infested wheat kernels served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C. The first symptoms, similar to those observed in the farm, developed 5 days after inoculation. Fifteen days after the artificial inoculation, all inoculated plants were dead. R. solani was re-isolated only from the stems of symptomatic plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of blight of R. perplexa caused by R. solani in Italy as well as worldwide. References: (1) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (2) A. Ogoshi. Ann. Rev. Phytopathol. 25:125, 1987. (3) B. Sneh et al. Identification of Rhizoctonia species. APS Press, St Paul, MN, 1991.

Download Full-text

First report of Rhizoctonia solani Kühn AG 2-2 LP in Zoyzia japonica Steud in Brazil

Summa Phytopathologica ◽

10.1590/0100-5405/221916 ◽

2020 ◽

Vol 46 (4) ◽

pp. 289-298

Author(s):

Maria Aurea Saboya Chiaradia Picarelli ◽

Flavia Rodrigues Alves Patricio ◽

Ricardo Harakava ◽

Eliana Borges Rivas ◽

Addolorata Colariccio

Keyword(s):

Rhizoctonia Solani ◽

Mycelial Growth ◽

Its Region ◽

Anastomosis Group ◽

Large Patch ◽

First Report ◽

Rdna Its ◽

Rdna Its Region ◽

Important Disease

ABSTRACT The use of cultivated grasses in Brazil has grown by 40% between 2010 and 2015, and the species Zoysia japonica Steud, especially the cultivar ‘Esmeralda’, corresponds to 81% of the grass market in the country. The most important disease affecting zoysia grass, known as large patch, is caused by Rhizoctonia solani and occurs in the Brazilian lawns particularly during winter months. The aim of this study was to contribute to the identification and characterization of the anastomosis group of R. solani isolates from lesions typical of large patch collected from ‘Esmeralda’ grass at gardens and golf courses in the states of São Paulo and Bahia, Brazil. All 12 obtained isolates presented dark-brown colonies with aerial mycelial growth, multinucleated hyphae and absence of concentric zonation or sclerotia, and showed their greatest mycelial growth rate at 25°C. In pathogenicity experiments, except three out of R. solani isolates, reduced the growth of zoysia grass. Based on the analysis of sequences of the rDNA-ITS region, the isolates clustered with reference isolates of the anastomosis group AG 2-2 LP. Phylogenetic inference showed that the Brazilian isolates are grouped into two clades that shared the same common ancestral with 96% bootstrap. One of the clades includes only Brazilian isolates while the other one also includes American and Japanese R. solani isolates AG 2-2 LP. This is the first report and characterization of R. solani AG 2-2 LP in zoysiagrass in Brazil.

Download Full-text

First Report of Rhizoctonia solani AG-1-IB Causing Leaf Blight of Sorrel (Rumex acetosa) in Brazil

Plant Disease ◽

10.1094/pdis-04-13-0443-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 278-278

Author(s):

B. E. C. Miranda ◽

A. M. S. Cardoso ◽

R. W. Barreto

Keyword(s):

New York ◽

Rhizoctonia Solani ◽

Its Region ◽

The United States ◽

Anastomosis Group ◽

Culture Collection ◽

Representative Specimen ◽

Broad Host Range ◽

Rumex Acetosa ◽

First Report

Rumex acetosa L., common name sorrel (in Brazil, azedinha), is an herb from Europe and Asia commonly used either as a vegetable or a medicinal plant (1). No pathogen has been recorded on this plant species in Brazil, where it has been promoted as an alternative vegetable crop. During a routine inspection of a vegetable garden in the campus of the Universidade Federal de Viçosa (Viçosa, state of Minas Gerais, Brazil) in July 2011, a group of sorrel plants were found bearing blight symptoms. Infected leaves had laminae with soaked irregular necrotic areas and infected petioles had reddish lesions. Healthy leaves touched by neighboring blighted leaves became diseased. A mycelial web was always associated with necrotic tissues. A representative specimen was collected, dried in a plant press, and deposited in the local herbarium (VIC 39063). Pure cultures were obtained through direct transfer of mycelium to PDA plates and deposited in the culture collection at the Universidade Federal de Viçosa – Coleção Oswaldo Almeida Drummond (COAD 1265). Slides containing fungal structures were mounted in lactophenol and observed under a microscope (Olympus BX 51). The fungus had the following morphology: mycelium superficial, either filiform or monilioid and constricted at septae, 6 to 10 μm diameter, often branching at right angles or nearly so, typically bearing a septum at branches near the branching point. Additionally, large, poorly differentiated, dirty white sclerotia were formed in older cultures. When mounted in DAPI, 7-day-old mycelium was seen to bear 5 to 13 nuclei per cell. These characteristics suggested that the fungus was Rhizoctonia solani Kuhn (RS). Anastomosis group (AG) was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS5 and ITS4 (4). A BLAST search revealed that the sequence (GenBank Accession No. KC887353) had 96% sequence identity with RS AG-1-IB GenBank accessions JN426850.1, GU596491.1, JQ692292.1, and JQ692291.1. Pathogenicity of the isolate obtained from sorrel was tested by inoculating four healthy individuals with culture plugs taken from the margin of actively growing cultures on V8 juice agar. Inoculated plants were placed in a dew chamber for 48 h and later transferred to the bench of a greenhouse. Necrosis appeared on all inoculated plants 2 days after inoculation, developing into severe blight after 7 days. RS was isolated from infected tissues. RS AG-1-IB is known as a broad host-range plant pathogen (3). This is its first report as a pathogen of sorrel in Brazil. The sole other published record of this disease on sorrel is from the United States (2). References: (1) N. R. Madeira et al. Hortic. Brasil. 26:428, 2008. (2) G. L. Peltier. Parasitic rhizoctonias in America. University of Illinois Agricultural Experiment Station, 1915. (3) B. Sneh, L. Burpee, and A. Ogoshi. Identification of Rhizoctonia species. APS Press, St Paul, MN, 1991. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

Download Full-text