scholarly journals First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States

Plant Disease ◽  
2009 ◽  
Vol 93 (4) ◽  
pp. 432-432 ◽  
Author(s):  
I. E. Tzanetakis ◽  
T. L. Guzmán-Baeny ◽  
Z. P. VanEsbroeck ◽  
G. E. Fernandez ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Southeastern United States ◽  
Yellow Vein ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Reverse Transcription Pcr

Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic ‘Apache’ blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5′ GATCTGTCCTGGGATTGTTC 3′) and INSVR (5′ GTCTCCTTCTGGTTCTATAATCAT 3′) that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.

scholarly journals First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽  
2004 ◽  
Vol 88 (7) ◽  
pp. 771-771 ◽  
Author(s):  
N. Martínez-Ochoa ◽  
S. W. Mullis ◽  
A. S. Csinos ◽  
T. M. Webster
Keyword(s):  
Southeastern United States ◽  
Impatiens Necrotic Spot Virus ◽  
Cyperus Esculentus ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Black Shank ◽  
Purple Nutsedge ◽  
Yellow Nutsedge ◽  
Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

Distribution of an Invasive Weevil, Pseudocneorhinus bifasciatus Roelofs, in the Southeastern United States

2005 ◽  
Vol 40 (1) ◽  
pp. 25-30 ◽  
Author(s):  
A. G. Wheeler ◽  
David W. Boyd
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
North America ◽  
Southeastern United States ◽  
Ornamental Plants ◽  
Review Of The Literature ◽  
Northeastern United States

The twobanded Japanese weevil, Pseudocneorhinus bifasciatus Roelofs, first found in North America near Philadelphia, PA, in 1914, is better known in the northeastern United States than in the Southeast. Based on examination of specimens in 11 museums, fieldwork, and review of the literature, we document the presence of this pest of ornamental plants in Alabama (3 counties), Georgia (12), North Carolina (16), and South Carolina (19). The southeastern distribution is mapped, and locality and date are provided for the first collection in each state: North Carolina, 1955; Georgia, 1956; South Carolina, 1966; and Alabama, 1970.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1248-1248 ◽  
Author(s):  
S. T. Koike ◽  
Y.-W. Kuo ◽  
M. R. Rojas ◽  
R. L. Gilbertson
Keyword(s):  
Frankliniella Occidentalis ◽  
Disease Incidence ◽  
Pcr Analysis ◽  
Impatiens Necrotic Spot Virus ◽  
Vegetable Crops ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Monterey County

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

scholarly journals Southeastern Tomato Growers Adopt Integrated Pest Management

1998 ◽  
Vol 8 (1) ◽  
pp. 40-44 ◽  
Author(s):  
Ellen M. Bauske ◽  
Geoffrey M. Zehnder ◽  
Edward J. Sikora ◽  
Joseph Kemble
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Integrated Pest Management ◽  
Pest Management ◽  
Government Regulation ◽  
Tomato Fruit ◽  
Southeastern United States ◽  
Fresh Market ◽  
Production Problems

Multidisciplinary integrated pest management (IPM) teams from seven states in the southeastern United States (Alabama, North Florida, Georgia, Kentucky, North Carolina, South Carolina, and Tennessee) met to develop standards for adopting IPM in fresh-market tomato (Lycopersicon esculentum L.) production. Teams were composed of growers, private consultants, extension personnel, and faculty. IPM practices available for use on tomatoes in the southeastern United States were identified and a survey to assess the current level of adoption of IPM practices was developed. The survey also allowed growers to identify insect, disease, and production problems; beneficial technology and research developments; and other information relevant to IPM adoption. In northern Florida, Georgia, Kentucky, North Carolina, and South Carolina, IPM adoption by tomato growers was classified as medium or high on >75% of the fresh-market tomato acreage surveyed. It appears these states may have met the federal mandate for IPM adoption. Tomato producers listed early blight, late blight, bacterial spot, bacterial speck, and bacterial wilt as the main disease problems; tomato fruit worm, thrips, and aphids as the primary insect problems; and poor weather conditions, government regulation, and labor as their primary production problems. Twenty-six percent of the producers throughout the region felt that the development of insect- and disease-resistant varieties would be most helpful to increase production.

scholarly journals First Report of Tobacco ringspot virus in Blackberry (Rubus sp.) in Alabama

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708 ◽  
Author(s):  
E. Coneva ◽  
J. F. Murphy ◽  
R. Boozer ◽  
N. Velásquez
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Virus Infection ◽  
The United States ◽  
Negative Control ◽  
Ringspot Virus ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Control Samples

In 2006, primocane stunted growth and crumbly berry development were observed on 4-year-old Kiowa and Apache blackberry cultivars grown at the Chilton Research and Extension Center, Clanton, AL. Samples from affected plants were tested for virus infection by ELISA kits (Agdia, Inc., Elkhart, IN) specific to each of 14 different viruses. Most samples tested positive for Tobacco ringspot virus (TRSV). TRSV was detected in blackberry samples from North Carolina and South Carolina (2). Bray et al. (1) studied the incidence of viruses in blackberry nursery stock in the United States and reported that 9% of the tested samples contained TRSV. Thus, a survey was conducted for TRSV incidence among commercial blackberry stands in eight counties in Alabama during July 2007. Blackberry plants were observed to express virus-like symptoms including chlorotic spots on leaves, leaf veinal chlorosis, stunting, and combinations thereof. Fruit-bearing plants sometimes had crumbly fruit symptoms characteristic of virus infection. Leaf samples that were collected from symptomatic and nonsymptomatic plants representing 14 cultivars were tested by TRSV ELISA (Agdia, Inc.). Of 180 blackberry samples, 68 tested positive for TRSV. Positive ELISA reactions for TRSV were on average 28 times greater than the reactions of known negative control samples considered negative for TRSV. Blackberry plants shown to be infected with TRSV during the 2007 survey were tested in July 2008 in an effort to confirm the presence of TRSV. Fifty-four percent of the samples tested positive by ELISA with the average positive ELISA value being 21 times higher than the average negative ELISA value for known negative control samples. To further confirm the occurrence of TRSV in Alabama-grown blackberry plants, leaf samples were tested by reverse transcription (RT)-PCR to amplify a 329-bp fragment of the viral coat protein gene (TRSV RNA 2 sequence accession no. NC_005096; primers TRSCP-F (5′-TCTGGCACTATAAGCGGAAG-3′) and TRSCP-R (5′-GAAAACATGGGAGGATGCAC-3′). A single band of the anticipated size was amplified (analyzed by agarose gel electorphoresis and visualized by ethidium bromide staining) from RNA samples extracted with a RNeasy Mini kit (Qiagen, Valencia, CA) from blackberry samples that tested positive for TRSV by ELISA and a known positive control. No amplified product resulted from a blackberry sample that tested negative for TRSV by ELISA. These results illustrate and confirm the presence of TRSV in blackberry leaf tissues grown in Alabama. To our knowledge, this is the first report of TRSV infection of blackberry plants in Alabama. References: (1) M. M. Bray et al. HortScience 40:874, 2005. (2) T. L. Guzmán-Baeny. Incidence, distribution, and symptom description of viruses in cultivated blackberry (Rubus subgenus Eubatus) in the southeastern United States. M.S. thesis, North Carolina State University, Raleigh, 2003.

First Report on the Incidence of Mixed Infections of Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) in Tobacco Grown in Georgia, South Carolina, and Virginia

2003 ◽  
Vol 4 (1) ◽  
pp. 40 ◽  
Author(s):  
N. Martínez-Ochoa ◽  
A. S. Csinos ◽  
E. B. Whitty ◽  
A. W. Johnson ◽  
M. J. Parrish
Keyword(s):  
South Carolina ◽  
Tomato Spotted Wilt Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Mixed Infections ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Greenhouse Production ◽  
Tomato Spotted Wilt ◽  
Serious Disease ◽  
Wilt Virus

Tomato spotted wilt caused by Tomato spotted wilt virus (TSWV) continues to be a serious disease problem on tobacco (Nicotiana tabacum L.), peanut (Arachis hypogaea L.), tomato (Lycopersicon esculentum Mill.), and pepper (Capsicum annum L.) in the southeastern United States. Impatiens necrotic spot virus (INSV, formerly known as TSWV-I) is an emerging virus found mostly in greenhouse production of ornamentals and is also vectored by thrips. A few years ago INSV was detected in peanut in Georgia and Texas and its occurrence appears to be increasing). Mixed infections of TSWV and INSV in tobacco have been observed within the last two years in North Carolina and Kentucky. Our objective was to sample several locations in Georgia, Florida, South Carolina and Virginia to confirm and report the presence of natural TSWV and INSV mixed infections in tobacco. Accepted for publication 14 March 2003. Published 17 April 2003.

scholarly journals First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece

Plant Disease ◽  
2020 ◽  
Vol 104 (10) ◽  
pp. 2742-2742
Author(s):  
D. Beris ◽  
I. Malandraki ◽  
O. Kektsidou ◽  
N. Vassilakos ◽  
C. Varveri
Keyword(s):  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report

scholarly journals First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 357-357 ◽  
Author(s):  
M. Ding ◽  
Y. Yin ◽  
Q. Fang ◽  
S. Li ◽  
Z. Zhang
Keyword(s):  
Sandwich Elisa ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Natural Occurrence ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Severe Stunting ◽  
Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

Sign in / Sign up

Export Citation Format

Share Document