scholarly journals A New Begomovirus Species Causing Leaf Curl Disease of Radish in India

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1053-1053 ◽  
Author(s):  
A. K. Singh ◽  
B. Chattopadhyay ◽  
P. K. Pandey ◽  
A. K. Singh ◽  
S. Chakraborty
Keyword(s):  
Sequence Analysis ◽  
Electron Microscopic Observation ◽  
Begomovirus Species ◽  
Infected Leaf ◽  
Electron Microscopic ◽  
Degenerate Primers ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Leaf curl disease of radish (RLCD) was observed for the first time in India in commercial fields and kitchen gardens of the Varanasi District and adjoining areas of eastern Uttar Pradesh during November 2003. Infected plants exhibited typical upward and downward leaf curling, leaf distortion, reduction of leaf area, and conspicuous enations on the underside of the leaves. Incidence of RLCD was estimated to be between 10 and 40% depending on the cultivars used. Electron microscopic observation revealed typical geminate particles in infected leaf samples. The causal virus could be transmitted to radish cv. Minu Early by whiteflies (Bemisia tabaci) and grafting. Inoculated plants developed symptoms similar to those observed in naturally infected radish plants. Viral DNA was isolated from artificially inoculated symptomatic radish plants (4) followed by concentration of super-coiled DNA by alkaline denaturation (1). The presence of a geminivirus was confirmed by PCR using DNA-A degenerate primers (3), and a 1.5-kb amplified product was obtained from six artificially and three naturally infected plants. Amplification of the full-length DNA-A was achieved using a primer combination derived from sequences obtained from a 1.5-kb amplicon. Amplification of 1.3-kb DNA-β sequences was achieved using specific primers (2) in three infected plants. Sequence analysis revealed that DNA-A (GenBank Accession No. EF 175733) contained 2,756 nt and DNA-β contained 1,358 nt (GenBank Accession No. EF 175734). DNA-A of the causal virus shares 87.7% identity with Tomato leaf curl Bangladesh virus (GenBank Accession No. AF 188481) and 62% identity with Mungbean yellow mosaic India virus (GenBank Accession No. AF126406). The begomovirus DNA-A sequence associated with RLCD contained seven open reading frames (AV1, AV2, AC1, AC2, AC3, AC4, and AC5). The DNA-β associated with RLCD shared the highest nucleotide sequence identity (84.9%) with DNA-β of Tobacco leaf curl virus isolate NIB 12-1 (GenBank Accession No. AJ316033) reported from Pakistan. Despite exhaustive attempts to amplify a putative viral B-component using degenerate primers based on the intergenic region sequence of the DNA-A or sequences that are highly conserved for other begomoviruses, no DNA-B component was detected. On the basis of DNA-A sequence analysis, the ICTV species demarcation criteria of 89% sequence identity, and genome organization, the virus causing RLCD should be considered a new Begomovirus species, for which the name Radish leaf curl virus (RLCV) is proposed. To our knowledge, this is the first report of the association of a Begomovirus with a disease of radishes in India. References: (1) H. C. Birnboim and J. Doly. Nucleic Acids Res. 7:1513, 1979. (2) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) K. M. Srivastava et al. J. Virol. Methods 51:297, 1995.

scholarly journals Identification of a New, Monopartite Begomovirus Associated with Leaf Curl Disease of Cotton in Gezira, Sudan

Plant Disease ◽  
2000 ◽  
Vol 84 (7) ◽  
pp. 809-809 ◽  
Author(s):  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Cotton Leaf ◽  
Degenerate Primers ◽  
Monopartite Begomovirus ◽  
Sequence Identity ◽  
Eastern Hemisphere ◽  
Cotton Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Begomoviral Species ◽  
Leaf Curl

Cotton leaf curl disease (CLCuD) was first reported in Sudan in 1931. Disease symptoms in cotton were characterized by vein thickening and leaf curling, and the suspect causal agent was shown to be transmitted by the whitefly Bemisia tabaci (Genn.) among cotton, okra, and several weed species (2). Although begomovirus etiology was suspected based on symptomatology and vector transmission, no evidence was available that confirmed or disputed this hypothesis. During 1994 to 1996, four cotton samples exhibiting typical CLCuD symptoms were collected from different fields in the Gezira region in Central Sudan and examined for presence of begomovirus DNA. Total nucleic acids were isolated from cotton plants and subjected to polymerase chain reaction (PCR) using degenerate primers (pAV 2644 and pAC 1154) to amplify begomovirus coat protein (Cp) gene and its flanking sequences (1). An amplicon of the expected size (1,300 bp) was obtained by PCR from each sample, and their nucleotide (nt) sequences were determined. Virus-specific primers designed around the Cp sequence were used to amplify an apparent full-length DNA component. Amplicons were cloned and their sequences were determined, yielding a begomoviral component of approximately 2,761 nt (AF260241). Despite exhaustive attempts to amplify a putative viral B-component using degenerate primers based on the intergenic region sequence of the putative “A-component,” or sequences that are highly conserved for other begomoviruses, no B component was detected. The four cotton isolates shared 99.9 to 100% nt sequence identity, and the number and arrangement of predicted open reading frames were similar to those known for other monopartite begomoviruses. Phylogenetic analysis of the putative CLCuV genome with other begomoviruses indicated that its closest relative was Althea rosea enation virus (AREV) from Egypt (AF014881) with which it shares 79% sequence identity, indicating that CLCuV is a unique begomovirus species with a probable origin in the Eastern Hemisphere. CLCuV shared 66% identity with its second closest relative, Cotton leaf curl virus-Pakistan (CLCuV-PK) (AJ002448). These data provide the first direct evidence for the association of a monopartite begomovirus with the leaf curl disease of cotton in Gezira, Sudan, that is distinct from all other begomoviral species described to date. Herein, we provisionally designate this unique begomoviral species as Cotton leaf curl virus from Sudan (CLCuV-SD). References: (1) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (2) A. M. Nour and J. J. Nour. Emp. Cott. Gr. Rev. 41:27, 1964.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals MOLECULAR IDENTIFICATION OF Pepper yellow leaf curl Indonesia virus ON CHILI PEPPER IN NUSA PENIDA ISLAND

2021 ◽  
Vol 21 (2) ◽  
pp. 97-102
Author(s):  
Dewa Gede Wiryangga Selangga ◽  
Listihani Listihani
Keyword(s):  
Sequence Analysis ◽  
Molecular Identification ◽  
Disease Incidence ◽  
Analysis Data ◽  
Chili Pepper ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Disease Symptoms ◽  
Leaf Curl Disease ◽  
Leaf Curl

Molecular identification of Pepper yellow leaf curl Indonesia virus on chili pepper in Nusa Penida Island. Pepper yellow leaf curl Indonesia virus (PYLCV) has been reported as caused yellow leaf curl disease in Bali Island since early 2012. Dominant symptoms of PYLCV infection in chili pepper were yellowing, leaf curl, yellow mosaic, and mottle. Bemisia tabaci, has been known to vector on the case yellow leaf curl disease. Observations on the Nusa Penida Island in 2020 showed symptoms such as yellow leaf curl disease, however, identification of PYLCV in Nusa Penida Island has not been studied. Molecular identification was conducted using polymerase chain reaction and sequence analysis. Data collected in this study was disease symptoms and disease incidence. The results showed that dominant disease symptoms caused by virus from Nusa Penida were yellow mosaic, yellowing, and mottle. Universal DNA fragments of 912 bp were successfully amplified from 50 leaf samples using Begomovirus degenerate primers SPG 1 (5’-CCCCKGTGCGWRAATCCAT-3’) and SPG 2 (5’ATCCVAA YWTYCAGGGAGCT-3’). Sequence analysis showed that the isolate from Nusa Penida was a Pepper yellow leaf curl Indonesia virus with a 98–100% homology with several reference isolates.

scholarly journals Three Previously Unidentified Begomoviral Genotypes from Tomato Exhibiting Leaf Curl Disease Symptoms from Central Sudan

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1209-1209
Author(s):  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Phylogenetic Analysis ◽  
Nucleotide Sequence ◽  
Nucleotide Sequence Identity ◽  
Degenerate Primers ◽  
Disease Symptoms ◽  
Old World ◽  
Sequence Identity ◽  
Central Sudan ◽  
Leaf Curl Disease ◽  
Leaf Curl

Field tomato plants exhibiting upward curling of leaflets, chlorosis, and stunting symptoms described for tomato leaf curl disease in Sudan (2) were collected in 1996 from Gezira (GZ) and Shambat (SH), Sudan. Disease symptoms were reproduced following experimental transmission of the causal agent(s) by the whitefly Bemisia tabaci from field tomato to virus-free tomato seedlings in a glasshouse at Gezira Research Station, Wad Medani, Sudan. Total nucleic acids were extracted from symptomatic tomato test plants. An ≈1.3-kbp fragment, diagnostic for begomovirus, was obtained from extracts by polymerase chain reaction using degenerate primers that amplify the coat protein gene (CP) and the respective flanking sequences for most begomoviuses (1). A second pair of degenerate primers was used to amplify a 2.3-kbp begomoviral fragment that overlaps both ends of the (CP) amplicon by >200 nt (1). At least 10 amplicons for each were cloned, and their sequences were determined, revealing three unique, tomato-infecting begomoviruses genotypes, two from GZ and one from SH. No B component was detected using degenerate primers that direct the amplification of a diagnostic fragment of the B component (1.4 kbp) for most bipartite begomoviruses. The organization of the three, apparently full-length viral genomes, was typical of other monopartite begomoviruses. A GenBank search revealed that the three viruses were previously undescribed. The GZ and SH tomato isolates are herein provisionally named ToLCV-GZ1 (GenBank Accession No. AY044137), ToLCV-GZ2 (GenBank Accession No. AY044138), and ToLCV-SH (GenBank Accession No. AY044139), respectively. All three tomato-infecting begomoviruses have identical stem-loop structures containing the conserved nonanucleotide motif characteristic of all members of the family Geminiviridae; however, the predicted Rep binding element located in the common region is unique for each virus. Phylogenetic analysis of the three viral sequences placed them in a large clade containing all other Old World begomoviruses. Distance comparisons among these and other well-studied begomoviruses indicated that ToLCV-GZ1 and ToLCV-SH shared an overall 90% nucleotide sequence identity, with ˜83% nucleotide sequence identity to ToLCV-GZ2. ToLCV-GZ1 and ToLCV-SH were 83% identical, with their closest relative, Tomato yellow leaf curl virus (TYLCV), while ToLCV-GZ2 shared 93% identity with TYLCV. The genomes of all three Sudan viruses contained regions of homologous nucleotide sequences, suggesting intermolecular exchange among these viruses. Exclusion of the homologous sequences (>800 nt) from the phylogenetic analysis indicated even lower shared nucleotide identities (<90%, the arbitrary cut-off for distinct species), which may warrant their classification as separate species. These three newly described begomoviruses are indigenous to central Sudan, and comprise a unique Old World lineage distinct from previously described begomoviruses associated with leaf curl disease of tomato in Africa and the Mediterranean Region. References: (1) A. M. Idris and J. K. Brown. Phytopathology 83:548, 1998. (2) A. M. Yassin. Trop. Pest Manage. 29:253, 1983.

scholarly journals A New Geminivirus Associated with a Yellow Leaf Curl Disease of Pepper in Thailand

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1047-1047 ◽  
Author(s):  
K. Samretwanich ◽  
P. Chiemsombat ◽  
K. Kittipakorn ◽  
M. Ikegami
Keyword(s):  
Sequence Similarity ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Stem Loop ◽  
Loop Region ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Pepper Plants ◽  
Leaf Curl

Pepper (Capsicum anuum) plants affected with yellow leaf curl disease were observed at Kanchanaburi in central Thailand in 1995. Three naturally infected pepper plants showing yellow leaf curl were collected and virus cultures maintained in pepper plants. Transmission experiments were carried out with the whitefly vector (Bemisia tabaci Genn.). Acquisition and inoculation threshold periods were 1 h and 30 min, respectively. The latent period was 10 h. Symptoms in cultured plants were the same as those observed in field plants. DNA was extracted from these cultured plants and amplified using polymerase chain reaction (PCR) with geminivirus-specific degenerate primers (1). A PCR product of 2.7 kbp was amplified and cloned. Three independent clones were sequenced and analyzed, and an identical 32-base stem loop region and the unique sequence (TGGGGTC) of putative Rep binding site were found in the intergenic region (IR). The B component could not be detected. The nucleotide sequence of the coat protein gene was compared with 28 well-studied whitefly-transmitted geminiviruses. Our geminivirus showed the highest sequence similarity (85%) with Tomato leaf curl virus from Taiwan (TwToLCV: GeneBank accession number U88692), suggesting that it is a new geminivirus. Therefore, it is designated Pepper yellow leaf curl virus. Reference: (1) M. R. Rojas et al. Plant Dis. 77: 340, 1993.

scholarly journals First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1056-1056 ◽  
Author(s):  
M. R. Rojas ◽  
T. Kon ◽  
E. T. Natwick ◽  
J. E. Polston ◽  
F. Akad ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Homologous Sequence ◽  
Yellow Leaf ◽  
First Report ◽  
Bona Fide ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

scholarly journals Evidence for the Association of a Bipartite Geminivirus with Tomato Leaf Curl Disease in Pakistan

Plant Disease ◽  
1997 ◽  
Vol 81 (8) ◽  
pp. 958-958 ◽  
Author(s):  
S. Mansoor ◽  
S. H. Khan ◽  
M. Saeed ◽  
A. Bashir ◽  
Y. Zafar ◽  
...  
Keyword(s):  
Tomato Leaf ◽  
Cotton Leaf ◽  
Degenerate Primers ◽  
Tomato Plants ◽  
Tomato Leaf Curl Disease ◽  
Eastern Hemisphere ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato leaf curl disease is the most important constraint on tomato production in Pakistan, where it is found throughout the country. The disease, which occurs in high incidence in Punjab and Sindh provinces, causes 30 to 40% yield losses in the spring crop and uneconomically high losses when grown as an autumn crop. The symptoms of the disease include upward or downward leaf curling, vein thickening, and stunting of the plant. The disease is transmitted by Bemisia tabaci whiteflies (non-B, biotype K) and is suspected to be caused by a geminivirus. For the detection of geminivirus, total DNA was extracted from infected plants, fractionated in an agarose gel, transferred to a nylon membrane, and Southern blotted. A full-length clone of DNA-A of cotton leaf curl virus from Pakistan (S. Mansoor, I. Bedford, M. S. Pinner, A. Bashir, R. Briddon, J. Stanley, Y. Zafar, K. A. Malik, and P. G. Markham, unpublished) was labeled with [32P]dCTP by the oligo-labeling method and hybridized at medium stringency. Geminivirus DNA forms that are normally found in infected plants were detected in plants with tomato leaf curl disease but not in healthy plants. To further confirm the presence of a whiteflytransmitted geminivirus, universal primers for dicot-infecting geminiviruses (1) were used in polymerase chain reaction (PCR) and a product of expected size (approximately 2.7 kb) was detected. The 2.7-kb PCR-amplified DNA from diseased tomato plants was labeled with [32P]dCTP and used as probe in Southern hybridization. This probe also detected geminivirus DNA forms at medium stringency. Both monopartite and bipartite geminiviruses transmitted by whiteflies have been reported to cause leaf curl symptoms on tomato from the Eastern hemisphere. Degenerate primers (PBLv2040 and PCRc1), which amplify B component DNA, were used to determine if tomato leaf curl was monopartite or bipartite (2). A product of expected size (0.65 kb) was amplified, suggesting this virus to be bipartite. DNA-B PCR product obtained from diseased tomato plants was hybridized as described above and detected geminivirus DNA forms at medium stringency. Samples of diseased tomato plants were collected from tomato fields throughout Punjab. DNA-A was detected in all 20 samples whereas DNA B was detected in 17 samples when hybridized by dot blot method at medium stringency. Our data show that tomato leaf curl virus from Pakistan is a bipartite geminivirus. This is the first evidence for a bipartite geminivirus in tomato plants from Pakistan. References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1993. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report and Molecular Characterization of DNA A of Three Distinct Begomoviruses Associated with Tomato Leaf Curl Disease in Ghana

Plant Disease ◽  
2008 ◽  
Vol 92 (11) ◽  
pp. 1585-1585 ◽  
Author(s):  
M. K. Osei ◽  
R. Akromah ◽  
S. L. Shih ◽  
L. M. Lee ◽  
S. K. Green
Keyword(s):  
Molecular Characterization ◽  
Tomato Leaf ◽  
Begomovirus Species ◽  
Sequence Comparisons ◽  
Tomato Leaf Curl Disease ◽  
Sequence Identity ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato leaf curl disease is reported to be widespread in Ghana and to cause severe yield losses (4). So far, the causal agent has not been identified. Thirty-three tomato (Solanum lycopersicum L.) samples with symptoms such as curling, yellowing, small leaves, and stunting were collected from the Ashanti Region, the main tomato-production area in Ghana, including three samples from Akumandan in the autumn of 2007 and 30 samples from Kumasi in the spring of 2008. The observed leaf curl disease incidence in the farmer's field in Kumasi was approximately 75%. Viral DNAs were extracted from the 33 samples and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR with previously described primers (1,3). The expected 1.4-kb DNA-A begomovirus fragment was obtained from one of the samples from Akumadan and from 25 samples from Kumasi. DNA-B and DNA-beta were not detected by PCR. The 1.4-kb PCR products from all positive samples were cloned and sequenced. Sequence comparison by MegAlign software (DNASTAR, Inc., Madison, WI) showed three distinct virus groups. One isolate from each group was selected and specific primers were designed to complete the DNA-A sequence. The DNA-As of GH5-3 (group 1), GOTB2-2 (group 2), and GHK2 (group 3) isolates consisted of 2,803 (GenBank Accession No. EU350585), 2,794 (GenBank Accession No. EU847739), and 2,792 nt (GenBank Accession No. EU847740) respectively. All contain the geminiviral conserved nonanucleotide sequence TAATATTAC in the intergenic region and the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). BLASTn analysis was conducted with geminivirus sequences available in the GenBank database at National Center for Biotechnology Information (Bethesda, MD). Further sequence comparisons were performed by Clustal V algorithm of MegAlign software with the representative isolates of begomovirus species reported by Fauquet et al (2) and the sequences that showed high scores in BLASTn search. The DNA-A sequence of isolate GHK2 from Kumasi showed highest sequence identity (96.5%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accesssion No. AY502934). The DNA-A sequence of GH5-3 and GOTB2-2 isolates had 87.5% sequence identity with each other. Both had highest sequence identities of 76.7 and 77.6%, respectively, with Tomato leaf curl Antsiranana virus, Madagascar (GenBank Accession No. AM701764). They constitute two distinct begomovirus species based on DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity. The names Tomato leaf curl Ghana virus for isolate GH5-3 and Tomato leaf curl Kumasi virus for isolate BOTB2-2 are proposed, respectively. To our knowledge, this is the first report of molecular characterization of begomoviruses associated with tomato leaf curl disease in Ghana and of the presence of three distinct tomato begomoviruses. This presence should be considered for recommending or developing stable begomovirus resistant tomato cultivars for Ghana. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) C. M. Fauquet et al. Arch. Virol. 153:783, 2008. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) D. Horna et al., eds. Online publication. Int. Food Policy Res. Inst. PBS Policy Brief 2, 2007.

scholarly journals Association of a Begomovirus and Nanovirus-like Molecule with Ageratum Yellow Vein Disease in Pakistan

Plant Disease ◽  
2000 ◽  
Vol 84 (1) ◽  
pp. 101-101 ◽  
Author(s):  
S. Mansoor ◽  
S. H. Khan ◽  
M. Hussain ◽  
Y. Zafar ◽  
M. S. Pinner ◽  
...  
Keyword(s):  
Full Length ◽  
Yellow Vein ◽  
Cotton Leaf ◽  
Degenerate Primers ◽  
Total Dna ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Vein Disease ◽  
Full Length Clone ◽  
Leaf Curl

Whitefly-transmitted geminiviruses (begomoviruses) cause heavy losses to many food and fiber crops in Pakistan. Many weeds also show symptoms typical of begomoviruses. Ageratum (Ageratum conyzoides) is a common perennial weed in Pakistan, growing along irrigation canals, that often shows symptoms, such as yellow vein and mosaic, suggesting infection by a begomovirus. To confirm this, symptomatic and asymptomatic ageratum plants were collected from three locations in the Punjab Province of Pakistan, and total DNA was isolated, subjected to agarose gel electrophoresis, transferred to a nylon membrane, and Southern blotted. Total DNA isolated from cotton infected with Cotton leaf curl virus (CLCuV), tomato infected with Tomato leaf curl virus from Pakistan (TLCV-Pak), tobacco infected with African cassava mosaic virus (ACMV) from Nigeria, and healthy tobacco were included as controls. A full-length clone of CLCuV DNA A was labeled with [32P]dCTP by oligo-labeling and hybridized at medium stringency. The probe detected characteristic geminivirus DNA forms in symptomatic ageratum and plants infected with CLCuV, TLCV-Pak, and ACMV, while no signal was detected in asymptomatic ageratum from the field or healthy tobacco. To confirm infection by a begomovirus, degenerate primers WTGF (5′-GATTGTACGCGTCCDCCTTTAATTT GAAYBGG-3′), designed in the rep gene of begomoviruses, and WTGR (5′-TANACGCGTGGC TTCKRTACATGGCCTDT-3′), designed in the coat protein gene of DNA A of begomoviruses, were used in polymerase chain reaction (PCR). Degenerate primers (PBLv2040 and PCRc1) also were used in PCR (2). A product of expected size (≈1.4 kb) was obtained with DNA A primers from symptomatic ageratum, while no product was obtained with DNA B primers in the same sample. Previously we were unable to detect a DNA component equivalent to begomovirus DNA B in cotton showing symptoms of cotton leaf curl disease (1). We recently reported a novel circular DNA molecule that was approximately half as long as the full-length DNA A (CLCuV DNA-1) associated with CLCuV that share homology to plant nanoviruses (1). The supercoiled replicative form of viral DNA isolated from infected ageratum plants indicated the presence of smaller molecules, as was found in cotton leaf curl disease, suggesting that a nanovirus-like molecule might be associated with ageratum yellow vein disease. A duplicate blot of samples used in Southern hybridization with the DNA A probe was prepared, and a probe of the full-length clone of the nanovirus-like molecule (CLCuV DNA-1) was prepared as described for DNA A. The probe detected characteristic nanovirus DNA forms in ageratum with yellow vein symptoms and cotton infected with CLCuV, while no signal was detected in plants infected with TLCV-Pak or ACMV, healthy tobacco, or asymptomatic ageratum. Abutting primers PB2-F and PB2R (1), designed based on the CLCuV DNA-1 sequence, were unable to amplify a PCR product from ageratum with yellow vein symptoms, suggesting the nanovirus-like molecule associated with ageratum yellow vein disease is distinct from CLCuV DNA-1. Our results show that yellow vein disease of ageratum in Pakistan is associated with a begomovirus infection and single-stranded circular DNA molecule with similarity to CLCuV DNA-1. References: (1) S. Mansoor et al. Virology 259:190, 1999. (2) M. R. Rojas et al., Plant Dis. 77:340, 1993.

scholarly journals Leaf Curl Disease of Carica papaya from India May Be Caused by a Bipartite Geminivirus

Plant Disease ◽  
1998 ◽  
Vol 82 (1) ◽  
pp. 126-126 ◽  
Author(s):  
Sangeeta Saxena ◽  
Vipin Hallan ◽  
B. P. Singh ◽  
P. V. Sane
Keyword(s):  
Southern Blot ◽  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Dna Probes ◽  
Economic Losses ◽  
Degenerate Primers ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Papaya has considerable economic importance to agriculture in India. Papaya leaf curl disease was first reported in 1939 by Thomas and Krishnaswamy (3). This disease is of moderate incidence and widely distributed in India. Recent observations of papaya fields in India indicated that there has been a continued increase in the incidence of papaya leaf curl disease (as shown by symptoms), resulting in severe economic losses. The disease is characterized by downward curling and cupping of leaves followed by vein clearing and thickening. Enations develop in the form of frills on green veins. The affected leaves become leathery and brittle and the petioles become twisted in a zig-zag manner. Diseased plants may bear a few small fruits, which are distorted in shape and tend to fall prematurely. The disease could be transmitted by the whitefly Bemisia tabaci Genn. Therefore, possible involvement of a geminivirus was suspected. Three different cloned geminiviral DNAs, Indian tomato leaf curl virus (ITLCV) (2), tomato yellow leaf curl virus from Sardinia (TYLCV Sar), and tomato golden mosaic virus (TGMV), were used as probes (with radioactive labeling) to detect the presence of geminiviral DNA from infected papaya tissue in both slot-blot and Southern blot hybridization studies with high stringency washes. These DNA probes gave strong signals with DNA isolated from infected papaya tissue whereas they did not give any signals with DNA from healthy tissue. Further, successful polymerase chain reaction (PCR)-based amplification of fragments from both DNA-A and DNA-B components with geminivirus degenerate primers (1) was accomplished only from the DNA of infected papaya plants. The PCR-amplified DNA fragments gave positive signals in Southern blot hybridization with the three geminiviral DNA probes. These results suggest that the causal agent of papaya leaf curl disease is a bipartite geminivirus that may be provisionally called papaya leaf curl virus (PLCV). References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) K. M. Srivastava et al. J. Virol. Methods 51:297, 1995. (3) K. M. Thomas and C. S. Krishnaswamy. Curr. Sci. 8:316, 1939.

Sign in / Sign up

Export Citation Format

Share Document