scholarly journals First Report of Grapevine yellow speckle viroid 1 and Hop stunt viroid in Grapevine (Vitis vinifera) in New Zealand

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 617-617 ◽  
Author(s):  
L. I. Ward ◽  
G. M. Burnip ◽  
L. W. Liefting ◽  
S. J. Harper ◽  
G. R. G. Clover
Keyword(s):  
United States ◽  
New Zealand ◽  
Vitis Vinifera ◽  
Complete Genome ◽  
Consensus Sequence ◽  
The United States ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Blastn Analysis

In February 2009, grapevines (Vitis vinifera) in a commercial vineyard in Auckland were showing shortened, spindly canes with tiny leaves. Approximately 10% of the vines were affected. An RNeasy Plant Mini Kit (Qiagen, Valencia, CA) was used to isolate total RNA from leaves collected from six symptomatic (cvs. BAC0022A and Syrah) and eight symptomless vines (cvs. BAC0022A, Syrah, and Chardonnay). RNA was tested by reverse transcription-PCR for the presence of Australian grapevine viroid, Citrus exocortis viroid, Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2, and Hop stunt viroid (HSVd). Four of the six symptomatic and all the symptomless vines tested positive for GYSVd-1 using primers 5′-TGTGGTTCCTGTGGTTTCAC-3′ and 5′-ACCACAAGCAAGAAGATCCG-3′, which amplify the complete genome (368 bp), and published primers PBCVd100C/194H (3), which amplify a 220-bp region of the genome. Amplicons from each PCR were transformed into a pCR 4-TOPO vector (Invitrogen, Carlsbad, CA), cloned, and sequenced. Sequence from both PCRs aligned identically to generate a consensus sequence (GenBank Accession No. HQ447056), which showed 99% nt identity to GYSVd-1 (GenBank No. X87906) by BLASTN analysis. All symptomatic and symptomless vines also tested positive for HSVd using primers C/H-HSVd (4) and HSVd-C60/H79 (1), which amplify the complete genome (298 bp). Amplicons from each isolate were cloned and sequenced. Sequence from both PCRs were aligned. Clones from all isolates, with the exception of one, aligned identically to create a consensus sequence (GenBank No. HQ447057) that showed 99% nt identity to Chinese HSVd isolates from grapevine (GenBank Nos. DQ371436–59) by BLASTN analysis. Sequence from the remaining isolate (GenBank No. HQ447056) was identical to a German Riesling grape isolate of HSVd (GenBank No. X06873). The presence of each viroid was further confirmed in PCR-positive plants by dot-blot hybridization with digoxigenin-labeled synthetic ssRNA probes specific to the full-length genomes of GYSVd-1 and HSVd (S. Harper and L. Ward, unpublished data). To our knowledge, this is the first report of GYSVd-1 and HSVd in V. vinifera in New Zealand. Since both viroids were detected in symptomatic and symptomless plants, the symptoms observed in the vineyard cannot be attributed to viroid infection. Symptoms described for GYSVd-1 include leaf spots and flecks, but no disease symptoms have been reported in grapes as a result of HSVd (2). Viruses found in the vines include Grapevine leaf roll virus-3, Grapevine viruses A and B, and Rupestris stem pitting associated virus, but these are not thought to be the cause of the symptoms. Two sequence types of HSVd were found, suggesting at least two separate introductions of HSVd into the vineyard. The vineyard is more than 40 years old so both viroids may have been present for some years. Export of wine from New Zealand was worth 1 billion dollars in 2009, so there is potential for these viroids to have an economic impact if symptoms are expressed. HSVd has been reported from China, Europe, Japan, Middle East, Pakistan, and the United States. GYSVd-1 has been reported from Australia, China, East Mediterranean, Europe, Japan, and the United States. References: (1) A. Hadidi et al. Acta Hortic. 309:339, 1992. (2) A. Hadidi et al., eds. Viroids. CSIRO Publishing, Collingwood, Australia, 2003. (3) R. Nakaune and M. Nakano. J. Virol. Methods 134:244, 2006. (4) A. M. Shamoul et al. J. Virol. Methods 105:115, 2002.

scholarly journals First Report of Apple Hammerhead Viroid in the United States, Japan, Italy, Spain, and New Zealand

Plant Disease ◽  
2018 ◽  
Vol 102 (12) ◽  
pp. 2670-2670 ◽  
Author(s):  
S. A. Szostek ◽  
A. A. Wright ◽  
S. J. Harper
Keyword(s):  
United States ◽  
New Zealand ◽  
The United States ◽  
First Report

scholarly journals Complete Genome Sequences of Grapevine Yellow Speckle Viroid 1 and Hop Stunt Viroid Assembled from the Transcriptome of Ixeridium dentatum Plants

2015 ◽  
Vol 3 (5) ◽  
Author(s):  
Joong-Hwan Lee ◽  
Seungmo Lim ◽  
Seung-Won Lee ◽  
Ran Hee Yoo ◽  
Davaajargal Igori ◽  
...  
Keyword(s):  
Complete Genome ◽  
Transcriptome Data ◽  
Genome Sequences ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
The Family

Here, we report complete genome sequences of grapevine yellow speckle viroid 1 (GYSVd1) and hop stunt viroid (HSVd), members of the family Pospiviroidae , assembled from the transcriptome data generated from Ixeridium dentatum plants. To our knowledge, this is the first report of GYSVd1 and HSVd in I. dentatum .

scholarly journals First report of grapevine rupestris vein feathering virus in grapevines from Washington State

Plant Disease ◽  
2020 ◽  
Author(s):  
Nomatter Chingandu ◽  
Sridhar Jarugula ◽  
Jati Adiputra ◽  
Basavaraj Bagewadi ◽  
Raphael Olayemi Adegbola ◽  
...  
Keyword(s):  
New Zealand ◽  
De Novo ◽  
Salt Lake ◽  
Salt Lake City ◽  
Washington State ◽  
Australian Isolate ◽  
Total Rna ◽  
First Report ◽  
Hop Stunt Viroid ◽  
Blastn Analysis

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5’- TACAAGGTGAATTGCTCCACAC -3’) and SaR-1027 (5’-TCATTGGCGATGCGTTCG-3’) to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

scholarly journals First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
J. D. Postman ◽  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North America ◽  
Consensus Sequence ◽  
The United States ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Cdna Clones ◽  
Meristem Culture ◽  
Rt Pcr ◽  
First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

scholarly journals First Report of Colletotrichum phormii Causing Anthracnose on New Zealand Flax in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1115-1115 ◽  
Author(s):  
M. Serdani ◽  
S. Rooney-Latham ◽  
K. M. Wallis ◽  
C. L. Blomquist
Keyword(s):  
United States ◽  
New Zealand ◽  
Sequence Similarity ◽  
Disease Incidence ◽  
Its Region ◽  
The United States ◽  
Production Costs ◽  
Santa Cruz ◽  
California Department ◽  
First Report

Phormium colensoi Hook.f. (syn. P. cookianum), New Zealand flax, (family Xanthorrhoeaceae) is popular in ornamental landscapes in the United States because of its sturdy blade-like foliage available in diverse colors. In February 2012, the Oregon State University Plant Clinic received three potted plants of P. colensoi ‘Black Adder’ from a commercial nursery in Santa Cruz County, California. The margins and midribs of several leaves had brown lesions that were variable in size, and fusiform to ellipsoidal in shape. Embedded in the lesions were black acervuli without setae that exuded salmon-colored spore masses under moist conditions. Conidia were hyaline, cylindrical to fusiform, straight to slightly curved, and 22.4 to 35.2 × 4.0 to 6.4 (average 24.7 × 4.9) μm. Based on morphology, the fungus was confirmed by USDA-APHIS National Identification Services to be Colletotrichum phormii (Henn.) D.F. Farr & Rossman (2). In March 2012, the California Department of Food and Agriculture Plant Pest Diagnostic Lab received additional samples from the same nursery lot (25% disease incidence) from which a similar fungus was recovered. rDNA sequences of the internal transcribed spacer (ITS) region from the California isolate (GenBank KC122681), amplified using primers ITS1 and ITS4 (2), were 100% identical to multiple species of Colletotrichum, including C. phormii by a BLAST query (JQ948446 through JQ948453). ITS sequence similarity alone is not sufficient to address Colletotrichum taxonomy and must be used in combination with host range and morphology (1). Pathogenicity of C. phormii (isolate CDFA986) was tested on three ‘Black Adder’ plants, which were inoculated with 6-mm agar plugs from a 14-day-old culture grown on half strength potato dextrose agar (PDA). Leaves were wound-inoculated along the midrib using colonized plugs (4). Five leaves per plant were inoculated with C. phormii plugs and five leaves per plant were treated with uncolonized PDA agar plugs as controls. Plants were sprayed with water and incubated in plastic bags at 22°C with a 12-h photoperiod. After 48 h, the bags and caps were removed and plants were kept under the same conditions. Two weeks later, water-soaked lesions had developed on the inoculated leaves. Lesions expanded along the midrib and became fusiform in shape after 21 to 28 days. C. phormii was isolated from lesion margins of all the inoculated leaves, but not from control leaves. This experiment was repeated once with similar results. Another Colletotrichum species, C. gloeosporiodes, also occurs on Phormium spp., but differs from C. phormii in morphology and symptom expression. Subsequent nursery and landscape surveys showed that anthracnose caused by C. phormii occurs on several P. colensoi cultivars as well as on P. tenax in five California counties including Santa Cruz, Yolo, Sacramento, San Luis Obispo, and Solano. C. phormii is also reported to infect P. colensoi and P. tenax in New Zealand, Europe, the United Kingdom, Australia, and South Africa (2,3). To our knowledge, this is the first report of C. phormii causing anthracnose on Phormium in North America. This disease could impact the American nursery trade and New Zealand flax production due to crop loss and increased production costs for pest management. References: (1) J. Crouch et al. Mycologia 101:648, 2009. (2) D. F. Farr et al. Mycol. Res. 110:1395, 2006. (3). H. Golzar and C. Wang. Australas. Plant Pathol. 5:110, 2010. (4) L. E. Yakabe et al. Plant Dis. 93:883, 2009.

scholarly journals First Report of the Detection of ‘Candidatus Liberibacter’ Species in Zebra Chip Disease-Infected Potato Plants in the United States

Plant Disease ◽  
2009 ◽  
Vol 93 (1) ◽  
pp. 108-108 ◽  
Author(s):  
J. A. Abad ◽  
M. Bandla ◽  
R. D. French-Monar ◽  
L. W. Liefting ◽  
G. R. G. Clover
Keyword(s):  
United States ◽  
New Species ◽  
New Zealand ◽  
16S Rdna ◽  
The United States ◽  
Economic Losses ◽  
Zebra Chip ◽  
First Report ◽  
Potato Plants ◽  
A New Species

Zebra chip (ZC), an emerging disease causing economic losses to the potato chip industry, has been reported since the early 1990s in Central America and Mexico and in Texas during 2000 (4). ZC was subsequently found in Nebraska, Colorado, New Mexico, Arizona, Nevada, California, and Kansas (3). Severe losses to potato crops were reported in the last few years in Mexico, Guatemala, and Texas (4). Foliar symptoms include purple top, shortened internodes, small leaves, enlargement of the stems, swollen axillary buds, and aerial tubers. Chips made from infected tubers exhibit dark stripes that become markedly more visible upon frying, and hence, are unacceptable to manufacturers. Infected tubers may or may not produce plants when planted. The causal agent of ZC is not known and has been the subject of increased investigation. The pathogen is believed to be transmitted by the potato psyllid, Bactericera cockerelli, and the association of the vector with the disease is well documented (3). Following the report of a potential new liberibacter species in solanaceous crops in New Zealand, we sought to identify this liberibacter species in plants with symptoms of the ZC disease. Six potato plants (cv. Russet Norkota) exhibiting typical ZC symptoms were collected in Olton, TX in June of 2008. DNA was extracted from roots, stems, midribs, and petioles of the infected plants using a FastDNA Spin Kit and the FastPrep Instrument (Qbiogene, Inc., Carlsbad, CA). Negative controls from known healthy potato plants were included. PCR amplification was carried out with ‘Candidatus L. asiaticus’ omp primers (1), 16S rDNA primers specific for ‘Ca. L. asiaticus’, ‘Ca. L. africanus’, and ‘Ca. L. americanus’ (1), and 16S rDNA primers OA2 (GenBank Accession No. EU834130) and OI2c (2). Amplicons from 12 samples were directly sequenced in both orientations (McLab, San Francisco CA). PCR amplifications using species-specific primers for the citrus huanglongbing liberibacter were negative. However, 1.1- and 1.8-kb amplicons were obtained with the OA2/OI2C and omp primers, respectively. The sequences for the rDNA were submitted to NCBI GenBank (Accession Nos. EU884128 and EU884129). BLASTN alignment of the 16S rDNA sequences obtained with primers OA2 and OI2c revealed 99.7% identity with a new species of ‘Ca. Liberibacter’ identified in New Zealand affecting potato (GenBank Accession No. EU849020) and tomato (GenBank Accession No. EU834130), 97% identity with ‘Ca. L. asiaticus’, and 94% with ‘Ca. L. africanus’ and ‘Ca. L. americanus’. The neighbor-joining phylogenetic tree constructed using the 16S rDNA fragments delineated four clusters corresponding to each of the liberibacter species. These results confirm that ‘Ca. Liberibacter’ spp. DNA sequences were obtained from potatoes showing ZC-like symptoms, suggesting that a new species of this genus may be involved in causing ZC disease. To our knowledge, this is the first report of the detection of ‘Ca. Liberibacter’ spp. in potatoes showing ZC disease in the United States. References: (1) C. Bastianel et al. Appl. Environ. Microbiol. 71:6473, 2005. (2) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (3) J. E. Munyaneza et al. J. Econ. Entomol. 100:656, 2007. (4) G. A. Secor and V. V. Rivera-Varas. Rev. Latinoamericana de la Papa (suppl.)1:1, 2004.

scholarly journals Complete Genome Sequence of a New Strain of Sida Golden Mosaic Buckup Virus from Florida, USA

2020 ◽  
Vol 9 (2) ◽  
Author(s):  
Zafar Iqbal ◽  
Salma Arous ◽  
J. E. Polston
Keyword(s):  
United States ◽  
Genome Sequence ◽  
Complete Genome Sequence ◽  
Complete Genome ◽  
The United States ◽  
Bipartite Begomovirus ◽  
Virus Family ◽  
Content Type ◽  
First Report

The complete genome sequence of a bipartite begomovirus found in a Sida sp. plant growing in Bradenton, FL, was determined. The virus is a new strain of Sida golden mosaic Buckup virus (family Geminiviridae, genus Begomovirus). This is the first report of this virus in the United States and the first report outside Jamaica.

scholarly journals First Report of Grapevine yellow speckle viroid 1 and Hop stunt viroid Infecting Grapevines (Vitis vinifera) in Korea

Plant Disease ◽  
2017 ◽  
Vol 101 (6) ◽  
pp. 1069-1069
Author(s):  
Y. Jo ◽  
H. Choi ◽  
M. K. Song ◽  
J. S. Park ◽  
J. W. Lee ◽  
...  
Keyword(s):  
Vitis Vinifera ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid

scholarly journals First Report of Catharanthus mosaic virus in Mandevilla in the United States

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 165-165 ◽  
Author(s):  
D. Mollov ◽  
M. A. Guaragna ◽  
B. Lockhart ◽  
J. A. M. Rezende ◽  
R. Jordan
Keyword(s):  
United States ◽  
Amino Acid ◽  
Mosaic Virus ◽  
Consensus Sequence ◽  
The United States ◽  
Amino Acid Sequences ◽  
Universal Primers ◽  
Rt Pcr ◽  
First Report ◽  
Virus Particles

Mandevilla (Apocynaceae) is an ornamental tropical vine popular for its bright and attractive flowers. During 2012 to 2013, 12 Mandevilla sp. samples from Minnesota and Florida nurseries were submitted for analysis at the University of Minnesota Plant Disease Clinic. Plants showed mosaic symptoms, leaf deformation, premature leaf senescence, and vine dieback. Filamentous virus particles with modal lengths 700 to 900 nm were observed by transmission electron microscopy (TEM) in partially purified preparations from symptomatic leaves. Partially purified virions were obtained using 30% sucrose cushion centrifuged at 109,000 gmax for 2 h at 10°C (5). No other virus particles were observed in these samples, nor were any observed in non-symptomatic samples. One sample was submitted as potted plant (Mandevilla ‘Sunmandeho’ Sun Parasol Giant White) and was kept under greenhouse conditions for subsequent analyses. Total RNA (Qiagen) was extracted from this sample, and Potyvirus was detected using the universal primers Poty S (5′-GGN AAY AAY AGY GGN CAR CC-3′) and PV1 (5′-20(T)V-3′) (1) by reverse transcription (RT)-PCR (3). The amplified product was the expected ~1.7-kb, corresponding to the partial nuclear inclusion body gene, the coat protein (CP) gene, and the 3′ end untranslated region. The RT-PCR amplicon was cloned (NEB) and sequenced, and the 1,720-bp consensus sequence was deposited in GenBank (Accession No. KM243928). NCBI BLAST analysis at the nucleotide level revealed highest identity (83%) with an isolate of Catharanthus mosaic virus (CatMV) from Brazil (Accession No. DQ365928). Pairwise analysis of the predicted 256 amino acid CP revealed 91% identity with the CatMV Brazilian isolate (ABI94824) and 68% or less identity with other potyviruses. Two potyviruses are usually considered the same species if their CP amino acid sequences are greater than 80% identical (2). Serological analysis of the infected sample Mandevilla ‘Sunmandeho’ Sun Parasol Giant White using a CatMV specific antiserum (4) resulted in positive indirect ELISA reactions. CatMV has been previously reported in periwinkle (Catharanthus roseus) in Brazil (4). Based on the analyses by TEM, RT-PCR, nucleotide and amino acid sequence identities, and serological reactivity, we identify this virus as a U.S. Mandevilla isolate of CatMV. To our knowledge, this is the first report of Catharanthus mosaic virus both in the United States and in Mandevilla. References: (1) J. Chen et al. Arch Virol. 146:757, 2001. (2) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (3) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (4) S. C. Maciell et al. Sci. Agric. Piracicaba, Brazil. 68:687, 2011. (5) D. Mollov et al. Arch Virol. 158:1917, 2013.

scholarly journals First Report of Stem Rot on Cereus peruvianus monstruosus Caused by Bipolaris cactivora (Petr.) Alcorn in Italy

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 159-159 ◽  
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
P. Pensa ◽  
A. Poli ◽  
M. L. Gullino
Keyword(s):  
United States ◽  
Morphological Characteristics ◽  
Its Region ◽  
The United States ◽  
Stem Rot ◽  
Pathogenicity Test ◽  
First Report ◽  
Plastic Bags ◽  
Blastn Analysis ◽  
Dark Green

Cereus peruvianus monstruosus, known as “monster cactus,” family Cactaceae, is grown as a potted plant. In the winter of 2013, a stem rot was observed on a farm located near Ventimiglia (northern Italy) on 80% of 4,000 9-month-old plants grown in trays in a peat substrate. Symptoms consisted of a rapid rot of the upper portion of the stem. Affected stems at first showed yellowish spots that became brown irregular necrotic lesions with well-defined margins. The tissues below the affected areas were blackened and dry but became soft in the presence of high relative humidity. Fungal sporulation on rotted tissues consisted of caespitose, non-branched, septate conidiophores, olivaceous to brown at the base, paler above, measuring 89.0 to 196.9 × 6.2 to 8.7 (average 124.8 × 7.0) μm. Single conidia were borne on terminal cells. At maturity, conidia with 2 to 5 (average 3) septa were brownish-olivaceous, varying in shape from obclavate, fusiform, ellipsoid or sometimes furcate, and measuring 23.4 to 48.6 × 8.0 to 12.6 (average 38.8 × 10.3) μm. Symptomatic tissues were immersed in 1% sodium hypochlorite for 2 to 3 s and rinsed in sterile distilled water, then fragments excised from the margin of internal lesions were cultured on potato dextrose agar (PDA) medium amended with 25 mg/l of streptomycin sulfate and incubated at 20 to 23°C under alternating daylight and darkness (10 h light, 14 h dark). A fungus that was consistently isolated was subcultured on PDA. At maturity, dark green floccose colonies comprised of light brown septate hyphae, 4.2 to 8.1 (average 5.6) μm in width, produced non-branched, pale to dark brown, septate conidiophores, measuring 99.6 to 176.1 × 4.5 to 6.5 (average 146.7 × 5.4) μm. The conidia produced on PDA were similar to those observed on infected tissues and measured 20.6 to 40.7 × 7.5 to 11.4 (average 32.0 × 9.7) μm, with 1 to 3 septa (average 2). On the basis of the morphological characteristics, the fungus was identified as Bipolaris cactivora (Petr.) Alcorn [Syn.: Drechslera cactivora (Petr.) M. B. Ellis] (4). The internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA) was amplified for one isolate using ITS1/ITS4 primers and sequenced (GenBank Accession No. KF041822). BLASTn analysis (1) of the 557-bp segment showed a 99% similarity with the ITS sequence of Bipolaris cactivora HM598679. For pathogenicity tests, 8 mm diameter mycelial disks removed from 15-day-old PDA cultures of the fungus were placed at the wounded stem apexes of three 7-month-old healthy plants (three disks per plant). Three plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 23 ± 1°C with 12 h light/dark. By 8 days after inoculation, all the inoculated stems were rotted and 10 colonies of B. cactivora were re-isolated from infected tissues. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Several hosts are listed for B. cactivora including C. peruvianus, and the pathogen has been reported in the United States (2) and in South Korea (3). To our knowledge, this is the first report of B. cactivora on C. peruvianus monstruosus in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. APS Press, St Paul, MN, 1989. (3) I. H. Hyun et al. Res. Plant Dis. 7:56, 2001. (4) A. Sivanesan. Mycopathologia 111:125, 1990.

Sign in / Sign up

Export Citation Format

Share Document