scholarly journals Apis andreniformis associated Actinomycetes show antimicrobial activity against black rot pathogen (Xanthomonas campestris pv. campestris)

PeerJ ◽  
2021 ◽  
Vol 9 ◽  
pp. e12097
Author(s):  
Yaowanoot Promnuan ◽  
Saran Promsai ◽  
Wasu Pathom-aree ◽  
Sujinan Meelai
Keyword(s):  
Antimicrobial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Honey Bee ◽  
Pseudomonas Syringae ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Rrna Gene ◽  
Apis Andreniformis

This study aimed to investigate cultivable actinomycetes associated with rare honey bee species in Thailand and their antagonistic activity against plant pathogenic bacteria. Actinomycetes were selectively isolated from the black dwarf honey bee (Apis andreniformis). A total of 64 actinomycete isolates were obtained with Streptomyces as the predominant genus (84.4%) followed by Micromonospora (7.8%), Nonomuraea (4.7%) and Actinomadura (3.1%). All isolates were screened for antimicrobial activity against Xanthomonas campestris pv. campestris, Pectobacterium carotovorum and Pseudomonas syringae pv. sesame. Three isolates inhibited the growth of X. campestris pv. campestris during in vitro screening. The crude extracts of two isolates (ASC3-2 and ASC5-7P) had a minimum inhibitory concentration (MIC) of 128 mg L−1against X. campestris pv. campestris. For isolate ACZ2-27, its crude extract showed stronger inhibitory effect with a lower MIC value of 64 mg L−1 against X. campestris pv. campestris. These three active isolates were identified as members of the genus Streptomyces based on their 16S rRNA gene sequences. Phylogenetic analysis based on the maximum likelihood algorithm showed that isolate ACZ2-27, ASC3-2 and ASC5-7P were closely related to Streptomyces misionensis NBRC 13063T (99.71%), Streptomyces cacaoi subsp. cacaoi NBRC 12748T (100%) and Streptomyces puniceus NBRC 12811T (100%), respectively. In addition, representative isolates from non-Streptomyces groups were identified by 16S rRNA gene sequence analysis. High similarities were found with members of the genera Actinomadura, Micromonospora and Nonomuraea. Our study provides evidence of actinomycetes associated with the black dwarf honey bee including members of rare genera. Antimicrobial potential of these insect associated Streptomyces was also demonstrated especially the antibacterial activity against phytopathogenic bacteria.

scholarly journals Antimicrobial activity of Streptomyces spp. isolated from Apis dorsata combs against some phytopathogenic bacteria

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e10512
Author(s):  
Yaowanoot Promnuan ◽  
Saran Promsai ◽  
Sujinan Meelai
Keyword(s):  
Antimicrobial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Honey Bee ◽  
Crude Extract ◽  
Pathogenic Bacteria ◽  
Rrna Gene ◽  
Apis Dorsata ◽  
Phytopathogenic Bacteria ◽  
Plant Pathogenic Bacteria

The aim of this study was to investigate the antimicrobial potential of actinomycetes isolated from combs of the giant honey bee, Apis dorsata. In total, 25 isolates were obtained from three different media and were screened for antimicrobial activity against four plant pathogenic bacteria (Ralstonia solanacearum, Xanthomonas campestris pv. campestris, Xanthomonas oryzae pv. oryzae and Pectobacterium carotovorum). Following screening using a cross-streaking method, three isolates showed the potential to inhibit the growth of plant pathogenic bacteria. Based on a 96-well microtiter assay, the crude extract of DSC3-6 had minimum inhibitory concentration (MIC) values against X. oryzae pv. oryzae, X. campestris pv. campestris, R. solanacearum and P. carotovorum of 16, 32, 32 and 64 mg L−1, respectively. The crude extract of DGA3-20 had MIC values against X. oryzae pv. oryzae, X. campestris pv. campestris, R. solanacearum and P. carotovorum of 32, 32, 32 and 64 mg L−1, respectively. The crude extract of DGA8-3 at 32 mgL−1 inhibited the growth of X. oryzae pv. oryzae, X. campestris pv. campestris, R. solanacearum and P. carotovorum. Based on their 16S rRNA gene sequences, all isolates were identified as members of the genus Streptomyces. The analysis of 16S rRNA gene sequence similarity and of the phylogenetic tree based on the maximum likelihood algorithm showed that isolates DSC3-6, DGA3-20 and DGA8-3 were closely related to Streptomyces ramulosus (99.42%), Streptomyces axinellae (99.70%) and Streptomyces drozdowiczii (99.71%), respectively. This was the first report on antibacterial activity against phytopathogenic bacteria from actinomycetes isolated from the giant honey bee.

scholarly journals A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 556-556 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
K. J. Lewis ◽  
D. B. Langston
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Substrate Utilization ◽  
Rrna Gene ◽  
Conventional Pcr ◽  
Specific Primers ◽  
Necrotic Spots ◽  
The 16S Rrna Gene

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose–CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals In VitroActivity of Glucosinolates and Their Degradation Products against Brassica-Pathogenic Bacteria and Fungi

2014 ◽  
Vol 81 (1) ◽  
pp. 432-440 ◽  
Author(s):  
T. Sotelo ◽  
M. Lema ◽  
P. Soengas ◽  
M. E. Cartea ◽  
P. Velasco
Keyword(s):  
Pseudomonas Syringae ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Degradation Products ◽  
Allyl Isothiocyanate ◽  
Leaf Extracts ◽  
Soil Pathogens ◽  
Content Type ◽  
Positive Effects

ABSTRACTGlucosinolates (GSLs) are secondary metabolites found inBrassicavegetables that confer on them resistance against pests and diseases. Both GSLs and glucosinolate hydrolysis products (GHPs) have shown positive effects in reducing soil pathogens. Information about theirin vitrobiocide effects is scarce, but previous studies have shown sinigrin GSLs and their associated allyl isothiocyanate (AITC) to be soil biocides. The objective of this work was to evaluate the biocide effects of 17 GSLs and GHPs and of leaf methanolic extracts of different GSL-enrichedBrassicacrops on suppressingin vitrogrowth of two bacterial (Xanthomonas campestrispv. campestris andPseudomonas syringaepv. maculicola) and two fungal (AlternariabrassicaeandSclerotiniascletoriorum)Brassicapathogens. GSLs, GHPs, and methanolic leaf extracts inhibited the development of the pathogens tested compared to the control, and the effect was dose dependent. Furthermore, the biocide effects of the different compounds studied were dependent on the species and race of the pathogen. These results indicate that GSLs and their GHPs, as well as extracts of differentBrassicaspecies, have potential to inhibit pathogen growth and offer new opportunities to study the use ofBrassicacrops in biofumigation for the control of multiple diseases.

scholarly journals Inorganic Phosphate Solubilization by a Novel Isolated Bacterial Strain Enterobacter sp. ITCB-09 and Its Application Potential as Biofertilizer

Agriculture ◽  
2020 ◽  
Vol 10 (9) ◽  
pp. 383 ◽  
Author(s):  
Gustavo Enrique Mendoza-Arroyo ◽  
Manuel Jesús Chan-Bacab ◽  
Ruth Noemi Aguila-Ramírez ◽  
Benjamín Otto Ortega-Morales ◽  
René Efraín Canché Solís ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Inorganic Phosphate ◽  
Extracellular Polymeric Substances ◽  
Phosphate Solubilization ◽  
Rrna Gene ◽  
Bacterial Strains ◽  
Habanero Pepper ◽  
Phosphate Solubilizing

The excessive use of fertilizers in agriculture is mainly due to the recognized plant requirements for soluble phosphorus. This problem has limited the implementation of sustainable agriculture. A viable alternative is to use phosphate solubilizing soil microorganisms. This work aimed to isolate inorganic phosphorus-solubilizing bacteria from the soils of agroecosystems, to select and identify, based on sequencing and phylogenetic analysis of the 16S rRNA gene, the bacterium with the highest capacity for in vitro solubilization of inorganic phosphate. Additionally, we aimed to determine its primary phosphate solubilizing mechanisms and to evaluate its effect on Habanero pepper seedlings growth. A total of 21 bacterial strains were isolated by their activity on Pikovskaya agar. Of these, strain ITCB-09 exhibited the highest ability to solubilize inorganic phosphate (865.98 µg/mL) through the production of organic acids. This strain produced extracellular polymeric substances and siderophores that have ecological implications for phosphate solubilization. 16S rRNA gene sequence analysis revealed that strain ITCB-09 belongs to the genus Enterobacter. Enterobacter sp. ITCB-09, especially when immobilized in beads, had a positive effect on Capsicum chinense Jacq. seedling growth, indicating its potential as a biofertilizer.

Terrabacter terrae sp. nov., a novel actinomycete isolated from soil in Spain

2005 ◽  
Vol 55 (6) ◽  
pp. 2491-2495 ◽  
Author(s):  
Marta Montero-Barrientos ◽  
Raúl Rivas ◽  
Encarna Velázquez ◽  
Enrique Monte ◽  
Manuel G. Roig
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
Sequence Similarity ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Biochemical Tests ◽  
Bacterium Strain

A Gram-positive, aerobic, long-rod-shaped, non-spore-forming bacterium (strain PPLBT) was isolated from soil mixed with Iberian pig hair. This actinomycete showed keratinase activity in vitro when chicken feathers were added to the culture medium. Strain PPLBT was oxidase-negative and catalase-positive and produced lipase and esterase lipase. This actinomycete grew at 40 °C on nutrient agar and in the same medium containing 5 % (w/v) NaCl. Growth was observed with many different carbohydrates as the sole carbon source. On the basis of 16S rRNA gene sequence similarity, strain PPLBT was shown to belong to the genus Terrabacter of the family Intrasporangiaceae. Strain PPLBT showed 98·8 % 16S rRNA gene sequence similarity to Terrabacter tumescens. Chemotaxonomic data, such as the main ubiquinone (MK-8), the main polar lipids (phosphatidylethanolamine, diphosphatidylglycerol and phosphatidylinositol) and the main fatty acids (i-C15 : 0, ai-C15 : 0, i-C16 : 0 and ai-C17 : 0) supported the affiliation of strain PPLBT to the genus Terrabacter. The G+C content of the DNA was 71 mol%. The results of DNA–DNA hybridization (36·6 % relatedness between Terrabacter tumescens and strain PPLBT) and physiological and biochemical tests suggested that strain PPLBT belongs to a novel species of the genus Terrabacter, for which the name Terrabacter terrae sp. nov. is proposed. The type strain is PPLBT (=CECT 3379T=LMG 22921T).

scholarly journals In Vitro Activity of Amikacin against Isolates of Mycobacterium avium Complex with Proposed MIC Breakpoints and Finding of a 16S rRNA Gene Mutation in Treated Isolates

2013 ◽  
Vol 51 (10) ◽  
pp. 3389-3394 ◽  
Author(s):  
B. A. Brown-Elliott ◽  
E. Iakhiaeva ◽  
D. E. Griffith ◽  
G. L. Woods ◽  
J. E. Stout ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Mutation ◽  
Mycobacterium Avium ◽  
Mycobacterium Avium Complex ◽  
Vitro Activity ◽  
Rrna Gene ◽  
In Vitro Activity

scholarly journals Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos) Shown with 16S rRNA Gene-Based Microbial Community Analysis

2013 ◽  
Vol 2013 ◽  
pp. 1-5 ◽  
Author(s):  
Isamu Maeda ◽  
Mohammad Shohel Rana Siddiki ◽  
Tsutomu Nozawa-Takeda ◽  
Naoki Tsukahara ◽  
Yuri Tani ◽  
...  
Keyword(s):  
Microbial Community ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
Community Analysis ◽  
Microbial Community Analysis ◽  
Intestinal Microbiome ◽  
Rrna Gene ◽  
Jungle Crow ◽  
Corvus Macrorhynchos

Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous toEimeriasp., which belongs to the protozoan phylumApicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the generaCampylobacterandBrachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

scholarly journals In Vitro Activity of Amikacin against Isolates of Mycobacterium avium Complex with Proposed MIC Breakpoints and Finding of a 16S rRNA Gene Mutation in Treated Isolates

2014 ◽  
Vol 52 (4) ◽  
pp. 1311-1311 ◽  
Author(s):  
B. A. Brown-Elliott ◽  
E. Iakhiaeva ◽  
D. E. Griffith ◽  
G. L. Woods ◽  
J. E. Stout ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Mutation ◽  
Mycobacterium Avium ◽  
Mycobacterium Avium Complex ◽  
Vitro Activity ◽  
Rrna Gene ◽  
In Vitro Activity

scholarly journals PROBIOTIC CHARACTERIZATION OF BACILLUS SUBTILIS STRAIN ISOLATED FROM INFANT FECAL MATTER REVEALED BY 16S rRNA GENE AND PHYLOGENETIC ANALYSIS

2021 ◽  
pp. 77-85
Author(s):  
DEVARANJAN DAS ◽  
CHANDI CHARAN RATH ◽  
NAKULANANDA MOHANTY ◽  
SMITA HASINI PANDA
Keyword(s):  
Antimicrobial Activity ◽  
Bacillus Subtilis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Bile Salt ◽  
Rrna Gene ◽  
Probiotic Properties ◽  
Fecal Matter ◽  
Antimicrobial Metabolites

Objective: The rationale of our study was to isolate and identify the putative probiotic strain from infant fecal matter exhibiting a broad range of antimicrobial activity and to analyze the effect of different culturing conditions on its probiotic properties and the production of antimicrobial metabolites. Methods: In the present study, bacterial strains were screened for probiotic properties and antimicrobial activity from infant fecal matter (6 months–2 years). The effect of varying culture conditions such as tolerance to acid, bile salt, phenol, NaCl, pH, incubation period, and temperature along with autoaggregation assay, hydrophobicity, and hemolysis was studied. The characterization of the potent strain was studied by morphological, biochemical, and 16S rRNA gene sequencing along the phylogenetic affiliation of the strain was studied. Results: Two putative probiotic bacteria (DAM and IFM) were isolated, identified, characterized, and predicted at pH 2.0, 3.0, and 4.0, the isolate IFM had 50%, 60%, and 70% survivability, while isolate DAM had 55%, 63%, and 75% survivability, respectively. At a bile salt concentration of 0.5%, both isolates had a 75% survival rate. The isolates exhibited a high percentage of hydrophobicity and autoaggregation. The isolates also had non-hemolytic activity and were susceptible to many clinical tested antibiotics (tetracycline, erythromycin, ampicillin, gentamycin, penicillin, etc.). The isolate showed antimicrobial activity against enteric pathogens such as Staphylococcus aureus, Escherichia coli, and Shigella dysenteriae. The accession number of Bacillus subtilis MT279753 and MK453362 was submitted to NCBI. Conclusion: The result revealed that isolates have potent probiotic properties and possess a direct influence on the production of antimicrobial metabolites. These parameters can be modified for the improvement of the potentiality of the isolates.

Sign in / Sign up

Export Citation Format

Share Document