scholarly journals A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 556-556 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
K. J. Lewis ◽  
D. B. Langston
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Substrate Utilization ◽  
Rrna Gene ◽  
Conventional Pcr ◽  
Specific Primers ◽  
Necrotic Spots ◽  
The 16S Rrna Gene

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose–CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals Apis andreniformis associated Actinomycetes show antimicrobial activity against black rot pathogen (Xanthomonas campestris pv. campestris)

PeerJ ◽  
2021 ◽  
Vol 9 ◽  
pp. e12097
Author(s):  
Yaowanoot Promnuan ◽  
Saran Promsai ◽  
Wasu Pathom-aree ◽  
Sujinan Meelai
Keyword(s):  
Antimicrobial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Honey Bee ◽  
Pseudomonas Syringae ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Rrna Gene ◽  
Apis Andreniformis

This study aimed to investigate cultivable actinomycetes associated with rare honey bee species in Thailand and their antagonistic activity against plant pathogenic bacteria. Actinomycetes were selectively isolated from the black dwarf honey bee (Apis andreniformis). A total of 64 actinomycete isolates were obtained with Streptomyces as the predominant genus (84.4%) followed by Micromonospora (7.8%), Nonomuraea (4.7%) and Actinomadura (3.1%). All isolates were screened for antimicrobial activity against Xanthomonas campestris pv. campestris, Pectobacterium carotovorum and Pseudomonas syringae pv. sesame. Three isolates inhibited the growth of X. campestris pv. campestris during in vitro screening. The crude extracts of two isolates (ASC3-2 and ASC5-7P) had a minimum inhibitory concentration (MIC) of 128 mg L−1against X. campestris pv. campestris. For isolate ACZ2-27, its crude extract showed stronger inhibitory effect with a lower MIC value of 64 mg L−1 against X. campestris pv. campestris. These three active isolates were identified as members of the genus Streptomyces based on their 16S rRNA gene sequences. Phylogenetic analysis based on the maximum likelihood algorithm showed that isolate ACZ2-27, ASC3-2 and ASC5-7P were closely related to Streptomyces misionensis NBRC 13063T (99.71%), Streptomyces cacaoi subsp. cacaoi NBRC 12748T (100%) and Streptomyces puniceus NBRC 12811T (100%), respectively. In addition, representative isolates from non-Streptomyces groups were identified by 16S rRNA gene sequence analysis. High similarities were found with members of the genera Actinomadura, Micromonospora and Nonomuraea. Our study provides evidence of actinomycetes associated with the black dwarf honey bee including members of rare genera. Antimicrobial potential of these insect associated Streptomyces was also demonstrated especially the antibacterial activity against phytopathogenic bacteria.

Overestimation of Streptococcus mutans prevalence by nested PCR detection of the 16S rRNA gene

2006 ◽  
Vol 55 (1) ◽  
pp. 109-113 ◽  
Author(s):  
Ali Al-Ahmad ◽  
Thorsten Mathias Auschill ◽  
Gabriele Braun ◽  
Elmar Hellwig ◽  
Nicole Birgit Arweiler
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Streptococcus Mutans ◽  
Nested Pcr ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
Rrna Gene ◽  
Direct Pcr ◽  
Specific Primers ◽  
The 16S Rrna Gene

This study was carried out in order to compare two PCR-based methods in the detection of Streptococcus mutans. The first PCR method was based on primers for the 16S rRNA gene and the second method was based on specific primers that targeted the glucosyltransferase gene (gtfB). Each PCR was performed with eight different streptococci from the viridans group, five other streptococci and 17 different non-streptococcal bacterial strains. Direct use of the S. mutans 16S rRNA gene-specific primers revealed that Streptococcus gordonii and Streptococcus infantis were also detected. After amplifying the 16S rRNA gene with universal primers and subsequently performing nested PCR, the S. mutans-specific nested primers based on the 16S rRNA gene detected all tested streptococci. There was no cross-reaction of the gtfB primers after direct PCR. Our results indicate that direct PCR and nested PCR based on 16S rRNA genes can reveal false-positive results for oral streptococci and lead to an overestimation of the prevalence of S. mutans with regards to its role as the most prevalent causative agent of dental caries.

scholarly journals Genetic characterization of the microbiota of artisan fresh cheese from the Papaloapan region

2021 ◽  
Vol 6 (2) ◽  
pp. 61-85
Author(s):  
Miguel A. García-Muñoz ◽  
◽  
Nancy Cruz-Velazco ◽  
América Chávez-Martínez ◽  
Cirilo Nolasco-Hipólito ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gel Electrophoresis ◽  
Pathogenic Bacteria ◽  
Denaturing Gradient Gel Electrophoresis ◽  
Starter Cultures ◽  
Rrna Gene ◽  
Gradient Gel Electrophoresis ◽  
Fresh Cheese ◽  
The 16S Rrna Gene

The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) method was used for bacteria identification. For all the samples, the presence of aerobic mesophiles, Streptococcus mesophiles and thermophiles, Lactobacillus mesophiles, Leuconostoc, total coliforms, Staphylococcus aureus, molds, and yeasts were identified. The complexity and variety of microorganisms in the summer and winter seasons samples were not significantly different. In conclusion, all samples of fresh artisan cheeses were under high microbial loads. Lactic Acid Bacteria (LAB) were in a typical load, as established by the quality and safety standards in the food industry. Conversely, pathogenic bacteria exceeded this limit. The microorganisms present in the fresh artisanal cheeses of the Papaloapan region were identified with precision, regarding the count and their diversity. A recommendation for the cheese manufacturers is to prepare starter cultures by selecting the appropriate microorganisms to produce the desirable characteristics such as aroma and flavor and reduce the risk of microbial infections by using pasteurized milk.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Rapid identification of Saccharomonospora strains by multiplex PCR using species-specific primers within the 16S rRNA gene

1996 ◽  
Vol 27 (1) ◽  
pp. 89-95 ◽  
Author(s):  
Jung-Hoon Yoon ◽  
Sung Taik Lee ◽  
Yong Kook Shin ◽  
Sam-Bong Kim ◽  
Hong-Joong Kim ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Multiplex Pcr ◽  
Rapid Identification ◽  
Rrna Gene ◽  
Specific Primers ◽  
Species Specific ◽  
The 16S Rrna Gene

scholarly journals Accuracy of Conventional PCR Targeting the 16S rRNA Gene with the Ot-16sRF1 and Ot-16sRR1 Primers for Diagnosis of Scrub Typhus: a Case-Control Study: TABLE 1

2015 ◽  
Vol 54 (1) ◽  
pp. 178-179 ◽  
Author(s):  
Choon-Mee Kim ◽  
Min Keun Cho ◽  
Dong-Min Kim ◽  
Na-Ra Yun ◽  
Seok Won Kim ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Scrub Typhus ◽  
Rrna Gene ◽  
Conventional Pcr ◽  
Content Type ◽  
Increased Sensitivity ◽  
Good Diagnostic Accuracy ◽  
Pcr Targeting ◽  
The 16S Rrna Gene

We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis ofOrientia tsutsugamushiinfection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy.

scholarly journals Cultivable bacterial diversity of the canine dental plaque as a potential source of bacterial infections

2021 ◽  
Vol 90 (2) ◽  
pp. 171-178
Author(s):  
Marián Maďar ◽  
Jana Kačírová ◽  
Aladár Maďari ◽  
Rastislav Mucha ◽  
Eva Styková ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Dental Plaque ◽  
Pathogenic Bacteria ◽  
Companion Animals ◽  
Oral Bacteria ◽  
Universal Primers ◽  
Rrna Gene ◽  
Persistent Problem ◽  
The 16S Rrna Gene

Dental diseases are a persistent problem, not only in humans, but very often in companion animals as well. Aetiological agents of these diseases are the dental plaque bacteria. In the present study, we focused on identifying cultivable bacteria living in the dental plaque of dogs, specifically dogs suffering from the early stages of periodontal disease. Canine oral bacteria pose a risk to humans that get bitten by the dog, but they also have a zoonotic potential. Dental plaque samples were taken from five dogs of small breeds. Samples were cultured under aerobic and anaerobic conditions on several types of microbiological agars. All obtained and selected bacterial colonies were identified by PCR with universal primers for the 16S rRNA gene and the sequences of the 16S rRNA gene were compared with the sequences available in the GenBank database using BLASTn analysis. A total of 75 bacteria belonging to five phyla, predominantly to Firmicutes and Proteobacteria, were identified. The most frequent species was Pasteurella canis which was detected in all samples. In addition, representatives of the genera Actinomyces, Bacillus, Bacteroides, Corynebacterium, Frederiksenia, Fusobacterium, Haemophilus, Lactobacillus, Leucobacter, Neisseria, Ottowia, Porphyromonas, Pseudomonas, Staphylococcus, Stenotrophomonas and Streptococcus were detected in the samples. In the present study, a broad spectrum of bacteria in dental plaque samples, including canine periodontal pathogens such as Porphyromonas gulae or Porphyromonas macacae were identified. In addition, highly pathogenic bacteria, specifically Actinomyces hordeovulneris, Bacillus circulans, and Bacteroides pyogenes, which pose a serious risk to human health, were detected in samples.

Sign in / Sign up

Export Citation Format

Share Document