First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using ‘root dip inoculation’ and ‘soil inoculation’ technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing root rot on chickpea in Mexico

Plant Disease ◽

10.1094/pdis-05-21-1123-pdn ◽

2021 ◽

Author(s):

Sixto Velarde Felix ◽

Victor Valenzuela ◽

Pedro Ortega ◽

Gustavo Fierros ◽

Pedro Rojas ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Species Complex ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Chickpea (Cicer aretinium L.) is a legume crop of great importance worldwide. In January 2019, wilting symptoms on chickpea (stunted grow, withered leaves, root rot and wilted plants) were observed in three fields of Culiacan Sinaloa Mexico, with an incidence of 3 to 5%. To identify the cause, eighty symptomatic chickpea plants were sampled. Tissue from roots was plated on potato dextrose agar (PDA) medium. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Ff01 to Ff10). On PDA the colonies were abundant with white aerial mycelium, hyphae were branched and septae and light purple pigmentation was observed in the center of old cultures (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidias were falciform, hyaline, with slightly curved apexes, three to five septate, with well-developed foot cells and blunt apical cells, and measured 26.6 to 45.8 × 2.2 to 7.0 μm (n = 40). The microconidia (n = 40) were hyaline, one to two celled, produced in false heads that measured 7.4 to 20.1 (average 13.7) μm × 2.4 to 8.9 (average 5.3) μm (n = 40) at the tips of long monophialides, and were oval or reniform, with apexes rounded, 8.3 to 12.1 × 1.6 to 4.7 μm; chlamydospores were not evident. These characteristics fit those of the Fusarium solani (Mart.) Sacc. species complex, FSSC (Summerell et al. 2003). The internal transcribed spacer and the translation elongation factor 1 alpha (EF1-α) genes (O’Donnell et al. 1998) were amplified by polymerase chain reaction and sequenced from the isolate Ff02 and Ff08 (GenBank accession nos. KJ501093 and MN082369). Maximum likelihood analysis was carried out using the EF1-α sequences (KJ501093 and MN082369) from the Ff02 and Ff08 isolates and other species from the Fusarium solani species complex (FSSC). Phylogenetic analysis revealed the isolate most closely related with F. falciforme (100% bootstrap). For pathogenicity testing, a conidial suspension (1x106 conidia/ml) was prepared by harvesting spores from 10-days-old cultures on PDA. Twenty 2-week-old chickpea seedlings from two cultivars (P-2245 and WR-315) were inoculated by dipping roots into the conidial suspension for 20 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80% and a 12-h/12-h light/dark cycle. After 8 days, the first root rot symptoms were observed on inoculating seedlings and the infected plants eventually died within 3 to 4 weeks after inoculation. No symptoms were observed plants inoculated with sterilized distilled water. The fungus was reisolated from symptomatic tissues of inoculated plants and was identified by sequencing the partial EF1-α gene again and was identified as F. falciforme (FSSC 3 + 4) (O’Donnell et al. 2008) based on its morphological characteristics, genetic analysis, and pathogenicity test, fulfilling Koch’s postulates. The molecular identification was confirmed via BLAST on the FusariumID and Fusarium MLST databases. Although FSSC has been previously reported causing root rot in chickpea in USA, Chile, Spain, Cuba, Iran, Poland, Israel, Pakistan and Brazil, to our knowledge this is the first report of root rot in chickpea caused by F. falciforme in Mexico. This is important for chickpea producers and chickpea breeding programs.

Download Full-text

First Report of Ramularia coleosporii causing Leaf Spot on Perilla frutescens in Korea

Plant Disease ◽

10.1094/pdis-01-21-0223-pdn ◽

2021 ◽

Author(s):

Md Aktaruzzaman ◽

Tania Afroz ◽

Hyo-Won Choi ◽

Byung Sup Kim

Keyword(s):

Leaf Spot ◽

Ipomoea Batatas ◽

Rust Fungus ◽

Morphological Characteristics ◽

Perilla Frutescens ◽

Herbaceous Plant ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Perilla (Perilla frutescens var. japonica), a member of the family Labiatae, is an annual herbaceous plant native to Asia. Its fresh leaves are directly consumed and its seeds are used for cooking oil. In July 2018, leaf spots symptoms were observed in an experimental field at Gangneung-Wonju National University, Gangneung, Gangwon province, Korea. Approximately 30% of the perilla plants growing in an area of about 0.1 ha were affected. Small, circular to oval, necrotic spots with yellow borders were scattered across upper leaves. Masses of white spores were observed on the leaf underside. Ten small pieces of tissue were removed from the lesion margins of the lesions, surface disinfected with NaOCl (1% v/v) for 30 s, and then rinsed three times with distilled water for 60 s. The tissue pieces were then placed on potato dextrose agar (PDA) and incubated at 25°C for 7 days. Five single spore isolates were obtained and cultured on PDA. The fungus was slow-growing and produced 30-50 mm diameter, whitish colonies on PDA when incubated at 25ºC for 15 days. Conidia (n= 50) ranged from 5.5 to 21.3 × 3.5 to 5.8 μm, were catenate, in simple or branched chains, ellipsoid-ovoid, fusiform, and old conidia sometimes had 1 to 3 conspicuous hila. Conidiophores (n= 10) were 21.3 to 125.8 × 1.3 to 3.6 μm in size, unbranched, straight or flexuous, and hyaline. The morphological characteristics of five isolates were similar. Morphological characteristics were consistent with those described for Ramularia coleosporii (Braun, 1998). Two representative isolates (PLS 001 & PLS003) were deposited in the Korean Agricultural Culture Collection (KACC48670 & KACC 48671). For molecular identification, a multi-locus sequence analysis was conducted. The internal transcribed spacer (ITS) regions of the rDNA, partial actin (ACT) gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified using primer sets ITS1/4, ACT-512F/ACT-783R and gpd1/gpd2, respectively (Videira et al. 2016). Sequences obtained from each of the three loci for isolate PLS001 and PLS003 were deposited in GenBank with accession numbers MH974744, MW470869 (ITS); MW470867, MW470870 (ACT); and MW470868, MW470871 (GAPDH), respectively. Sequences for all three genes exhibited 100% identity with R. coleosporii, GenBank accession nos. GU214692 (ITS), KX287643 (ACT), and 288200 (GAPDH) for both isolates. A multi-locus phylogenetic tree, constructed by the neighbor-joining method with closely related reference sequences downloaded from the GenBank database and these two isolates demonstrated alignment with R. coleosporii. To confirm pathogenicity, 150 mL of a conidial suspension (2 × 105 spores per mL) was sprayed on five, 45 days old perilla plants. An additional five plants, to serve as controls, were sprayed with sterile water. All plants were placed in a humidity chamber (>90% relative humidity) at 25°C for 48 h after inoculation and then placed in a greenhouse at 22/28°C (night/day). After 15 days leaf spot symptoms, similar to the original symptoms, developed on the leaves of the inoculated plants, whereas the control plants remained symptomless. The pathogenicity test was repeated twice with similar results. A fungus was re-isolated from the leaf lesions on the inoculated plants which exhibited the same morphological characteristics as the original isolates, fulfilling Koch’s postulates. R. coleosporii has been reported as a hyperparasite on the rust fungus Coleosporium plumeriae in India & Thailand and also as a pathogen infecting leaves of Campanula rapunculoides in Armenia, Clematis gouriana in Taiwan, Ipomoea batatas in Puerto Rico, and Perilla frutescens var. acuta in China (Baiswar et al. 2015; Farr and Rossman 2021). To the best of our knowledge, this is the first report of R. coleosporii causing leaf spot on P. frutescens var. japonica in Korea. This disease poses a threat to production and management strategies to minimize leaf spot should be developed.

Download Full-text

First Report of Colletotrichum boninense Causing Anthracnose on Pepper in China

Plant Disease ◽

10.1094/pdis-04-12-0403-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 138-138 ◽

Cited By ~ 7

Author(s):

Y. Z. Diao ◽

J. R. Fan ◽

Z. W. Wang ◽

X. L. Liu

Keyword(s):

Internal Transcribed Spacer ◽

Severe Disease ◽

Causal Agent ◽

Its Sequences ◽

Universal Primers ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Species Specific

Anthracnose, caused by Colletotrichum spp., is a severe disease and results in large losses in pepper (Capsicum frutescens) production in China (4). Colletotrichum boninense is one of the Colletotrichum species in pepper in China. In August 2011, anthracnose symptoms (circular, sunken lesions with orange to black spore masses) were observed on pepper fruits in De-Yang, Sichuan Province, China. Three single-spore isolates (SC-6-1, SC-6-2, SC-6-3) were obtained from the infected fruits. A 5-mm diameter plug was transferred to potato dextrose agar (PDA); the isolates formed colonies with white margins and circular, dull orange centers. The conidia were cylindrical, obtuse at both ends, and 10.5 to 12.6 × 4.1 to 5.0 μm. The colonies grew rapidly at 25 to 28°C, and the average colony diameter was 51 to 52 mm after 5 days on PDA at 25°C. Based upon these characters, the causal agent was identified as C. boninense. To confirm the identity of the isolates, the internal transcribed spacer (ITS) regions were amplified with the ITS1/ITS4 universal primers (1). The internal transcribed spacer (ITS) sequences (Accession No. JQ926743) of the causal fungus shared 99 to 100% homology with ITS sequences of C. boninense in GenBank (Accession Nos. FN566865 and EU822801). The identity of the causal agent as C. boninense was also confirmed by species-specific primers (Col1/ITS4) (2). In a pathogenicity test, five detached ripe pepper fruits were inoculated with 1 μl of a conidial suspension (106 conidia/mL) or five fruits with 1 μl of sterile water were kept as control. After 7 days in a moist chamber at 25°C, typical anthracnose symptoms had developed on the five inoculated fruits but not on control fruits. C. boninense was reisolated from the lesions, and which was confirmed by morphology and molecular methods as before. There have reports of C. boninense infecting many species of plants, including pepper (3). To our knowledge, this is the first report of C. boninense causing anthracnose on pepper in China. References: (1) A. K. Lucia et al. Phytopathology 93:581, 2002. (2) S. A. Pileggi et al. Can. J. Microbiol. 55:1081, 2009. (3) H. J. Tozze et al. Plant Dis. 93:106, 2009. (4) M. L. Zhang. J. Anhui Agri. Sci. 2:21, 2000.

Download Full-text

First Report of Passalora Leaf Spot Caused by Passalora bougainvilleae on Bougainvillea in Mexico

Plant Disease ◽

10.1094/pdis-11-10-0787 ◽

2011 ◽

Vol 95 (6) ◽

pp. 775-775 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

V. Santiago-Santiago ◽

A. Madariaga-Navarrete ◽

A. Castañeda-Vildozola ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Disease Incidence ◽

Morphological Characteristics ◽

The United States ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Bougainvillea Spectabilis

Bougainvillea (Bougainvillea spectabilis Willd) growing in 28 gardens during 2009 showed 100% disease incidence and 3 to 7% disease severity. Bougainvilleas with white flowers were the most affected. Symptoms consisted of light brown spots with dark brown margins visible on adaxial and abaxial sides of the leaves. Spots were circular, 2 to 7 mm in diameter, often surrounded by a chlorotic halo, and delimited by major leaf veins. Single-spore cultures were incubated at 24°C under near UV light for 7 days to obtain conidia. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 spores/ml) on leaves of potted bougainvillea plants (white, red, yellow, and purple flowers), incubating the plants in a dew chamber for 48 h and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed at the residential gardens appeared on inoculated plants after 45 to 60 days. The fungus was reisolated from inoculated plants that showed typical symptoms. No symptoms developed on control plants treated with sterile distilled water. The fungus produced distinct stromata that were dark brown, spherical to irregular, and 20 to 24 μm in diameter. Conidiophores were simple, born from the stromata, loose to dense fascicles, brown, straight to curved, not branched, zero to two septate, 14 × 2 μm, with two to four conspicuous and darkened scars. The conidia formed singly, were brown, broad, ellipsoid, obclavate, straight to curved with three to four septa, 40 × 4 μm, and finely verrucous with thick hilum at the end. Fungal DNA from the single-spore cultures was obtained using a commercial DNA Extraction Kit (Qiagen, Valencia, CA); ribosomal DNA was amplified with ITS5 and ITS4 primers and sequenced. The sequence was deposited at the National Center for Biotechnology Information Database (GenBank Accession Nos. HQ231216 and HQ231217). The symptoms (4), morphological characteristics (1,2,4), and pathogenicity test confirm the identity of the fungus as Passalora bougainvilleae (Muntañola) Castañeda & Braun (= Cercosporidium bougainvilleae Muntañola). This pathogen has been reported from Argentina, Brazil, Brunei, China, Cuba, El Salvador, India, Indonesia, Jamaica, Japan, Thailand, the United States, and Venezuela (3). To our knowledge, this is the first report of this disease on B. spectabilis Willd in Mexico. P. bougainvilleae may become an important disease of bougainvillea plants in tropical and subtropical areas of Mexico. References: (1) U. Braun and R. R. Castañeda. Cryptogam. Bot. 2/3:289, 1991. (2) M. B. Ellis. More Dematiaceous Hypomycetes. Commonwealth Mycological Institute, Kew, Surrey, UK, 1976. (3) C. Nakashima et al. Fungal Divers. 26:257, 2007. (4) K. L. Nechet and B. A. Halfeld-Vieira. Acta Amazonica 38:585, 2008.

Download Full-text

First Report of Cercospora Leaf Spot Caused by Cercospora apii (= C. molucellae) on Bells-of-Ireland (Molucella laevis) in Mexico

Plant Disease ◽

10.1094/pdis-93-2-0197a ◽

2009 ◽

Vol 93 (2) ◽

pp. 197-197 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

U. Braun ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Cercospora Leaf Spot ◽

Single Spore ◽

First Report ◽

Cornell University ◽

Specific Fragment ◽

Species Specific

In late 2007, a new disease was found in commercial cutflower fields of bells-of-Ireland (Molucella laevis L.) in Texcoco, Mexico. Four plantings surveyed during this time had 100% incidence. A few spots on cutflowers make them unmarketable. Symptoms consisted of gray-green spots on leaves, calyxes, and stems, which turned brown with age. Spots were initially circular to oval, delimited by major leaf veins, and were visible on both adaxial and abaxial sides of the leaves. A Cercospora species was consistently associated with the spots. The fungus was isolated on V8 agar medium. Three single-spore cultures were obtained from isolation cultures. Cultures were incubated at 24°C under near-UV light for 7 days. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 condia/ml) on leaves of 16 potted M. laevis plants, incubating the plants in a dew chamber for 48 h, and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed in the field appeared on all inoculated plants after 2 weeks. No symptoms developed on control plants treated with autoclaved distilled water. The pathogenicity test was repeated twice with similar results. The fungus produced erumpent stromata, which were dark brown, spherical to irregular, 10 to 26 μm diameter, and giving rise to fascicles of five to nine divergent conidiophores, which were clear brown, paler near the subtruncate apex, straight to curved, not branched, rarely geniculate with two to four septa, and 57 × 3.4 μm. The conidia were formed singly, hyaline, acicular, base truncate, tip acute, straight to curved with 11 to 19 septa, and 172 × 3.5 μm. Fungal DNA from single-spore cultures was obtained with a commercial extraction kit (Qiagen, Hilden, Germany), amplified with ITS5 and ITS4 primers, and sequenced. The sequence, deposited at the National Center for Biotechnology Information Database (GenBank Accession No. EU564808), aligned almost perfectly (99% identity) to the bells-of-Ireland isolates from California (GenBank Accession Nos. AY156918 and AY156919) and New Zealand (Accession No. DQ233321). A 176-bp species-specific fragment was amplified with CercoCal-apii primers but not with CercoCal-beta or CercoCal-sp primers. These results, coupled with the morphological characteristics (1) and pathogenicity test, confirm the identity of the fungus as Cercospora apii sensu lato (including C. molucellae) (2,3,4). Although C. apii sensu lato has been reported on other hosts in Mexico (1,2), to our knowledge, this is the first report of this disease on M. laevis plants in this country. References: (1) C. Chupp. A Monograph of the Fungus Cercospora. Cornell University Press, Ithaca, NY, 1954. (2) P. W. Crous and U. Braun. CBS Biodiversity Series 1:1, 2003. (3) M. Groenewald et al. Phytopathology 95:951, 2005. (4) S. T Koike et al. Plant Dis. 87:203, 2003.

Download Full-text

First Report of Basal Stem Rot of Apple Cactus (Cereus peruvianus monstruosus) Caused by Fusarium oxysporum in Italy

Plant Disease ◽

10.1094/pdis-03-11-0216 ◽

2011 ◽

Vol 95 (7) ◽

pp. 877-877

Author(s):

A. Garibaldi ◽

P. Pensa ◽

D. Bertetti ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

United States ◽

Fusarium Oxysporum ◽

The United States ◽

Stem Rot ◽

Fluorescent Light ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

Basal Stem Rot ◽

First Report

During the summer of 2010, 20% of 7,000 4-month-old plants of apple cactus (Cereus peruvianus monstruosus) showed symptoms of a basal stem rot in a commercial nursery located in Liguria (northern Italy). Affected plants showed yellow orange-to-pale brown color from the crown level to the stem apex and a water-soaked rot was observed on the stem starting from the base. Brown discoloration was observed in the vascular system. Eventually stems bent, plants collapsed and died, and affected tissues dried out. A Fusarium sp. was consistently and readily isolated from symptomatic tissue on Komada selective medium. Isolates were purified and subcultured on potato dextrose agar (PDA). Single-spore cultures on PDA, Spezieller Nährstoffarmer agar (SNA) (3), and carnation leaf-piece agar (CLA) (2) were incubated at 26 ± 1°C (12-h fluorescent light, 12-h dark). On PDA, cultures produced a thick growth of white-to-pink mycelium and pale pink pigments in the agar. On SNA, cultures produced short monophialides with unicellular, ovoid-elliptical microconidia measuring 4.3 to 8.2 × 2.3 to 3.8 (average 6.0 × 2.8) μm. Chlamydospores were abundant, single or paired, terminal and intercalary, rough walled, and 6 to 8 μm in diameter. On CLA, cultures produced orange sporodochia with macroconidia that were 3 to 4 septate, nearly straight with a foot-shaped basal cell and a short apical cell, and measured 31.1 to 51.5 × 4.4 to 3.5 (average 43.2 × 3.8) μm. Such characteristics are typical of Fusarium oxysporum (3). Amplification of the ITS (internal transcribed spacer) of the rDNA using primers ITS1/ITS4 (4) yielded a 498-bp band. Sequencing and BLASTn analysis of this band showed an E-value of 0.0 with F. oxysporum. The nucleotide sequence has been assigned GenBank Accession No. JF422071. To confirm pathogenicity, five 6-month-old healthy plants of C. peruvianus monstruosus were inoculated by dipping roots in a conidial suspension (2.4 × 106 CFU/ml) of F. oxysporum isolated from affected plants. Inoculum was obtained from pure cultures of three single-spore isolates grown for 10 days on casein hydrolysate liquid medium. Roots were not wounded before the inoculation. Plants were transplanted into pots filled with steam-sterilized substrate (sphagnum peat/perlite/pine bark/clay 50:20:20:10). Five noninoculated plants served as a control. Plants were placed in a climatic chamber at 25 ± 1°C (12-h fluorescent light, 12 h-dark). Basal stem rot and vascular discoloration in the crown and stem developed within 30 days on each inoculated plant. Noninoculated plants remained healthy. F. oxysporum was consistently isolated from symptomatic plants. The pathogenicity test was conducted twice. F. oxysporum has been reported on Cereus spp. in the United States (1). To our knowledge, this is the first report of F. oxysporum on C. peruvianus monstruosus in Italy as well as in Europe. Currently, this disease is present in a few nurseries in Liguria. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (2) N. L. Fisher et al. Phytopathology 72:151, 1982. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell, Ames, IA, 2006. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

Download Full-text

First Report of Corynespora Leaf Spot of Eucalyptus in China

Plant Disease ◽

10.1094/pdis-07-14-0697-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 419-419 ◽

Cited By ~ 1

Author(s):

C. K. Phan ◽

J. G. Wei ◽

F. Liu ◽

B. S. Chen ◽

J. T. Luo ◽

...

Keyword(s):

Leaf Spot ◽

Southern China ◽

Tap Water ◽

Pathogenic Fungi ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Eucalyptus is widely planted in the tropics and subtropics, and it has become an important cash crop in Southern China because of its fast-growing nature. In the Guangxi Province of southern China, Eucalyptus is produced on approximately 2 million ha, and two dominant asexual clones, Guanglin No. 9 (E. grandis × E. urophylla) and DH3229 (E. urophylla × E. grandis), are grown. Diseases are an increasing threat to Eucalyptus production in Guangxi since vast areas are monocultured with this plant. In June 2013, a leaf spot disease was observed in eight out of 14 regions in the province on a total of approximately 0.08 million ha of Eucalyptus. Initially, the lesions appeared as water-soaked dots on leaves, which then became circular or irregular shaped with central gray-brown necrotic lesions and dark red-brown margins. The size of leaf spots ranged between 1 and 3 mm in diameter. The main vein or small veins adjacent to the spots were dark. The lesions expanded rapidly during rainy days, producing reproductive structures. In severe cases, the spots coalesced and formed large irregular necrotic areas followed by defoliation. The causal fungus was isolated from diseased leaves. Briefly, the affected leaves were washed with running tap water, sterilized with 75% ethanol (30 s) and 0.1% mercuric dichloride (3 min), and then rinsed three times with sterilized water. Small segments (0.5 to 0.6 cm2) were cut from the leading edge of the lesions and plated on PDA. The plates were incubated at 25°C for 7 to 10 days. When mycelial growth and spores were observed, a single-spore culture was placed on PDA and grown in the dark at 25°C for 10 days. A pathogenicity test was done by spraying a conidial suspension (5 × 105 conidia ml–1) of isolated fungus onto 30 3-month-old leaves of Guanglin No. 9 seedlings. The plants were covered with plain plastic sheets for 7 days to keep the humidity high. Lesions similar to those observed in the forests were observed on the inoculated leaves 7 to 10 days after incubation. The same fungus was re-isolated. Leaves of control plants (sprayed with sterilized water) were disease free. Conidiophores of the fungus were straight to slightly curved, erect, unbranched, septate, and pale to light brown. Conidia were formed in chains or singly with 4 to 15 pseudosepta, which were oblong oval to cylindrical, subhyaline to pale olivaceous brown, straight to curved, 14.5 to 92.3 μm long, and 3.5 to 7.1 μm wide. The fungus was morphologically identified as Corynespora cassiicola (1). DNA of the isolate was extracted, and the internal transcribed spacer (ITS) region (which included ITS 1, 5.8S rDNA gene of rDNA, and ITS 2) was amplified with primers ITS5 and ITS4. 529 base pair (bp) of PCR product was obtained and sequenced. The sequence was compared by BLAST search to the GenBank database and showed 99% similarity to C. cassiicola (Accession No. JX087447). Our sequence was deposited into GenBank (KF669890). The biological characters of the fungus were tested. Its minimum and maximum growth temperatures on PDA were 7 and 37°C with an optimum range of 25 to 30°C. At 25°C in 100% humidity, 90% of conidia germinated after 20 h. The optimum pH for germination was 5 to 8, and the lethal temperature of conidia was 55°C. C. cassiicola has been reported causing leaf blight on Eucalyptus in India and Brazil (2,3) and causing leaf spot on Akebia trifoliate in Guangxi (4). This is the first report of this disease on Eucalyptus in China. References: (1) M. B. Ellis and P. Holliday. CMI Descriptions of Pathogenic Fungi and Bacteria, No. 303. Commonwealth Mycological Institute, Kew, Surrey, UK, 1971. (2) B. P. Reis, et al. New Dis. Rep. 29:7, 2014. (3) K. I. Wilson and L. R. Devi. Ind. Phytopathol. 19:393, 1966. (4) Y. F. Ye et al. Plant Dis. 97:1659, 2013.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing wilt disease of Phaseolus vulgaris in Mexico

Plant Disease ◽

10.1094/pdis-06-20-1160-pdn ◽

2020 ◽

Author(s):

José Francisco Díaz-Nájera ◽

Sergio Ayvar-Serna ◽

Antonio Mena-Bahena ◽

Emiliano Baranda-Cruz ◽

Mateo Vargas-Hernández ◽

...

Keyword(s):

Phaseolus Vulgaris ◽

Tap Water ◽

Wilt Disease ◽

Healthy Plant ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Fusarium Falciforme

Bean (Phaseolus vulgaris) is the second most important crop in Mexico after corn due to the high consumption of beans in all regions of the country. In the winter (January 2016), bean plants showing wilting, root discoloration and necrosis were observed, with an incidence of approximately 30% in different fields (<1 ha) in Tecoanapa, Guerrero State, Mexico. Symptomatic fine roots (<2 mm) were cut into 0.5 cm long pieces, washed with tap-water, surface disinfected with 1.5% NaOCl for 3 min, and rinsed with sterile distilled water. Thirty-five pieces were placed on potato dextrose agar (PDA, Difco) and incubated at 25 ℃ for seven days. Then, single-spore isolates were obtained. Colonies on PDA showed abundant white aerial mycelium and a growth rate of 4.5 mm/day, and in reverse, colonies were white/pink with a brown centre. Microconidia were cylindrical to ellipsoid, aseptate, hyaline and 7.8-(6.0)-4.7 × 2.7-(2.1)-1.6 µm. On carnation leaf agar, macroconidia were 37.8-(29.4)-23.5 × 4.1-(3.5)-2.6 µm, hyaline, falcate, with slightly curved apexes, and 3-5 septa. Chlamydospores were round, intercalary, hyaline, single or in chains (Boot 1971). A representative strain (CSAEGRO-AyDi-Ef) was analyzed by PCR and the translation elongation factor 1-alpha (tef1) gene (GenBank accession number MK945757) was sequenced using the EF-1/EF-2 primers (O’Donnell 2000). FUSARIUM-ID (Geiser et al. 2004) analysis showed 100% similarity with the Fusarium solani species complex (FSSC 3+4) strain NRRL28562. In addition, Bayesian phylogenetic analysis placed this strain in the Fusarium falciforme clade. A pathogenicity test was performed by immersing healthy plant roots (cv. Negro Jamapa) in 200 mL of a conidial suspension (50×106 conidia mL-1) for 10 min, and then transplanting the plants into pots. Control plants were immersed in sterile distilled water. Similar symptoms as those in the field were observed at 10 days after inoculation, and the controls were healthy. The fungus was reisolated from infected plants and showed the same morphology and tef1 sequence as the original isolate, fulfilling Koch’s postulates. Recently, F. falciforme was reported to cause wilting of P. vulgaris in Cuba (Duarte et al. 2019); however, this is the first report of F. falciforme (FSSC 3+4) causing wilt disease of P. vulgaris in Mexico. This species was previously reported in Mexico affecting onion (Tirado-Ramírez et al. 2018), papaya, tomato (Vega-Gutiérrez et al. 2019a, b), and maize (Douriet-Angulo et al. 2019), suggesting an ample host range in the country.

Download Full-text

First Report of Colletotrichum cereale Causing Anthracnose on Avena nuda in China

Plant Disease ◽

10.1094/pdis-10-20-2109-pdn ◽

2020 ◽

Author(s):

Na Zhao ◽

Junyu Yang ◽

Xiaoli Fang ◽

lingrui Li ◽

Hongfei Yan ◽

...

Keyword(s):

Morphological Characteristics ◽

Causal Agent ◽

Post Inoculation ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Fungal Isolates ◽

Colletotrichum Cereale ◽

Avena Nuda

Naked oats (Avena nuda L.) is rich in protein, fat, vitamin, mineral elements and so on, and is one of the world's recognized cereal crops with the highest nutritional and healthcare value. In July 2019, leaf spot was detected on A. nuda in Zhangbei experimental station of Hebei Agricultural University. The incidence of disease is 10% to 20%. The symptoms were similar to anthracnose disease, the infected leaves had fusiform or nearly fusiform yellowish-brown spots, yellow halo around the spots. Numerous acervuli with black setae diagnostic of fungi in the genus Colletotrichum were present on necrotic lesions. To identify the pathogen, ten symptomatic leaves were collected, and only one disease spot was isolated from each leaf. Small square leaf pieces (3 to 5 mm) were excised from the junction of diseased and healthy tissues with a sterile scalpel and surface disinfested with 75% alcohol for 30s, 0.1% corrosive sublimate for 1 min, rinsed three times in sterile water. Plant tissues were then transferred on potato dextrose agar (PDA), and incubated at 25°C for 7 days. Two fungal isolates were obtained and purified by single-spore isolation method. All fungi have the same morphology and no other fungi were isolated. The aerial mycelium was gray black. The conidia were colorless and transparent, falcate, slightly curved, tapered toward the tips, and produced in acervuli with brown setae. The length and width of 100 conidia were measured and size ranged from 1.86 to 3.84 × 8.62 to 29.81 μm. These morphological characteristics were consistent with the description of Colletotrichum cereale (Crouch et al. 2006). To further assess the identity of the species, the genomic DNA of two fungal isolates (LYM19-4 and LYM19-10) was extracted by a CTAB protocol. The ribosomal DNA internal transcribed spacer (ITS) region as well as, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), and the beta-tubulin 2 (Tub2) partial genes were amplified and sequenced with primers ITS4/5, GDF/GDR, ACT-512F/ACT-783R, and T1/Bt2b, respectively (Carbone et al. 1999; Templeton et al. 1992; O'Donnell et al. 1997; Glass et al. 1995). The sequences of the ITS-rDNA region (MW040121, MW040122), the GAPDH sequences (MW052554, MW052555), the ACT sequences (MW052556, MW052551) and the Tub2 sequences (MW052552, MW052553) of the two single-spore isolates were more than 99% identical to C. cereale isolate CGMCC3.15110 (JX625159, KC843517, KC843534 and JX625186). Maximum likelihood tree based on concatenated sequences of the four genes were constructed using MEGA7. The results showed the strains isolated from A. nuda were closely related to C. cereale, as supported by high bootstrap values. A pathogenicity test of the C. cereale isolates was performed on first unfolding leaves of A. nuda. Koch's postulates were carried out with isolates by spraying a conidial suspension of 106 conidia/mL on leaves of healthy A. nuda. Four replicated pots were inoculated at a time, 10 leaves each pot, while sterile distilled water was used as the control. All treated plants were placed in a moist chamber (25°C, 16-h light and 8-h dark period). Anthracnose symptoms developed on the inoculated plants 7 days post inoculation while all control plants remained healthy. Microscopic examination showed the surface of infected leaves had the same acervuli, setae, and conidia as the original isolate. The pathogenicity test was repeated three times. C. cereale was previously reported as the causal agent of anthracnose on feather reed grass in US (Crouch et al. 2009). To our knowledge, this is the first report of C. cereale as the causal agent of A. nuda anthracnose in China.

Download Full-text

First Report of Stemphylium solani as the Causal Agent of a Leaf Spot on Greenhouse Cucumber

Plant Disease ◽

10.1094/pdis-08-12-0776-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 287-287 ◽

Cited By ~ 5

Author(s):

D. J. Vakalounakis ◽

E. A. Markakis

Keyword(s):

Leaf Spot ◽

Natural Infection ◽

Apical Cell ◽

Morphological Characteristics ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

During the 2011 to 2012 crop season, a severe leaf spot disease of cucumber (Cucumis sativus) cv. Cadiz was noticed on crops in some greenhouses in the Goudouras area, Lasithi, Crete, Greece. Symptoms appeared in late winter, mainly on the leaves of the middle and upper part of the plants. Initially, small necrotic pinpoint lesions with white centers, surrounded by chlorotic halos, 1 to 3 mm in diameter, appeared on the upper leaf surfaces, and these progressively enlarged to spots that could coalesce to form nearly circular lesions up to 2 cm or more in diameter. Stemphylium-like fructifications appeared on necrotic tissue of older lesions. Severely affected leaves became chlorotic and died. No other part of the plant was affected. Small tissue pieces from the edges of lesions were surface disinfected in 0.5% NaClO for 5 min, rinsed in sterile distilled water, plated on acidified potato dextrose agar and incubated at 22 ± 0.5°C with a 12-h photoperiod. Stemphylium sp. was consistently isolated from diseased samples. Colonies showed a typical septate mycelium with the young hyphae subhyaline and gradually became greyish green to dark brown with age. Conidiophores were subhyaline to light brown, 3- to 10-septate, up to 200 μm in length, and 4 to 7 μm in width, with apical cell slightly to distinctly swollen, bearing a single spore at the apex. Conidia were muriform, mostly oblong to ovoid, but occasionally nearly globose, subhyline to variant shades of brown, mostly constricted at the median septum, 22.6 ± 6.22 (11.9 to 36.9) μm in length, and 15.1 ± 2.85 (8.3 to 22.6) μm in width, with 1 to 8 transverse and 0 to 5 longitudinal septa. DNA from a representative single-spore isolate was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) was amplified using the universal primers ITS5 and ITS4. The PCR product was sequenced and deposited in GenBank (Accession No. JX481911). On the basis of morphological characteristics (3) and a BLAST search with 100% identity to the published ITS sequence of a S. solani isolate in GenBank (EF0767501), the fungus was identified as S. solani. Pathogenicity tests were performed by spraying a conidial suspension (105 conidia ml–1) on healthy cucumber (cv. Knossos), melon (C. melo, cv. Galia), watermelon (Citrullus lanatus cv. Crimson sweet), pumpkin (Cucurbita pepo, cv. Rigas), and sponge gourd (Luffa aegyptiaca, local variety) plants, at the 5-true-leaf stage. Disease symptoms appeared on cucumber and melon only, which were similar to those observed under natural infection conditions on cucumber. S. solani was consistently reisolated from artificially infected cucumber and melon tissues, thus confirming Koch's postulates. The pathogenicity test was repeated with similar results. In 1918, a report of a Stemphylium leaf spot of cucumber in Indiana and Ohio was attributed to Stemphylium cucurbitacearum Osner (4), but that pathogen has since been reclassified as Leandria momordicae Rangel (2). That disease was later reported from Florida (1) and net spot was suggested as a common name for that disease. For the disease reported here, we suggest the name Stemphylium leaf spot. This is the first report of a disease of cucumber caused by a species of Stemphylium. References: (1) C. H. Blazquez. Plant Dis. 67:534, 1983. (2) P. Holliday. Page 243 in: A Dictionary of Plant Pathology. Cambridge University Press, Cambridge, UK, 1998. (3) B. S. Kim et al. Plant Pathol. J. 15:348, 1999. (4) G. A. Osner. J. Agric. Res. 13:295, 1918.

Download Full-text