First Report of Grapevine yellow speckle viroid 1 and Hop stunt viroid Infecting Grapevines (Vitis vinifera) in Korea

In February 2009, grapevines (Vitis vinifera) in a commercial vineyard in Auckland were showing shortened, spindly canes with tiny leaves. Approximately 10% of the vines were affected. An RNeasy Plant Mini Kit (Qiagen, Valencia, CA) was used to isolate total RNA from leaves collected from six symptomatic (cvs. BAC0022A and Syrah) and eight symptomless vines (cvs. BAC0022A, Syrah, and Chardonnay). RNA was tested by reverse transcription-PCR for the presence of Australian grapevine viroid, Citrus exocortis viroid, Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2, and Hop stunt viroid (HSVd). Four of the six symptomatic and all the symptomless vines tested positive for GYSVd-1 using primers 5′-TGTGGTTCCTGTGGTTTCAC-3′ and 5′-ACCACAAGCAAGAAGATCCG-3′, which amplify the complete genome (368 bp), and published primers PBCVd100C/194H (3), which amplify a 220-bp region of the genome. Amplicons from each PCR were transformed into a pCR 4-TOPO vector (Invitrogen, Carlsbad, CA), cloned, and sequenced. Sequence from both PCRs aligned identically to generate a consensus sequence (GenBank Accession No. HQ447056), which showed 99% nt identity to GYSVd-1 (GenBank No. X87906) by BLASTN analysis. All symptomatic and symptomless vines also tested positive for HSVd using primers C/H-HSVd (4) and HSVd-C60/H79 (1), which amplify the complete genome (298 bp). Amplicons from each isolate were cloned and sequenced. Sequence from both PCRs were aligned. Clones from all isolates, with the exception of one, aligned identically to create a consensus sequence (GenBank No. HQ447057) that showed 99% nt identity to Chinese HSVd isolates from grapevine (GenBank Nos. DQ371436–59) by BLASTN analysis. Sequence from the remaining isolate (GenBank No. HQ447056) was identical to a German Riesling grape isolate of HSVd (GenBank No. X06873). The presence of each viroid was further confirmed in PCR-positive plants by dot-blot hybridization with digoxigenin-labeled synthetic ssRNA probes specific to the full-length genomes of GYSVd-1 and HSVd (S. Harper and L. Ward, unpublished data). To our knowledge, this is the first report of GYSVd-1 and HSVd in V. vinifera in New Zealand. Since both viroids were detected in symptomatic and symptomless plants, the symptoms observed in the vineyard cannot be attributed to viroid infection. Symptoms described for GYSVd-1 include leaf spots and flecks, but no disease symptoms have been reported in grapes as a result of HSVd (2). Viruses found in the vines include Grapevine leaf roll virus-3, Grapevine viruses A and B, and Rupestris stem pitting associated virus, but these are not thought to be the cause of the symptoms. Two sequence types of HSVd were found, suggesting at least two separate introductions of HSVd into the vineyard. The vineyard is more than 40 years old so both viroids may have been present for some years. Export of wine from New Zealand was worth 1 billion dollars in 2009, so there is potential for these viroids to have an economic impact if symptoms are expressed. HSVd has been reported from China, Europe, Japan, Middle East, Pakistan, and the United States. GYSVd-1 has been reported from Australia, China, East Mediterranean, Europe, Japan, and the United States. References: (1) A. Hadidi et al. Acta Hortic. 309:339, 1992. (2) A. Hadidi et al., eds. Viroids. CSIRO Publishing, Collingwood, Australia, 2003. (3) R. Nakaune and M. Nakano. J. Virol. Methods 134:244, 2006. (4) A. M. Shamoul et al. J. Virol. Methods 105:115, 2002.

Download Full-text

First Report of Citrus Exocortis Viroid and Two Citrus Variants of the Hop Stunt Viroid on Lemon in Azerbaijan

Plant Disease ◽

10.1094/pdis-05-16-0761-pdn ◽

2016 ◽

Vol 100 (11) ◽

pp. 2341-2341 ◽

Cited By ~ 1

Author(s):

S. H. Tan ◽

T. H. O. Talibov ◽

R. R. Krueger ◽

S. Bodaghi ◽

T. Dang ◽

...

Keyword(s):

First Report ◽

Stunt Viroid ◽

Citrus Exocortis Viroid ◽

Hop Stunt Viroid

Download Full-text

First Report of Grapevine yellow speckle viroid 1, Grapevine yellow speckle viroid 2, and Hop stunt viroid Infecting Grapevines (Vitis spp.) in Nigeria

Plant Disease ◽

10.1094/pdis-07-17-1133-pdn ◽

2018 ◽

Vol 102 (1) ◽

pp. 259-259 ◽

Cited By ~ 2

Author(s):

A. M. Zongoma ◽

D. B. Dangora ◽

M. Al Rwahnih ◽

S. P. Bako ◽

M. D. Alegbejo ◽

...

Keyword(s):

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Vitis Spp

Download Full-text

Complete Genome Sequences of Grapevine Yellow Speckle Viroid 1 and Hop Stunt Viroid Assembled from the Transcriptome of Ixeridium dentatum Plants

Genome Announcements ◽

10.1128/genomea.01248-15 ◽

2015 ◽

Vol 3 (5) ◽

Cited By ~ 4

Author(s):

Joong-Hwan Lee ◽

Seungmo Lim ◽

Seung-Won Lee ◽

Ran Hee Yoo ◽

Davaajargal Igori ◽

...

Keyword(s):

Complete Genome ◽

Transcriptome Data ◽

Genome Sequences ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

The Family

Here, we report complete genome sequences of grapevine yellow speckle viroid 1 (GYSVd1) and hop stunt viroid (HSVd), members of the family Pospiviroidae , assembled from the transcriptome data generated from Ixeridium dentatum plants. To our knowledge, this is the first report of GYSVd1 and HSVd in I. dentatum .

Download Full-text

First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Plant Disease ◽

10.1094/pdis-04-21-0863-pdn ◽

2021 ◽

Author(s):

Dong Xu ◽

Charith Raj Adkar-Purushothama ◽

Pierre Lemoyne ◽

Jean Pierre Perreault ◽

Mamadou Fall

Keyword(s):

Rna Extraction ◽

Leaf Tissue ◽

Positive Sequence ◽

Wine Grape ◽

Library Preparation ◽

Rt Pcr ◽

Tissue Samples ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

Download Full-text

First Report of Hop Stunt Viroid Infecting Hop in Ohio

Plant Disease ◽

10.1094/pdis-02-19-0402-pdn ◽

2019 ◽

Vol 103 (7) ◽

pp. 1802-1802

Author(s):

J. Han ◽

X.-L. Yao ◽

F. Qu ◽

R. M. Kaufman ◽

M. L. Lewis Ivey

Keyword(s):

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid

Download Full-text

First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽

10.1094/pdis.2003.87.12.1537b ◽

2003 ◽

Vol 87 (12) ◽

pp. 1537-1537 ◽

Cited By ~ 1

Author(s):

M. Hassan ◽

P. Rysanek ◽

F. Di Serio

Keyword(s):

Czech Republic ◽

Stone Fruit ◽

Reference Sequence ◽

Mixed Infections ◽

Rt Pcr ◽

The Czech Republic ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Download Full-text

First Report of Hop stunt viroid in Peach Trees in Korea

Plant Disease ◽

10.1094/pdis-06-16-0823-pdn ◽

2016 ◽

Vol 100 (12) ◽

pp. 2543-2543 ◽

Cited By ~ 1

Author(s):

Y. H. Jo ◽

H. S. Chu ◽

J. K. Cho ◽

S. Lian ◽

H. S. Choi ◽

...

Keyword(s):

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Peach Trees

Download Full-text

First Report of Grapevine yellow speckle viroid-1 and Hop stunt viroid Infecting Grapevines (Vitis vinifera) in India

Plant Disease ◽

10.1094/pdis-05-13-0494-pdn ◽

2013 ◽

Vol 97 (11) ◽

pp. 1517-1517 ◽

Cited By ~ 14

Author(s):

A. B. Sahana ◽

C. R. Adkar-Purushothama ◽

G. Chennappa ◽

Z. X. Zhang ◽

M. Y. Sreenivasa ◽

...

Keyword(s):

Sequence Analysis ◽

Vitis Vinifera ◽

Northern Blot ◽

Single Type ◽

Rt Pcr ◽

Thompson Seedless ◽

Stunt Viroid ◽

Blast Analysis ◽

Hop Stunt Viroid ◽

Viroid Infection

During March through July 2012, 10 to 15% of the Vitis vinifera cultivars Thompson Seedless and Anab-e-Shahi exhibited yellow leaf spots and flecks, shortened internodes, and tiny yellow leaves in vineyards of the Bijapur, Doddaballapur, and Kolar districts of Karnataka State, India. These are the major grapevine cultivation regions in India. Samples were collected from four different plants from each district (12 samples in total) and RNA was extracted using 2X CTAB buffer (1). Presence of Grapevine yellow speckle viroid1 (GYSVd-1, genus Apscaviroid) was tested by reverse transcription (RT)-PCR with primer pair PBCVd100C/194H (4) for the amplification of a 220-bp region of the genome. In agarose gel electrophoresis, five samples showed amplicons of the expected size. These amplicons were cloned and sequenced. BLAST analysis confirmed the presence of GYSVd-1. Based on this data, the full-length genome of GYSVd-1 was amplified by RT-PCR using primer pair 341M (5′-CACTCGCGGGGCGCGTTGGA-3′) and 342P (5′-CAATCCCCGGAACCCCCGCT-3′) and the amplicons were cloned and sequenced. Sequence analysis revealed two sequence variants namely Kar-1 (GenBank Accession No. AB742222) and Kar-2 (AB742223) with 98% and 99% identity to GYSVd-1 variants IXc (X87913) and II (X87906), respectively. GYSVd-1 variants Kar-1 and Kar-2 clustered in two distinct phylogenetic sub-clades. All 12 samples also tested positive for Hop stunt viroid (HpSVd, genus Hostuviroid) in two separate sets of RT-PCR using HSV-78P (5′-AACCCGGGGCAACTCTTCTC-3′) and HSV-83M (5′-AACCCGGGGCTCCTTTCTCA-3′); and HSV-7P (5′-AATTCTCGAGTTGCCGC-3′) and HSV-220M (5′-CGAACCGAGAGGTGATGCCA-3′), with the expected size of 303 and 213 bp, respectively (3). Sequence analysis of the amplicons confirmed the presence of HpSVd. Alignment of HpSVd nucleotide sequences obtained from the 12 samples showed the presence of a single type of sequence variant, namely Ind-2 (AB742225). BLAST analysis showed 99% sequence identity of Ind-2 with a HpSVd variant isolated from a 100-year-old grapevine in China. All 12 grapevine samples were also tested for the presence of Australian grapevine viroid (AGVd, genus Apscaviroid), Grapevine yellow speckle viroid 2 (GYSVd 2, genus Apscaviroid), and Citrus exocortis viroid (CEVd, genus Pospiviroid) by RT-PCR as described previously (2). None of the samples showed any positives. Northern blot assay using appropriate digoxigenin-labeled riboprobes performed as described previously (2) further confirmed RT-PCR results. Positive controls for RT-PCR and Northern blot were obtained from viroid-infected grapevines maintained in the greenhouse. GYSVd-1 and HpSVd were detected in symptomatic and symptomless plants. Hence, the symptoms observed in the vineyard cannot be attributed to viroid infection. More work is needed to identify the causal agent(s) of the decline of Thompson Seedless and Anab-e-Shadi cultivars. References: (1) C. R. Adkar-Purushothama et al. Plant Dis. 97:149, 2013. (2) D. Jiang et al. Virus Res, 169:237, 2012. (3) Y. Kawaguchi-Ito et al. PLoS One 4:e8386, 2009. (4) L. I. Ward et al. Plant Dis. 95:617, 2011.

Download Full-text